Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Томатный корень Преобразование После прививки с Ralstonia Solanacearum для straightforward генетического анализа бактериальной болезни Wilt

doi: 10.3791/60302 Published: March 11, 2020

Summary

Здесь мы представляем универсальный метод для преобразования корня томатов после прививки с Ralstonia solanacearum для выполнения простого генетического анализа для изучения бактериального заболевания увядания.

Abstract

Ralstonia solanacearum является разрушительным почвенных сосудистых патогенов, которые могут инфицировать большой спектр видов растений, вызывая важную угрозу для сельского хозяйства. Тем не менее, модель Ralstonia значительно недостаточно изучена по сравнению с другими моделями с участием бактериальных растительных патогенов, таких как Pseudomonas шприцев в Arabidopsis. Исследования, направленные на понимание взаимодействия между Ralstonia и растениеводства имеет важное значение для разработки устойчивых решений для борьбы с бактериальной болезнью увядания, но в настоящее время препятствует отсутствие простых экспериментальных анализов для характеристики различных компонентов взаимодействия в местных растений-хозяев. В этом сценарии, мы разработали метод для выполнения генетического анализа Ralstonia инфекции помидоров, естественный хозяин Ralstonia. Этот метод основан на агробактерии rhizogenes-опосредоченнойтрансформации томатных корней, а затем Ralstonia почво-заливание прививки результирующих растений, содержащие преобразованные корни, выражающие конструкцию интереса. Универсальность ассея преобразования корня позволяет выполнять либо генную переэкспрессию, либо заглушку генов, опосредованные РНК. В качестве доказательства концепции, мы использовали этот метод, чтобы показать, что РНК-опосредованного замалчивания SlCESA6 в томатных корней присваивал сопротивление Ralstonia. Здесь мы подробно описываем этот метод, позволяющий генетическим подходам понимать бактериальное заболевание увядание за относительно короткое время и с небольшими требованиями оборудования и пространства роста растений.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum, причинно-следственный агент бактериального увядания болезни, является разрушительным почвенных сосудистых патогенов с мировым распространением, которые могут заразить широкий спектр видов растений, в том числе картофель, помидоры, табак, банан, перец и баклажаны, среди других1,2. Потери урожайности, вызванные Ralstonia может достигать 80-90% производства в томате, картофеле или банане, в зависимости от сорта, климата, почвы и других факторов3. Тем не менее, модель Ralstonia значительно недостаточно изучена по сравнению с другими моделями с участием бактериальных растительных патогенов, таких как Pseudomonas шприцев или Xanthomonas spp. Кроме того, большинство исследований в растительно-микробных взаимодействий сосредоточены на модели завода Arabidopsis thaliana. Хотя исследования с использованием этих моделей в значительной степени способствовали нашему пониманию взаимодействия растений и бактерий, они не решают текущую необходимость понять эти взаимодействия в растениеводстве. Исследования, направленные на понимание взаимодействия между Ralstonia и растениеводства имеет важное значение для разработки устойчивых решений для борьбы с бактериальными болезнями увядания, но в настоящее время препятствует отсутствие простых экспериментальных анализов для характеристики различных компонентов взаимодействия. В частности, помидор, естественный хозяин для Ralstonia, является вторым по значимости овощной культурой во всем мире и зависит от множества заболеваний4, в том числе бактериальной болезни увядания. В этой работе мы разработали простой метод для выполнения генетического анализа инфекции Ralstonia помидоров. Этот метод основан на Agrobacteriumrhizogenes-опосредоченной трансформации томатных корней, используя DsRed флуоресценции в качестве маркера отбора5, а затем Ralstonia почво-залитой прививки результирующих растений, содержащих преобразованные корни, выражающие конструкцию интереса. Универсальность ассея преобразования корня позволяет выполнять либо генную переэкспрессию, либо заглушку генов, опосредованные РНК.

Потенциальное ограничение этого метода заключается в остаточном росте непреобразованных корней. Это особенно важно в тех случаях, когда плазмида используется не хватает репортера гена, который позволяет выбор преобразованных корней. Для решения этой проблемы мы разработали альтернативный метод, основанный на отборе антибиотиков, который тормозит рост непреобразованных корней, позволяя при этом расти здоровыми устойчивыми к антибиотикам трансформированными корнями. Так как A. rhizogenes не вызывает трансформацию побегов, они восприимчивы к антибиотику, и, следовательно, они должны быть отделены от антибиотикосодержащей среды.

Хотя сопротивление растений против Ralstonia не очень хорошо понимается, несколько докладов связаны изменения клеточной стенки к повышенной устойчивости к бактериальной увядание6,7,8,9. Было высказано предположение, что эти изменения клеточной стенки влияют на развитие сосудов, важным аспектом для образа жизни Ralstonia внутри растения10. Мутации в генах, кодирующих целлюлозные синтазы CESA4, CESA7 и CESA8 в Arabidopsis thaliana, как было показано, ухудшают целостность вторичной клеточной стенки, вызывая повышенную устойчивость к Ralstonia, который, как представляется, связан с ABA сигнализации8. Таким образом, в качестве доказательства концепции для нашего метода, мы выполнили РНК-опосредованного гена глушить SlCESA6 (Solyc02g0722240), вторичные клеточной стенки целлюлозы синтазы, и орфогирование AtCESA8 (At4g18780). Последующие почво-заливание прививки с Ralstonia показали, что заглушая SlCESA6 повышенной устойчивостью к бактериальным симптомам увядания, предполагая, что клеточная стенка опосредованного сопротивления Ralstonia, вероятно, сохраняется в томатах, и проверки нашего метода для проведения генетического анализа бактериальной устойчивости увядания в томатных корней. Здесь мы подробно описываем этот метод, позволяющий генетическим подходам понимать бактериальное заболевание увядание за относительно короткое время и с небольшими требованиями оборудования и пространства роста растений.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ПРИМЕЧАНИЕ: Важные части этого метода включают обработку растительных материалов in vitro, и поэтому важно поддерживать стерильные условия во время всех этих процедур, включая визуализацию фторесценции DsRed. В течение всего процесса преобразования, саженцы томатов растут на 25-28 c и 16 h/8 h свет/темный (130 фотонов м-2s-1 свет). Плиты запечатываются микропорелентной лентой для облегчения газообмена и транспирации.

1. Приготовление томатных растений и агробактерии ризогенов

  1. Стерилизовать семена томатов(Solanum lycopersicum cv. Moneymaker, LA2706, Томатный генетика Ресурсный центр, TGRC) с 5% (v/v) гипохлорит натрия в течение 5 мин. Вымойте 4-5 раз дистиллированной стерильной водой и держать семена медленно трясутся в стерильной воде в течение ночи, чтобы облегчить прорастание.
  2. Перенесите семена помидоров в половину прочности Мурашиге и Скуг (1/2 MS) среды без сахарозы (2,21 г / л MS, 8% ж / V агар). Держите семена в темноте при 25-28 градусах По Цельсия в течение трех дней(рисунок 1А).
    ПРИМЕЧАНИЕ: Около 40 семян, как правило, необходимы для каждой конструкции.
  3. Автоклав 8,5 см2 квадратных фильтра бумаги. Поместите квадратные фильтровальные бумаги внутри 9 см2 квадратных петри блюда, содержащие 1 '2 MS среды (место бумаги на вершине агара) и место шесть проросшие семена помидоров на каждой тарелке(Рисунок 1B). Запечатайте тарелку микропорой лентой и инкубируем проросшие семена при 25–28 градусах Цельсия в течение 3–4 дней.
  4. Выращивайте агробактерии rhizogenes MSU440 в твердой среде LB (с соответствующими антибиотиками) при 28 градусах Цельсия за два дня до превращения растений.
    ПРИМЕЧАНИЕ: A. rhizogenes предоставляется д-р Хуан Антонио Лопес Реес, ЭЭЗ-CSIC, Гранада, Испания. В эксперименте, описанном в этой статье, были использованы а. rhizogenes, содержащий pK7GWIWG2_II-RedRoot::CESA6 или пустой вектор, как контроль. pK7GWIWG2_II-RedRoot содержит ген репортера, DsRed, движимый арабидопсис thaliana ubiquitin промоутер(pAtUB-10), и придает устойчивость к спектромицин (50 мкг/мл). Можно использовать другие векторы для экспрессии генов, как сообщалось до5. В этой работе, усиление конкретного фрагмента для SlCESA6 глушитель был получен путем обратной транскрипции (RT) PCR с использованием РНК изолированы от помидора (S. lycopersicum cv. Moneymaker) и ligated в p-ENTR/D-TOPO вектор (Таблица 1). Впоследствии фрагмент SlCESA6-RNAi был клонирован в бинарный вектор pK7GWIWG2_II-RedRoot.

2. Преобразование и выбор растений

  1. Используя стерильный скальпель, вырезать радикль и дно гипокотила саженцев помидоров(рисунок 1C,D).
  2. Урожай A. rhizogenes биомассы с поверхности среды LB с помощью пластиковых наконечников или скальпеля лезвие и осторожно окунуть нарезанные саженцы помидоров в бактериальной биомассы (Рисунок 1E).
  3. После прививки с A. rhizogenes,покрыть саженцы помидоров с 2 см х 4 см полукруглой фильтровальной бумагой(Рисунок 1F), для того, чтобы сохранить высокую влажность и облегчить выживание и новые корни развития.
  4. Храните преображеную саженцы помидоров в течение 6-7 дней. Затем используйте стерильный скальпель, чтобы вырезать новые новые волосатые корни(рисунок 1G,H;на этом этапе корни еще не преобразились) и позвольте саженцы производить новые волосатые корни.
  5. Как только появляются новые волосатые корни(рисунок 1I),удалите фильтровальную бумагу поверх саженцев и снова запечатайте тарелку микропоревой лентой.
    ПРИМЕЧАНИЕ: На данный момент наличие флуоресцентного маркера DsRed в векторе трансформации позволяет визуализировать эффективность преобразования в новых корнях.
  6. Для визуализации dsRed флуоресценции, используйте стереомикроскоп или любое другое оборудование для изображения растительного виво(рисунок 1J). Отметьте положительные (красная флуоресценция) преобразуйте корни и удалите отрицательные непреобразованные корни (без красной флуоресценции) с помощью стерильного скальпеля.
  7. Передача саженцев с красной флуоресценцией на новую пластину, содержащую 1/2 MS среды, для того, чтобы облегчить развитие преобразованного корня в качестве основного корня (Рисунок 1K). Держите саженцы, которые не показывают красную флуоресценцию в той же пластине, чтобы проверить появление флуоресцентных корней(Рисунок 1L) в более поздних точках времени.
  8. Альтернативный метод, основанный на выборе антибиотиков
    1. Альтернатива шагу 2.5, приготовьте полузаполненные 9 см2 квадратных пластины, содержащие 1/2 MS среды с соответствующим антибиотиком. Выщелачивайте пластины примерно на 5 градусов в процессе подготовки для создания пустого пространства без среды(рисунок 2А),что позволяет побегам расти, избегая контакта с антибиотиком.
    2. Альтернатива шагу 2.6, после резки первых непреобразованных волосатых корней появились (шаг 2.4), перенесите саженцы без корней на полузаполненные пластины с помощью фильтровальных бумаг с соответствующим размером(рисунок 2B).
      ПРИМЕЧАНИЕ: В качестве положительного контроля рекомендуется преобразовать несколько саженцев с плазмид, содержащий ту же резистентность к антибиотикам и ген репортера (в этом протоколе, pK7GWIWG2_II-RedRoot; канамицин 50 мкг/мл).
    3. Альтернатива шагу 2.7, пусть саженцы развивать новые волосатые корни и сократить те корни, которые не находятся в непосредственном контакте с поверхностью фильтра сэндвич бумаги, так как эти корни могут избежать выбора антибиотиков.
      ПРИМЕЧАНИЕ: Из-за эффекта антибиотика, развитие корня может быть медленнее, чем в тарелках без антибиотиков. Новые преобразованные волосатые корни появляются в течение 14–18 дней после переноса саженцев без корней на полузаполненные пластины (шаг 2.8.2)(рисунок 2C-E).
  9. Накройте саженцы полукруговой фильтрующей бумагой 2 см х 4 см, запечатайте тарелку и насижайте саженцы, чтобы дать им развить новые волосатые корни.
    ПРИМЕЧАНИЕ: Нет необходимости устранять А. rhizogenes с помощью антибиотиков. Фильтровная бумага поверх среды MS и отсутствие сахарозы препятствуют распространению Ризогенов A. на пластине5.
  10. Через пять-семь дней после первого отбора корней повторите процесс отбора, чтобы выбрать новые преобразованные корни и удалить непреобразованные корни. Перенесите саженцы, содержащие трансформированные корни, в новую пластину, содержащую 1/2 мс среды.

3. Перевод на прививки горшки

  1. Приготовьте прививочные горшки, где поверхность корней будет подвергаться воздействию бактериального инокулума: замочите прививочные горшки с водой, слейте излишки воды и поместите их в пластиковый посадочный лоток. Перенесите выбранные саженцы с преобразованными корнями в прививочной горшки с помощью пинцета(рисунок 3А).
  2. Обложка лоток с полиэтиленовой пленкой или прозрачной крышкой и держать их на 25-28 C и 65% влажности (16 ч/8 ч свет /темный; 130 моль фотонов м-2s-1 свет), для поддержания высокого уровня влажности Рисунок 3B). Снимите крышку через пять или шесть дней.
    ПРИМЕЧАНИЕ: Преобразованные томатные растения готовы к прививке через две-три недели после переноса их в почву(рисунок 3C). Во время роста на почве, томатные растения могут производить новые корни, которые не преобразуются. Чтобы определить масштабы этого явления, красная флуоресценция была визуализирована в корнях 3-недельных преобразованных томатных растений. Большинство корней (80%-100%) показал красную флуоресценцию, указывая, что они действительно преобразованы(Рисунок 3D, E).

4. Прививка, пропитанная почвой

  1. Расти R. solancearum (напряжение GMI1000 в этом протоколе) в фи жидкой среде(Таблица 211) в орбитальной шейкер (200 об/ ч) при 28 градусах Цельсия до стационарной фазы.
  2. Определить бактериальные числа путем измерения оптической плотности бактериальной культуры на 600 нм (OD600). Разбавить бактериальную культуру водой до OD600 0.1 (в условиях, используемых здесь, это соответствует примерно 108 колоний формирования единиц (CFU)/mL).
  3. Поместите в прививочной лоток прививки от 16 до 20 см, содержащую преобразованные томатные растения; Рисунок 4А).
  4. Налейте 300 мл (15 мл на растение) бактериального инокулума (OD600 из 0,1) в лоток, содержащий прививочные горшки. Пусть они впитывают сявок в течение 20 мин(рисунок 4B).
  5. Подготовьте новый лоток со слоем почвы для заливки. Переместите привитые горшки в новый лоток(рисунок 4C) и поместите лотки в камеру роста с 75% влажности, 26-28 градусов по Цельсию, и фотопериод 12 ч света и 12 ч темноты (130 фотонов м-2s-1 свет).

5. Определение параметров инфекции и статистический анализ

  1. Оценка симптомов болезни, как ранее описано12,13, используя шкалу от 0 (без симптомов) до 4 (полное увядание) (Рисунок 4D-H), каждый день после прививки Ralstonia в течение двух недель.
    ПРИМЕЧАНИЕ: Данные индекса болезни собираются из одного и того же экспериментального блока (каждого растения) с течением времени.

6. Анализ экспрессии генов

ПРИМЕЧАНИЕ: Выражение трансгена или замалчивание гена-мишени может быть определено RT-PCR или количественным RT-PCR (qRT-PCR).

  1. Соберите образцы и извлеките РНК из репрезентативной части преобразованной корневой системы (для оценки влияния на ген цели) и листьев (как внутренний контроль).
  2. Синтезировать кДНК с использованием 1 мкг общей РТС, обработанной DNase.
  3. Анализ экспрессии генов-мишеней по qRT-PCR. Рассчитайте относительные уровни транскрипции, используя метод 2-ЗККТ 14, используя SlEF-1 в качестве гена домашнего хозяйства15.
    ПРИМЕЧАНИЕ: Праймер последовательности перечислены в таблице 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

На рисунке 5 показано развитие симптомов заболевания томатных растений с корнями, преобразованных с пустым вектором (EV), а растения с корнями, преобразованные с помощью конструкции РНК, ориентированной на SlCESA6 (Solyc02g072240). Данные индекса болезни(рисунок 5A) собираются из одного и того же экспериментального блока (каждого растения) с течением времени по произвольной шкале от 0 до 4, и не следуют гауссианскому распределению, исключая использование стандартных тестов для параметрических данных. Кроме того, в такого рода экспериментах наблюдается внутренняя вариация растений и растений, обусловленная колонизацией и динамикой инфекции. Ниже мы рассмотрели различные методы для представления и статистического анализа симптомов, связанных с инфекцией Ралстонии.

В качестве стандартного подхода использовался двуххвостый непараметрический тест U Mann-Whitney для сравнения как контрольных (EV), так и кривых инфекции SlCESA6-RNAi. Согласно этому анализу, разница между медианами обеих кривых, как представляется, незначительна(P 0.16).

Также можно количественно определить область под кривой прогрессирования заболевания (AUDPC), что позволяет объединить несколько наблюдений за прогрессом болезни в одно значение. AUDPC показал более высокое значение для контрольных растений (EV; 28,75 и 4,75) по сравнению с SlCESA6-RNAi (21,01 и 4,74) растений в конце процесса инфекции, что свидетельствует о том, что SlCES6-глушитель растений более устойчивы к Ралстони инфекции, чем контрольные растения(рисунок 5B).

Доверительные интервалы (CI) предлагают способ оценки, с высокой вероятностью, диапазона значений, в которых находится значение (или параметр) данной переменной. Как показано на рисунке 5C, площадь 95% CI для контроля (EV) и SlCESA6-RNAi кривых инфекции оценка более высокий шанс устойчивости, когда SlCESA6 замолчать.

Значения индекса болезней могут быть преобразованы в двоичные данные, учитывая индекс заболеваемости ниже 2, соответствующий "0", и индекс болезни, равный или превышающей 2, соответствующий "1"12. Это позволяет представление кривой выживания после прививки Ralstonia. Это преобразование основано на наблюдении, что, как только растения начинают развиваться четкие симптомы (индекс заболеваемости 2), они считаются "инфицированными" и умрут в результате этой инфекции. Различия в выживаемости между EV и SlCESA6-RNAi растения не были статистически значимыми в соответствии с Gehan-Breslow-Wilcoxon Статистический тест (P 0,13) (Рисунок 5D).

В дополнение к выполнению статистического анализа, и независимо от полученных значений P, стоит интерпретировать эти данные на основе воспроизводимости наблюдаемых тенденций в различных репликациях(Дополнительная диаграмма 1). В соответствии с этим понятием, все большее число ученых в последнее время прокомментировал риски чрезмерного использования строгих статистических пороговых значений (таких, как стандартные P 0,05)16.

Выражение SlCESA6 было проанализировано в двух случайно выбранных преобразованных корнях перед шагом прививки, показывая, что повышенная устойчивость к Ralstonia коррелирует с пониженным выражением SlCESA6 (Рисунок 5E). Используя этот метод, скорость преобразования 35-40% после двух раундов отбора может быть получена(рисунок 5F). Это значение может быть увеличено путем выполнения дополнительных раундов отбора5.

Figure 1
Рисунок 1: Подготовка, преобразование и отбор растений. (A)Всхожесть семян томатов в половинной прочности MS (1/2) среды. (B) Germinated семена помидоров размещены на фильтровальной бумаге, лежащей на тарелке, содержащей 1/2 MS среды. Помидорные саженцы до (C) и после (D) резки радикл и дно гипокотила. (E) Томатный саженец преобразования путем погружения в бактериальной биомассы. (F) Преобразованные саженцы помидоров покрыты фильтровальной бумагой для поддержания влажности. Появление (G) и удаление (H) новых (непреобразованных) волосатых корней. (Я) Преобразованные корни. (J) Выбор преобразованных томатных волосатых корней путем визуализации DsRed флуоресценции. Красные стрелки указывают на положительные преобразованные корни, выражающие флуоресценцию DsRed. (K) Развитие преобразованных корней в качестве основных корней. (L) Визуализация DsRed флуоресценции в зрелых преобразованных корней. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Альтернативный метод, основанный на выборе антибиотиков. (A) Половина заполнены квадратная пластина, содержащая 1 /2 MS среды. (B) Cut саженцы утилизировать на фильтровальной бумаге, лежащей на 1/2 MS среде с антибиотиком, после удаления первых непреобразованных волосатых корней. (C) Корни покрыты дополнительной фильтровальной бумагой. (D) Помидор преобразованы корни, выращенные на 1/2 MS среды с антибиотиком. (E) Рассада превращается с pK7GWIWG2_II-RedRoot (канамицин 50 мкг/мл), выражая DsRed, как положительный контроль. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 3
Рисунок 3: Передача преобразованного помидора в прививочной горшки. (A) Корневые помидоры передаются в полнопропитанные прививочной горшки. (B) Преобразованные помидоры в прививочных горшках, покрытых пластиковой крышкой для поддержания высокого уровня влажности. (C) Две-три недели старые корне-преобразованные помидоры, после передачи в прививку горшки, готовые к прививке. (D) Трехнедельные томатные растения после удаления почвы. (E) DsRed флуоресценции в корнях 3-недельных преобразованных томатных растений. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 4
Рисунок 4: Ралстония почвозалитной прививки. (A) Материалы, необходимые для Прививки R. solanacearum GMI1000. (B) Почва-заливание преобразованных помидоров в прививочных горшках с R. solanacearum GMI1000 инокулум. (C) Привитые помидоры размещены на слое почвы заливки. (D-H) Ralstonia симптомы болезни масштаба от 0 (без симптомов) до 4 (полное увядание). Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 5
Рисунок 5: SlCESA6 глушитель повышает устойчивость к R. solanacearum. (A) Симптомы болезни РНК-опосредованного SlCESA6-молчание (CESA6-RNAi) и пустой вектор (EV) корень преобразованы томатные растения после прививки с R. solanacearum. Значения соответствуют средствам sE 8 заводов. (B) Область под кривой прогресса заболевания заводов показанных в панели A. (C) 95% уверенность Интервал растений показано в панели A. (D) Процент выживших растений показано в панели A. (E) Анализ экспрессии генов qRT-PCR РНК-PCR РНК-опосредованного SlCESA6-silenced (CESA6i) и EV корней преобразованных томатных растений в корней (1,2) и стрелять (S). Значения соответствуют средствам sE трех технических репликатов. (F) Скорость преобразования EV и CESA6-RNAi корне-преобразованных томатных растений двух независимых экспериментов. Значения соответствуют средствам sE, после двух раундов отбора. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Имя праймер Последовательность праймер (5'-3')
ЭФЗ-1-Ф GGTGGCGAGCATGATTTTGA
ЭФЗ-1-R CGAGCCAACCATGGAAAACAAAA
qCESA6-F ГАТТГТКГТТКТКГКТГГТГТГГТ
qCESA6-R ТКККТЦКТКАТКАТАККТГТГГГГ
CESA6-РНК-Ф CACGCGCGAAAAGTGGGGTTAG
CESA6-РНК-Р ТТТГАГААКТТГГАКТАГГЕГА

Таблица 1: Праймер последовательности.

Ингредиенты За 1 л
Бакто пептон 10 г
Дрожжевой экстракт 1 г
Казамино кислоты 1 г

Таблица 2: Phi (я) средняя композиция.

Дополнительная диаграмма 1: Воспроизводимость результата, показанного на рисунке 5A. Симптомы болезни РНК-опосредованного SlCESA6-молчание(CESA6-RNAi) и EV корень преобразованы томатные растения после прививки с R. solanacearum. Значения соответствуют средствам sE 8 заводов. Анализ экспрессии генов был выполнен qRT-PCR рнк-опосредованного SlCESA6-silenced (CESA6i) и Пустой вектор (EV) корне-преобразованных томатных растений в корнях (1,2) и стрелять (S). Значения соответствуют средствам sE трех технических репликатов. Пожалуйста, нажмите здесь, чтобы загрузить эту цифру.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum представляет собой серьезную угрозу для сельского хозяйства; однако его взаимодействие с природными хозяевами сельскохозяйственного значения по-прежнему плохо понимается по сравнению с другими бактериальными патогенами, особенно у видов растениеводства. В большинстве случаев генетическому анализу препятствуют время и расходы, необходимые для генетической модификации растений-хозяев. Для решения этой проблемы и облегчения генетического анализа инфекции R. solanacearum в томатах, мы разработали простой метод на основе агробактерии rhizogenes-опосредованныепреобразования томатных корней (Рисунок 1), а затем почвозамольной прививки (Рисунок 3). Преобразованные корни выбираются с помощью флуоресцентного репортера (DsRed в этом протоколе)(рисунок 1). Кроме того, мы также разработали альтернативный метод, основанный на выборе антибиотиков, который не повреждает непреобразованную воздушную часть(рисунок 2).

Протокол трансформации основан на описанном Хо-Плегаро и др.5, с несколькими изменениями. Универсальность этого метода позволяет несколько дополнительных анализов в преобразованных корней, таких, как те, для анализа физиологии растений, ответ на химическую обработку, и / или ответы на различные биотические и абиотических стрессов.

После переноса преобразованных растений в почву, мы рассмотрели возможность того, что растения могут развиваться новые корни, которые не могут быть преобразованы. Мы исследовали эту возможность, наблюдая флуоресценцию от DsRed в корневой системе преобразованных растений через две недели после переноса их в почву (до прививки Ralstonia). Результаты показали красную флуоресценцию в большинстве корней(Рисунок 3D).

Передача Т-ДНК Agrobacterium интегрируется в геном хозяина случайным образом, и, следовательно, этот метод генерирует разнородную популяцию томатных растений с разным уровнем экспрессии гена-мишени. R. solanacearum инфекции обычно приводит к смерти растений, которые, впоследствии, препятствует сбору корнеплодов после эксперимента для анализа экспрессии гена каждого растения. Для анализа уровня экспрессии гена-мишени в ходе экспериментов мы выбираем от двух до трех корневых растений перед шагом прививки, в качестве репрезентивной выборки популяции, которая будет привитана. Рисунок 5 показывает, что уменьшение симптомов заболевания в томатных растениях коррелирует с эффективностью slCESA6 заглушить до шага прививки. Таким образом, и, несмотря на ограничения протокола, наши репрезентативные результаты ясно показывают, что этот метод является мощным инструментом для изучения генов-кандидатов, участвующих в резистентности или восприимчивости к R. solanacearum в томатах. Пример, приведенный в этой статье позволило нам определить, что стучать вниз SlCESA6, вторичные клеточной стенки связанных целлюлозы синтазы, повышает устойчивость к инфекции R. solanacearum, напоминающие предыдущие наблюдения с помощью его ортодок AtCESA8 (At4g18780) от Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgments

Мы благодарим всех сотрудников лаборатории Мачо за полезные обсуждения, Альваро Лопес-Гарсия за статистические консультации и Синью Цзянь за техническую и административную помощь в ходе этой работы. Мы благодарим PSC Cell Biology основной объект за помощь в флуоресценции изображений Эта работа была поддержана Стратегической приоритетной исследовательской программы Китайской академии наук (грант XDB27040204), Шанхайский центр биологии стресса растений (китайский Академия наук) и китайская программа «1000 талантов».

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).
Томатный корень Преобразование После прививки с <em>Ralstonia Solanacearum</em> для straightforward генетического анализа бактериальной болезни Wilt
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).More

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter