Following the protocol described in section 1, botanical DNA from flower head and leaf were extracted into the supernatant after heat incubation of the collection tube at 95 °C for 10 min. In the current study, the supernatant showed a yellow and greenish color for both flower and leaf, indicating that a variety of natural compounds were released into the supernatant with botanical DNA (Figure 6). Although reliable PCR amplification was achieved later in triplicate for all field extracted DNA template, DNA quality assessment was performed in the laboratory as reference. The concentration of flower head DNA extract, determined by fluorometry, ranged from 3.69–5.36 ng/µL, while the concentration of leaf DNA extract ranged from 6.42–9.29 ng/µL. The A260/A280 and A260/A230 absorbance ratios of flower and leaf DNA extracts were measured by spectrophotometry. However, due to the overlap between DNA and phytochemical UV absorption spectrum, these ratios could not be reliability measured (data not shown).
Intercalating fluorescent dye was used to monitor the amplification of target fragments in real-time. Since both the specific primers M. chamomilla and C. nobile target the internal transcribed spacer 2 (ITS2) region, which has tens to hundreds of copies in the plant genome, 25 PCR amplification cycles are sufficient to generate enough amplicons for the identification of chamomile species. In Figure 7, the Ct value for M. chamomilla positive control in M. chamomilla identification test was less than 25 (GCP_GCT), while after 25 amplification cycles, the fluorescence of the same control in C. nobile identification test was below the detection threshold (GCP_RCT). On the other hand, after 25 cycles, the fluorescence for C. nobile positive control in M. chamomilla identification test was below the detection threshold (RCP_GCT), while the Ct value for the same control in C. nobile identification test was less than 25 (RCP_RCT). The amplification of target and non-target positive controls in their respective assays demonstrate the specificity of the M. chamomilla identification assay. For sample DNA, field flower head and leaf DNA extract yielded Ct values of 15.18 and 19.41 in M. chamomilla identification test, respectively (Sample1(FLOWER)_GCT and Sample2(LEAF)_GCT). Both of these samples were not amplified in C. nobile identification test (Sample1(FLOWER)_RCT and Sample2(LEAF)_RCT). The amplification patterns of both the samples matched the amplification pattern of M. chamomilla positive control. Negative controls were not amplified in both M. chamomilla and C. nobile identification tests (NC_GCT and NC_RCT), excluding the possibility of false positives caused by PCR contamination. To further confirm specific amplification in positive controls and samples, fractions of PCR end product from each well were run on 2% agarose gel in the laboratory (Figure 8). For M. chamomilla identification test, both field samples yielded amplicons running at the same position as the M. chamomilla positive control with an estimated size slightly above 100 bp (theoretical size 102 bp). For C. nobile identification test, non-target species C. nobile positive control yielded a band between 50 and 100 bp, fitting the theoretical size of 65 bp. The rest of the lanes showed no specific amplification product, which was in agreement with the absence of fluorescent signal for these wells, as observed in field testing.
Following PCR amplification, a melting curve analysis was performed to assess the dissociation characteristics of double-stranded DNA (dsDNA) during heating. As the temperature ramped up during the final cycle for melt curve analysis, increases in temperature caused the double-strand amplicons to dissociate. The intercalating fluorescent dye was gradually released into the solution, decreasing fluorescence intensity (Figure 9A). The inflection point of the first derivative curve was used to determine the melting temperature (Tm) (Figure 9B), which depends mainly on DNA fragment length and GC content. Combining Ct value with melting temperature can increase the specificity of qPCR analysis. In the current study, the melting temperature peak of M. chamomilla positive control PCR amplicon occurred at 85.6 °C (GCP_GCT) and it was distinct from the melting temperature peak of C. nobile positive control PCR amplicon at 79.1 °C (RCP_RCT). The PCR amplicon from field flower head and leaf produced melting temperature peaks at 85.2 °C and 84.8 °C, respectively (Sample1(FLOWER)_GCT and Sample2(LEAF)_GCT). To assess melting temperature variations measured by the portable qPCR system, additional datapoints were collected to confirm that sample melting temperatures were always close to the melting temperature obtained from M. chamomilla positive control (within 2 °C) and were far away from the melting temperature of C. nobile positive control amplicon (Figure 10). Melting temperature peaks were sometimes reported in other wells. However, their Ct values were not less than 25 and melting temperature peaks were not close to M. chamomilla or C. nobile positive control (more than 2 °C apart).
In summary, field M. chamomilla identification test can be interpreted based on decision rules summarized in Table 5. With all the positive controls testing positive for the putative botanical species, negative for the other species, and negative controls testing negative, both field samples were determined to contain M. chamomilla but not C. nobile. In addition, to align field testing results with other analytical techniques, field conclusions were further confirmed by a previously validated DNA barcoding method25 (data not shown).

Figure 1: Morphological identification of botanical materials. (A) Hibiscus rosa-sinensis flowers, Curcuma longa roots, Malva Sylvestris leaves, Rosmarinus officinalis leaves, Coriandrum sativum seeds, Zingiber officinale roots. (B) Petroselinum crispum and Apium graveolens flakes are difficult to differentiate. Please click here to view a larger version of this figure.

Figure 2: Chemical identification of botanical materials. (A) HPTLC instrument and a representative HPTLC chromatogram. (B) HPLC instrument and a representative HPLC chromatogram. Please click here to view a larger version of this figure.

Figure 3: Matricaria chamomilla and Chamaemelum nobile in the field. (A) Matricaria chamomilla, adapted from Wikipedia under CC BY-SA 3.0, https://en.wikipedia.org/wiki/Matricaria_chamomilla#/media/File:Matricaria_February_2008-1.jpg. (B) Chamaemelum nobile, adapted from Wikipedia under CC BY-SA 3.0, https://en.wikipedia.org/wiki/Chamomile#/media/File:Chamaemelum_nobile_001.JPG. Please click here to view a larger version of this figure.

Figure 4: Collecting M. chamomilla plant parts from the field. Please click here to view a larger version of this figure.

Figure 5: Layout of testing wells in the demonstration. Please click here to view a larger version of this figure.

Figure 6: Field DNA extract in collection tubes. Botanical tissue remains in the original tube and is covered by yellowish DNA extract. Please click here to view a larger version of this figure.

Figure 7: Fluorescence plot showing the accumulation of PCR products over 25 cycles of thermocycling. M. chamomilla positive control and C. nobile positive control show Ct values less than 25 in M. chamomilla and C. nobile identification tests, respectively. The field flower and leaf samples were amplified by M. chamomilla identification test with Ct values of 15.18 and 19.41. The rest of the wells were not amplified. Please click here to view a larger version of this figure.

Figure 8: Gel electrophoresis of field PCR amplification products. Please click here to view a larger version of this figure.

Figure 9: Melting temperature analysis. (A) The fluorescence signal in each well decreases with the increasing temperature. (B) The identity of the PCR products was confirmed by the melting temperature peak in melting curve analysis. The field flower and leaf samples show peaks at 85.2 °C and 84.8 °C. These are close to the peak produced by M. chamomilla positive control. The C. nobile positive control produced a peak at 79.1 °C, which is different from the other three samples. Please click here to view a larger version of this figure.

Figure 10: Melting temperature peak variation between positive control and field samples. Please click here to view a larger version of this figure.
| Stage | Cycle | Temperature | Time |
| Constant Temperature | 1 | 95 °C | 60s |
| Amplification | 25 | 95 °C | 30s |
| 60 °C | 30s |
| Melting Curve | 1 | 60 °C | Ramp 0.05 °C/s |
| 95 °C |
Table 1: qPCR thermocycling conditions for M. chamomilla and C. nobile identification tests.
| Assay | Primer name | Sequence 5'-3' | Position | Region | Amplicon Size |
| Matricaria recutita | ZL3 | TCGTCGGTCGCAAGGATAAG | Forward | ITS2 | 102 bp |
| ZL4 | TAAACTCAGCGGGTAGTCCC | Reverse |
| Chamaemelum nobile | ZL11 | TGTCGCACGTTGCTAGGAAGCA | Forward | ITS2 | 65 bp |
| ZL12 | TCGAAGCGTCATCCTAAGACAAC | Reverse |
Table 2: Primer pairs for M. chamomilla and C. nobile identification tests.
| Well position | Well name | Description |
| 1 | GC_PosCtrl_GC_Test | German chamomile positive control under GC Test |
| 2 | GC_PosCtrl_RC_Test | German chamomile positive control under RC Test |
| 3 | RC_PosCtrl_GC_Test | Roman chamomile positive control under GC Test |
| 4 | RC_PosCtrl_RC_Test | Roman chamomile positive control under RC Test |
| 5 | Field_Sample_GC_Test | Sample of leaf tissue under GC Test |
| 6 | Field_Sample_RC_Test | Sample of leaf tissue under RC Test |
| 7 | Field_Sample_GC_Test | Sample of flower tissue under GC Test |
| 8 | Field_Sample_RC_Test | Sample of flower tissue under RC Test |
| 9 | NegCtrl_GC_Test | Negative control sample under GC Test |
| 10 | NegCtrl_RC_Test | Negative control sample under RC Test |
Table 3: Well types and descriptions for M. chamomilla and C. nobile identification tests.
| Reagent | GC_Test | RC_Test |
| Universal qPCR Mix* | 10 µL | 10 µL |
| ZL3 primer (10 µM) | 0.4 µL | NA |
| ZL4 primer (10 µM) | 0.4 µL | NA |
| ZL11 primer (10 µM) | NA | 0.4 µL |
| ZL12 primer (10 µM) | NA | 0.4 µL |
| H2O (Nuclease-free) | 7.2 µL | 7.2 µL |
| * contains Hot Start Taq DNA Polymerase |
Table 4: Master-mix composition for M. chamomilla and C. nobile identification tests.
| Well Name | Expected Result | Positive Result Criteria | Negative Result Criteria |
| Detected / Present | Not Detected / Absent |
| GC_PosCtrl_GC_Test | Detected | Ct < 25 and 84 <= Tm <= 86 | - |
| GC_PosCtrl_RC_Test | Not Detected | - | No Ct value within 25 cycles |
| RC_PosCtrl_GC_Test | Not Detected | - | No Ct value within 25 cycles |
| RC_PosCtrl_RC_Test | Detected | Ct < 25 and 79 <= Tm <= 81 | - |
| Field_Sample_Leaf_GC_Test | Present | Ct < 25 and 84 <= Tm <= 86 | No Ct value within 25 cycles |
| Field_Sample_Leaf_RC_Test | Absent | - | No Ct value within 25 cycles |
| Field_Sample_Flower_GC_Test | Present | Ct < 25 and 84 <= Tm <= 86 | No Ct value within 25 cycles |
| Field_Sample_Flower_RC_Test | Absent | - | No Ct value within 25 cycles |
| NegCtrl_GC_Test | Not Detected | - | No Ct value within 25 cycles |
| NegCtrl_RC_Test | Not Detected | - | No Ct value within 25 cycles |
Table 5: Rules for qPCR result interpretation.