Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Tomat rotomvandling följt av inokulering med Ralstonia Solanacearum för enkel genetisk analys av bakteriell vissna sjukdom

doi: 10.3791/60302 Published: March 11, 2020

Summary

Här presenterar vi en mångsidig metod för tomatrotomvandling följt av inokulering med Ralstonia solanacearum för att utföra enkel genetisk analys för studier av bakteriell vissnande sjukdom.

Abstract

Ralstonia solanacearum är en förödande jordburen vaskulär patogen som kan infektera ett stort spektrum av växtarter, vilket orsakar ett viktigt hot mot jordbruket. Emellertid, Ralstonia modellen är betydligt underutforskad i jämförelse med andra modeller som involverar bakteriella växtpatogener, såsom Pseudomonas syringae i Arabidopsis. Forskning som syftar till att förstå samspelet mellan Ralstonia och växtväxter är viktigt att utveckla hållbara lösningar för att bekämpa bakteriell vissnande sjukdom, men för närvarande hindras av bristen på enkla experimentella analyser för att karakterisera de olika komponenterna i interaktionen i inhemska värdväxter. I detta scenario har vi utvecklat en metod för att utföra genetisk analys av Ralstonia infektion av tomat, en naturlig mängd Ralstonia. Denna metod är baserad på Agrobacterium rhizogenes-medieradomvandling av tomatrötter, följt av Ralstonia jord-dränkande inokulering av de resulterande växterna, som innehåller förvandlade rötter som uttrycker byggandet av intresse. Mångsidigheten hos rotomvandlingsanalysen gör det möjligt att utföra antingen genöveruttryck eller genljuddämpning medhjälp av RNAi. Som ett proof of concept, använde vi denna metod för att visa att RNAi-medierad tystas av SlCESA6 i tomat rötter tilldelas motstånd mot Ralstonia. Här beskriver vi denna metod i detalj, vilket gör det möjligt för genetiska metoder att förstå bakteriell vissna sjukdom på relativt kort tid och med små krav på utrustning och växttillväxtutrymme.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum, orsaksmedlet för bakteriell vissnande sjukdom, är en förödande jordburen vaskulär patogen med en världsomspännande distribution som kan infektera ett stort antal växtarter, inklusive potatis, tomat, tobak, banan, peppar och aubergine, bland annat1,2. Avkastning förluster orsakade av Ralstonia kan nå 80-90% av produktionen i tomat, potatis eller banan, beroende på sort, klimat, jord och andra faktorer3. Emellertid, Ralstonia modellen är betydligt underutforskad i jämförelse med andra modeller som involverar bakteriella växtpatogener, såsom Pseudomonas syringae eller Xanthomonas spp. Dessutom är de flesta studier i växt-mikrob interaktioner inriktade på modellen anläggningen Arabidopsis thaliana. Även om forskning med hjälp av dessa modeller till stor del har bidragit till vår förståelse av växt-bakterier interaktioner, de tar inte upp den nuvarande nödvändigheten att förstå dessa interaktioner i växtväxter. Forskning som syftar till att förstå samspelet mellan Ralstonia och växtväxter är viktigt att utveckla hållbara lösningar för att bekämpa bakteriell vissnande sjukdom, men för närvarande hindras av bristen på enkla experimentella analyser för att karakterisera de olika komponenterna i interaktionen. Särskilt tomat, en naturlig värd för Ralstonia, är den näst viktigaste grönsaksodlingen i världen och påverkas av en uppsjö av sjukdomar4, inklusive bakteriell vissna sjukdom. I detta arbete har vi utvecklat en enkel metod för att utföra genetisk analys av Ralstonia infektion av tomat. Denna metod är baserad på Agrobacterium rhizogenes-medieradomvandling av tomatrötter, med hjälp av DsRed fluorescens som urval markör5, följt av Ralstonia jord-dränkande inokulering av de resulterande växterna, som innehåller transformerade rötter som uttrycker byggandet av intresse. Mångsidigheten hos rotomvandlingsanalysen gör det möjligt att utföra antingen genöveruttryck eller genljuddämpning medhjälp av RNAi.

En potentiell begränsning av denna metod består av resttillväxt av icke-transformerade rötter. Detta är särskilt viktigt i de fall där plasmid används saknar en reporter gen som gör att valet av transformerade rötter. För att lösa detta problem har vi utvecklat en alternativ metod baserad på antibiotikaval, som hämmar tillväxten av icke-transformerade rötter samtidigt som tillväxten av friska antibiotikaresistenta transformerade rötter tillåts. Eftersom A. rhizogenes inte inducerar omvandlingen av skott, är de mottagliga för antibiotika, och därför bör de hållas åtskilda från det antibiotikainnehållande mediet.

Även om växtmotståndet mot Ralstonia inte är väl förstått, har flera rapporter associerade cellväggsförändringar till ökad motståndskraft mot bakteriell vissna6,7,8,9. Det har föreslagits att dessa cellvägg förändringar påverkar vaskulär utveckling, en viktig aspekt för livsstil Ralstonia inne i anläggningen10. Mutationer i gener som kodar cellulosasyntiserar CESA4, CESA7 och CESA8 i Arabidopsis talian har visat sig försämra sekundär cellväggintegritet, vilket orsakar ökat motstånd mot Ralstonia, som verkar vara kopplat till ABA signalering8. Därför, som ett proof of concept för vår metod, utförde vi RNAi-medierad gen ljuddämpning av SlCESA6 (Solyc02g072240), en sekundär cellulosasynthas för cellulosa och ortolog av AtCESA8 (At4g18780). Efterföljande jord-dränkning inokulering med Ralstonia visade att tysta SlCESA6 förbättrad motståndskraft mot bakteriell vissna symtom, vilket tyder på att cellen väggmedierad resistens mot Ralstonia sannolikt bevaras i tomat, och validera vår metod för att utföra genetisk analys av bakteriell vissna resistens i tomat rötter. Här beskriver vi denna metod i detalj, vilket gör det möjligt för genetiska metoder att förstå bakteriell vissna sjukdom på relativt kort tid och med små krav på utrustning och växttillväxtutrymme.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

OBS: Viktiga delar av denna metod innebär hantering av växtmaterial in vitro, och därför är det viktigt att hålla sterila förhållanden under alla dessa förfaranden, inklusive visualisering av DsRed fluorescens. Under all omvandlingsprocess växer tomatplantorna vid 25−28 °C och 16 h/8 h ljus/mörker (130 μmol fotoner m-2s-1 ljus). Plattorna är förseglade med mikropore tejp för att underlätta gasutbyte och transpiration.

1. Beredning av tomatplantor och Agrobacterium rhizogenes

  1. Sterilisera tomatfrön (Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) med 5% (v/v) natriumhypoklorit i 5 min. Tvätta 4-5 gånger med destillerat sterilt vatten och hålla fröna skakar långsamt i sterilt vatten över natten för att underlätta grobarhet.
  2. Överför tomatfröntill halvstyrka Murashige och Skoog (1/2 MS) medium utan sackaros (2,21 g/L MS, 8% w/v agar). Håll fröna i mörker vid 25−28 °C i tre dagar (bild 1A).
    OBS: Cirka 40 frön behövs vanligtvis för varje konstruktion.
  3. Autoklav 8,5 cm2 kvadratfilterpapper. Placera kvadratiska filterpapper inuti 9 cm2 kvadratiska petriskålar som innehåller 1/2 MS medium (placera papperet ovanpå agaren) och placera sex grodda tomatfrön på varje tallrik (figur 1B). Försegla plattan med mikroporetejp och inkubera de grodda fröna vid 25−28 °C i 3−4 dagar.
  4. Odla Agrobacterium rhizogenes MSU440 i fast LB medium (med lämpliga antibiotika) vid 28 °C två dagar före växtomvandling.
    OBS: A. rhizogenes tillhandahålls av Dr Juan Antonio López Ráez, EEZ-CSIC, Granada, Spanien. I experimentet som beskrivs i denna artikel användes A. rhizogenes som innehåller pK7GWIWG2_II-RedRoot::CESA6 eller en tom vektor, som kontroll,. pK7GWIWG2_II-RedRoot innehåller en reportergen, DsRed, driven av Arabidopsis thaliana ubiquitin promotorn (pAtUBQ10), och ger motstånd mot spectinomycin (50 μg/mL). Det är möjligt att använda andra vektorer för genöveruttryck, som rapporterats före5. I detta arbete erhölls förstärkningen av det specifika fragmentet för SlCESA6-ljuddämpning genom omvänd transkription (RT) PCR med RNA isolerad från tomat (S. lycopersicum cv. Moneymaker) och ligated in i p-ENTR/D-TOPO vektor (Tabell 1). Därefter klonades Fragmentet SlCESA6-RNAi till den pK7GWIWG2_II-RedRoot binära vektorn.

2. Omvandling och urval av växter

  1. Med hjälp av en steril skalpell, skär radicle och botten av hypocotyl av tomat plantor(Figur 1C,D).
  2. Skörda A. rhizogenes biomassa från ytan av LB-mediet med hjälp av plastspetsar eller ett skalpellblad och doppa försiktigt de skurna tomatplantorna i bakteriebiomassan (figur 1E).
  3. Efter inokulering med A. rhizogenes,täck tomatplantorna med ett halvcirkelformat filterpapper på 2 cm x 4 cm (figur 1F), för att hålla hög luftfuktighet och underlätta överlevnad och ny rotutveckling.
  4. Förvara de förvandlade tomatplantorna i 6-7 dagar. Använd sedan en steril skalpell för att klippa de nya framväxande håriga rötterna (figur 1G,H; i detta steg omvandlas inte rötterna ännu) och låt plantorna producera nya håriga rötter.
  5. När den andra generationen av nya håriga rötter visas (figur 1I),ta bort filterpapperet ovanpå plantorna och försegla plattan med mikroporetejp igen.
    OBS: Vid denna punkt, förekomsten av DsRed fluorescerande markör i omvandlingsvektorn gör det möjligt att visualisera omvandlingen effektivitet i de nya rötterna.
  6. För att visualisera DsRed-fluorescens, använd ett stereomikroskop eller annan utrustning för växtin vivo-avbildning (bild 1J). Markera de positiva (röda fluorescensen) förvandlade rötter och ta bort de negativa icke-transformerade rötterna (ingen röd fluorescens) med hjälp av en steril skalpell.
  7. Överför plantorna som visar röd fluorescens till en ny platta som innehåller 1/2 MS-medium, för att underlätta utvecklingen av den omvandlade roten som huvudrot (figur 1K). Håll plantorna som inte visar röd fluorescens i samma platta för att kontrollera uppkomsten av fluorescerande rötter (figur 1L) i senare tidpunkter.
  8. Alternativ metod baserad på val av antibiotika
    1. Alternativ till steg 2,5, förbereda halvfyllda 9 cm2 kvadratplattor som innehåller 1/2 MS medium med lämpligt antibiotikum. Luta plattorna ca 5° under beredningsprocessen för att generera ett tomt utrymme utan medium (figur 2A), vilket gör att skotten kan växa undvika kontakt med antibiotika.
    2. Alternativ till steg 2.6, efter att ha klippt de första icke-förvandlade håriga rötterna uppstod (steg 2.4), överför plantorna utan rötter till de halvfyllda plattorna med hjälp av filterpapper med lämplig storlek (figur 2B).
      OBS: Som positiv kontroll rekommenderas att omvandla flera plantor med en plasmid som innehåller samma antibiotikaresistens och en reportergen (i detta protokoll, pK7GWIWG2_II-RedRoot; kanamycin 50 μg/mL).
    3. Alternativ till steg 2,7, låt plantorna utveckla nya håriga rötter och klippa de rötter som inte är i direkt kontakt med ytan av filtret smörgås papper, eftersom dessa rötter kan undvika antibiotika urval.
      OBS: På grund av antibiotikaeffekten kan rotutvecklingen vara långsammare än i plattor utan antibiotika. Nya förvandlade håriga rötter visas inom 14−18 dagar efter att ha överfört plantorna utan rötter till de halvfyllda plattorna (steg 2.8.2) (figur 2C-E).
  9. Täck plantorna med ett 2 cm x 4 cm halvcirkelfilterpapper, täta plattan och inkubera plantorna så att de kan utveckla nya håriga rötter.
    OBS: Det är inte nödvändigt att eliminera A. rhizogenes med antibiotika. Filterpapperet ovanpå MS-mediet och bristen på sackaros hämmar spridningen av A. rhizogenes på plattan5.
  10. Fem till sju dagar efter den första rotmarkeringen upprepar du urvalsprocessen för att välja nya transformerade rötter och ta bort icke-transformerade rötter. Överför plantorna som innehåller förvandlade rötter till en ny platta som innehåller 1/2 MS-medium.

3. Överför till inokuleringskrukor

  1. Förbered inokuleringkrukor där ytan av rötterna kommer att utsättas för bakteriellinoculum: blötinikulering krukor med vatten, häll bort överflödigt vatten, och placera dem i en plast plantering bricka. Överför de valda plantorna med förvandlade rötter till inokuleringskrukor med hjälp av pincett (figur 3A).
  2. Täck brickan med plastfolie eller ett genomskinligt lock och håll dem på 25−28 °C och 65 % luftfuktighet (16 h/8 h ljus/mörker; 130 μmolfotoner m-2s-1 ljus), för att upprätthålla en hög luftfuktighet Figur 3B). Ta bort locket efter fem eller sex dagar.
    OBS: De omvandlade tomatplantorna är klara för inokulering två till tre veckor efter att de har överförts till jord (figur 3C). Under tillväxten på jord kan tomatplantor producera nya rötter som inte omvandlas. För att bestämma omfattningen av detta fenomen visualiserades röd fluorescens i rötter av 3 veckor gamla förvandlade tomatplantor. De flesta rötter (80%-100%) visade röd fluorescens, vilket tyder på att de verkligen omvandlas (figur 3D,E).

4. Markdränkt inokulering

  1. Odla R. solancearum (stam GMI1000 i detta protokoll) i phi flytande medium(tabell 211) i en orbital shaker (200 rpm) vid 28 °C tills stillastående fas.
  2. Bestäm bakterietal genom att mäta bakteriekulturens optiska densitet vid 600 nm (OD600). Späd bakteriekulturen med vatten till en OD600 av 0,1 (under förhållanden som används här, motsvarar detta cirka 108 kolonibildande enheter [CFU]/mL).
  3. Placera 16−20 inokuleringskrukor som innehåller förvandlade tomatplantor i en inokuleringsbricka (29 cm x 20 cm; Figur 4A).
  4. Häll 300 ml (~15 ml per växt) av bakteriellt inokulat (OD600 av 0,1) i facket som innehåller inokuleringskrukorna. Låt dem suga i inokulat i 20 min(bild 4B).
  5. Förbered en ny bricka med ett lager krukväxtjord. Flytta in de inokulerade krukorna i den nya brickan (figur 4C)och placera brickorna i en tillväxtkammare med 75 % luftfuktighet, 26−28 °C och en fotoperiod på 12 h ljus och 12 h mörker (130 μmol fotoner m-2s-1 ljus).

5. Bestämning av infektionsparametrar och statistisk analys

  1. Betyg sjukdomsymtom som tidigare beskrivits12,13, med en skala som sträcker sig från 0 (inga symtom) till 4 (fullständig vissning) (Figur 4D-H), varje dag efter Ralstonia inokulering i två veckor.
    OBS: Uppgifterna om sjukdomsindex samlas in från samma försöksenhet (varje anläggning) över tiden.

6. Genuttrycksanalys

OBS: Uttrycket av transgenen eller ljuddämpningen av målgenen kan bestämmas av RT-PCR eller kvantitativRT-PCR (qRT-PCR).

  1. Samla prover och extrahera RNA från en representativ del av det omvandlade rotsystemet (för att utvärdera effekten på målgenen) och blad (som intern kontroll).
  2. Syntetisera cDNA med 1 μg totalt DNase-behandlat RNA.
  3. Analysera genuttryck av målgenerna med qRT-PCR. Beräkna de relativa transkriptionsnivåerna med hjälp av 2-ΔΔCT-metoden 14, med SlEFα-1 som hushållningsgen15.
    Primer-sekvenser visas i tabell 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 5 visar utvecklingen av sjukdomssymtom på tomatplantor med rötter omvandlas med en tom vektor (EV), och växter med rötter omvandlas med en RNAi konstruktion inriktning SlCESA6 (Solyc02g072240). Sjukdomsindexdata (figur 5A) samlas in från samma försöksenhet (varje anläggning) över tiden enligt en godtycklig skala från 0 till 4, och följer inte en gaussisk distribution, utesluta användningen av standardtester för parametriska data. Dessutom finns det en inneboende växt-till-växt variation i denna typ av experiment, på grund av kolonisering och infektion dynamik. Nedan övervägde vi olika metoder för representation och statistisk analys av symtom i samband med Ralstonia infektion.

Som en standard metod, en U Mann-Whitney två-tailed icke-parametriska test för att jämföra både kontroll (EV) och SlCESA6-RNAi infektion kurvor användes. Enligt denna analys förefaller skillnaden mellan medianen för båda kurvorna vara icke-signifikant(P = 0,16).

Det är också möjligt att kvantifiera området under sjukdomsförloppskurvan (AUDPC), vilket gör det möjligt att kombinera flera observationer av sjukdomsframsteg till ett enda värde. AUDPC uppvisade ett högre värde för kontrollanläggningar (EV; 28,75 ± 4,75) jämfört med SlCESA6-RNAi (21.01 ± 4,74) växter i slutet av infektionsprocessen, vilket tyder på att SlCES6-tystadeväxter är mer motståndskraftiga mot Ralstonia-infektion än kontrollanläggningar (figur 5B).

Konfidensintervall (CI) erbjuder ett sätt att med hög sannolikhet uppskatta ett värdeintervall där populationsvärdet (eller parametern) för en viss variabel hittas. Som det visas i figur 5C, området 95% CI för kontroll (EV) och SlCESA6-RNAi infektion kurvor uppskattar en högre chans till resistens när SlCESA6 tystas.

Sjukdomsindexvärden kan omvandlas till binära data, med tanke på ett sjukdomsindex som är lägre än 2 motsvarande "0", och ett sjukdomsindex som är lika med eller högre än 2 som motsvarar "1"12. Detta gör det möjligt att representera en överlevnadskurva efter Ralstonia inokulering. Denna omvandling är baserad på observationen att när växterna börjar utveckla tydliga symtom (sjukdomsindex på 2), betraktas de som "infekterade" och kommer att dö som en följd av denna infektion. Skillnaderna i överlevnad mellan EV- och SlCESA6-RNAI-växternavar inte statistiskt signifikanta enligt ett statistiskt test av Gehan-Breslow-Wilcoxon (P = 0,13) (figur 5D).

Förutom att utföra statistisk analys, och oavsett de erhållna P-värdena, är det värt att tolka dessa data baserat på reproducerbarheten av de observerade tendenserna inom olika replikat (tilläggsfigur 1). I enlighet med detta begrepp har allt fler forskare nyligen kommenterat riskerna med att överanvända strikta statistiska trösklar (t.ex. standarden P ≤ 0,05)16.

Uttrycket av SlCESA6 analyserades i två slumpmässigt utvalda transformerade rötter före inokuleringssteget, vilket visar att det ökade motståndet mot Ralstonia korrelerar med det reducerade uttrycket för SlCESA6 (figur 5E). Med den här metoden kan en omvandlingshastighet på 35−40% efter två valomgångar erhållas(figur 5F). Det här värdet kan ökas genom att ytterligare urvalsrundor5utförs .

Figure 1
Figur 1: Beredning, omvandling och urval av växter. (A)Groning av tomatfrön i halvstyrka MS (1/2) medium. (B)Könsceller som placerats på filterpapper som ligger på en platta som innehåller 1/2 MS-medium. Tomatplantor före(C)och efter(D)skära radicle och botten av hypocotyl. (E)Omvandling av tomatplantor genom doppning i bakteriell biomassa. (F)Transformerade tomatplantor täckta med filterpapper för att bibehålla luftfuktigheten. Uppkomst (G) och borttagning (H) av nya (icke-transformerade) håriga rötter. (I) Förvandlade rötter. (J)Val av förvandlade tomathåriga rötter genom visualisering av DsRed-fluorescens. Röda pilar indikerar positiva transformerade rötter som uttrycker DsRed-fluorescens. (K)Utveckling av de förvandlade rötterna som huvudrötter. (L)Visualisering av DsRed fluorescens i mogna transformerade rötter. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Alternativ metod baserad på antibiotikaval. (A)Halvfylld fyrkantig platta som innehåller 1/2 MS-medium. (B)Klipp plantor kasseras på filterpapper som ligger på 1/2 MS medium med antibiotika, efter avlägsnande av första icke-omvandlade håriga rötter. (C)Rötter täckta med ytterligare filterpapper. (D)Tomat förvandlade rötter som odlas på 1/2 MS medium med antibiotika. (E)Plantor omvandlas med pK7GWIWG2_II-RedRoot (kanamycin 50 μg/mL), uttrycker DsRed, som positiv kontroll. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Överföring av omvandlad tomat till inokuleringkrukor. (A)Rotförvandlade tomater som överförts till fullblöta inokuleringskrukor. (B)Förvandlade tomater i inokuleringkrukor täckta med ett plastlock för att upprätthålla hög luftfuktighet. C)Två till tre veckor gamla rotomvandlade tomater, efter överföring till inokuleringskrukor, redo att vaccineras. (D)Tre veckor gamla tomatplantor efter att ha tagit bort jorden. (E)DsRed fluorescens i rötter av 3 veckor gamla omvandlade tomatplantor. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: Ralstonia jorddränkt agululation. (A)Material som behövs för R. solanacearum GMI1000 inokulering. (B)Jord-dränkning av omvandlade tomater i inokulering krukor med R. solanacearum GMI1000 inoculum. C)Vaccinerade tomater som placerats på ett lager krukväxtjord. (D-H) Ralstonia sjukdom symtom skala allt från 0 (inga symtom) till 4 (fullständig vissning). Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: SlCESA6 tystning ökar motståndet mot R. solanacearum. (A)Sjukdomssymtom på RNAI-medierad SlCESA6-tystad(CESA6-RNAi) och tomma vektor (EV) rotomvandlade tomatplantor vid inokulering med R. solanacearum. Värdena motsvarar medel ± SE av åtta växter. (B)Område under sjukdomskurvan för växter som visas i panel A.(C)95% konfidensintervall för växter som visas i panel A. (D)Procent av de överlevande växtersom visas i panel A. (E)Genuttryckanalys av qRT-PCR av RNAI-medierad SlCESA6-tystad (CESA6i) och EV rotomvandlade tomatplantor i rötter (1,2) och skjuta (S). Värdena motsvarar medelvärdet ± SE för tre tekniska replikat. (F)Omvandlingshastighet för EV och CESA6-RNAi rotomvandlade tomatplantor av två oberoende experiment. Värdena motsvarar medelvärdet ± SE, efter två valomgångar. Klicka här för att se en större version av denna siffra.

Primer namn Primer sekvens (5'-3')
EFα-1-F GGTGGCGAGCATGATTTTGA
EFα-1-R CGAGCCAACCATGGAAAAACAA
qCESA6-F GATCTGGTTCGCTTTCTCGT
qCESA6-R TCCCTCCCTTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
CESA6-RNAi-R TTTGAGACTTTGGCACTGGA

Tabell 1: Primer-sekvenser.

Ingredienser För 1 L
Bacto pepton 10 g
Jäst extrakt 1 g
Casamino syror 1 g

Tabell 2: Phi (Ø) medelsammansättning.

Tilläggsfigur 1: Reproducerbarhet av det resultat som visas i figur 5A. Sjukdom symtom på RNAi-medierad SlCESA6-tystas (CESA6-RNAi) och EV rot-omvandlas tomatplantor vid inokulering med R. solanacearum. Värdena motsvarar medel ± SE av åtta växter. Genuttrycksanalys utfördes av qRT-PCR av RNAI-medierad SlCESA6-tystad (CESA6i) och Empty Vector (EV) rotomvandlade tomatplantor i rötter (1,2) och skjuta (S). Värdena motsvarar medelvärdet ± SE för tre tekniska replikat. Klicka här för att ladda ner denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum utgör ett viktigt hot mot jordbruket. Dess interaktion med naturliga värdar av jordbruksbetydelse är dock fortfarande dåligt förstås jämfört med andra bakteriella patogener, särskilt hos växtarter. I de flesta fall hindras genetisk analys av den tid och de kostnader som krävs för att genetiskt modifiera värdväxter. För att lösa detta problem och underlätta genetisk analys av R. solanacearum infektion i tomat, har vi utvecklat en enkel metod baserad på Agrobacterium rhizogenes-medieradomvandling av tomat rötter(figur 1),följt av jord-dränkning inokulering (Figur 3). De transformerade rötterna väljs med hjälp av en fluorescerande reporter (DsRed i detta protokoll) (bild 1). Dessutom har vi också utvecklat en alternativ metod baserad på antibiotikaval som inte skadar den icke-omvandlade flygdelen (figur 2).

Omvandlingsprotokollet bygger på det som Ho-Plágaro et al.5beskriver, med flera ändringar. Mångsidigheten hos denna metod tillåter flera ytterligare analyser i transformerade rötter, såsom de att analysera växtfysiologi, svar på kemiska behandlingar, och / eller svar på olika biotiska och abiotiska påfrestningar.

Efter att ha överfört de förvandlade växterna till jord, övervägde vi möjligheten att växter kan utveckla nya rötter som inte kan omvandlas. Vi undersökte denna möjlighet genom att observera fluorescens från DsRed i rotsystemet av transformerade växter två veckor efter att ha överfört dem till jord (före Ralstonia inokulering). Resultaten visade röd fluorescens i de flesta av rötterna (figur 3D).

T-DNA-överföring av Agrobacterium är integrerad i värdgenomet på ett slumpmässigt sätt, och därför genererar denna metod en heterogen population av tomatplantor med olika uttrycksnivå av målgenen. R. solanacearuminfektion orsakar normalt växternas död, vilket därefter hindrar insamlingen av rotprover efter experimentet för att analysera genuttrycket för varje växt. För att analysera uttrycksnivån för målgenen under experimenten väljer vi två till tre rotomvandlade växter före inokuleringssteget, som representativt urval av den population som kommer att vaccineras. Figur 5 visar att minskningen av sjukdomssymtom i tomatplantor korrelerar med effektiviteten i SlCESA6 tysta innan inokulering ssteget. Därför, och trots begränsningarna i protokollet, våra representativa resultat visar tydligt att denna metod är ett kraftfullt verktyg för att studera kandidat gener som deltar i resistens eller mottaglighet för R. solanacearum i tomat. Det exempel som visas i den här artikeln tillät oss att avgöra att knocking-down SlCESA6, en sekundär cell vägg-relaterade cellulosa syntas, förbättrar motståndskraftmot infektion av R. solanacearum, liknar tidigare observationer med hjälp av sin ortolog AtCESA8 (At4g18780) från Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Vi tackar alla labbmedlemmar i Macho-laboratoriet för hjälpsamma diskussioner, Alvaro López-García för statistisk rådgivning och Xinyu Jian för tekniskt och administrativt bistånd under detta arbete. Vi tackar PSC Cell Biology kärnanläggning för hjälp med fluorescensimaging Detta arbete stöddes av strategic priority research program of the Chinese Academy of Sciences (grant XDB27040204), Shanghai Center for Plant Stress Biology (Chinese Academy of Sciences (grant XDB27040204), Shanghai Center for Plant Stress Biology (Chinese Academy of Sciences) och det kinesiska 1000 Talents-programmet.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).
Tomat rotomvandling följt av inokulering med <em>Ralstonia Solanacearum</em> för enkel genetisk analys av bakteriell vissna sjukdom
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).More

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter