Embryological manipulations such as extirpation and transplantation of cells are important tools to study early development. This protocol describes a simple and effective transplantation device to perform these manipulations in zebrafish embryos.
Method Article
Embryological manipulations such as extirpation and transplantation of cells are important tools to study early development. This protocol describes a simple and effective transplantation device to perform these manipulations in zebrafish embryos.
Classical embryological manipulations, such as removing cells and transplanting cells within or between embryos, are powerful techniques to study complex developmental processes. Zebrafish embryos are ideally suited for these manipulations since they are easily accessible, relatively large in size, and transparent. However, previously developed devices for cell removal and transplantation are cumbersome to use or expensive to purchase. In contrast, the transplantation device presented here is economical, easy to assemble, and simple to use. In this protocol, we first introduce the handling of the transplantation device as well as its assembly from commercially and widely available parts. We then present three applications for its use: generation of ectopic clones to study signal dispersal from localized sources, extirpation of cells to produce size-reduced embryos, and germline transplantation to generate maternal-zygotic mutants. Finally, we show that the tool can also be used for embryological manipulations in other species such as the Japanese rice fish medaka.
From the classical experiments of Mangold and Spemann that demonstrated the existence of an organizer instructing the formation of an embryonic axis1, transplantation of cells between embryos has become an established technique for studying embryonic development2,3,4,5,6,7,8,9,10. A commonly used setup for transplantation consists of a micrometer drive-controlled gas-tight syringe connected to a micropipette holder through flexible tubing and a reservoir filled with mineral oil12,13. In this setup, the plunger of the syringe is moved through a screw. The pressure generated in this manner is transferred to the micropipette and used to draw cells out from one embryo and deposit them into another. However, this hydraulically operated device consists of many parts and is laborious to assemble from scratch. Similar devices can also be purchased as a complete working set, usually sold as Manual Microinjectors, and these commercial versions typically cost more than 1500 US$. In both the home-made and the commercial version, the micropipette for embryo manipulation is separated from the pressure-generating device (the gas-tight syringe) through oil-filled tubing. The manipulation of the micropipette and the movement of the plunger, therefore, have to be operated separately with different hands, reducing the throughput and utility. Furthermore, the devices are cumbersome to prepare for transplantation since the tubing needs to be carefully filled with oil while avoiding the formation of bubbles. Here, we describe an alternative pneumatically operated device for cell removal and transplantation that is inexpensive, easy to assemble, and simple to use.
The device presented here comprises a 25 µL gas-tight syringe fitted with a micropipette holder and costs less than 80 US$ altogether. The device is easily assembled by inserting the micropipette holder into the syringe via Luer lock fitting (Figure 1A). The device is then directly mounted onto a micromanipulator, allowing the user to control both its position and the suction with a single hand directly at the micromanipulator. This conveniently leaves the other hand free to stabilize and move the transplantation dish containing donor and host embryos. The device works by direct suction with air and does not need to be filled with mineral oil. Due to the attractive forces between the water and the walls of the glass needle, a large movement in the plunger of the syringe is translated into a smaller movement in the water level within the needle, as long as the water level is in the tapered end of the glass needle. This allows precise control over the number of aspirated cells and the location of their insertion.
To demonstrate the utility of this device, we present three applications in zebrafish (Danio rerio) embryos. First, we show how to generate localized sources of secreted signaling molecules, which can be used to study gradient formation2,4,6. Here, donor embryos are injected with mRNA encoding a fluorescently labeled signaling molecule. The fluorescence-labeled donor cells are then transplanted to wild-type host embryos where the formation of a signal gradient can be imaged and analyzed. Second, we describe how the device can be used to remove cells by extirpation in order to generate size-reduced embryos5,13. Finally, we show how to robustly produce maternal-zygotic mutants by transplanting cells carrying a primordial germ cell reporter into host embryos in which the germ line had been ablated6,10. In the future, the transplantation device described here can be easily adapted to other embryological manipulations requiring the removal or transplantation of cells.
1. Assembling and using the transplantation device
2. Generating ectopic sources of secreted signaling molecules in zebrafish embryos
3. Generating size-reduced embryos by cell extirpation
4. Creating maternal-zygotic mutants by germline transplantation
Success and failure in the usage of the transplantation device for the three applications described above can readily be assessed by visual inspection under a stereomicroscope. In successful transplantations, the embryo should look normal and similar in shape and yolk clarity to untransplanted embryos, without large tears in the blastoderm. If the embryo is visibly damaged (Figure 4B), it will not develop normally. Ideally, transplanted cells expressing a fluorescent marker should appear as a continuous column when viewed under a fluorescence stereomicroscope (Figure 2A, Figure 4A). If the column is fragmented, this indicates that the cells were sheared by the suction into the transplantation needle or that the deposition of the cells was done too vigorously. This can be prevented by moving the plunger more slowly and gently.
Although the transplantation device has mainly been used on zebrafish embryos at blastula stages5,6, transplantation and cell extirpation work just as well for dechorionated blastula-stage embryos of the Japanese rice fish medaka (Oryzias latipes) (Figure 2B). Apart from embryo dechorionation, which has been described by Porazinski, S. R. et al.17, the same procedures as described above can be followed.
In the specific case of germline transplantation, a good transplant will result in an embryo with a long horizontal column of cells directly above the yolk margin (Figure 4A). However, whether germ cells were successfully transplanted can only be assessed on the following day (Figure 4C-F) due to background expression of GFP at blastula stages (Figure 1F). The primordial germ cells will appear as small fluorescent spheres in the groove directly above the yolk extension (Figure 4C-E). The presence of these cells at the correct location indicates successful germline transplantation. Cells with a different shape are not germ cells (e.g., elongated cells are typically muscle cells, Figure 4F). Also, if primordial germ cells are found outside the groove, this means that they have failed to migrate properly, and they will not be able to contribute to the embryo's germline. Finally, the general morphology of transplanted embryos should appear similar to untransplanted embryos (Figure 4D); the tail should not be deformed, and the head should not be shrunken or missing eyes (Figure 4E). These defects generally result from excessively high morpholino concentrations or from embryo damage during transplantation. Germline transplantation experiments as described here will typically result in 1-2 out of 6 host embryos with successfully transplanted germ cells for 60%-80% of donor embryos, depending on the experience of the experimenter. Thus, cells from 40-50 homozygous donor embryos need to be transplanted into 200-300 host embryos to raise approximately 30 individuals with mutant germ cells.

Figure 1: Assembly and usage of the transplantation device. (A) The transplantation device is assembled by connecting a gas-tight syringe with a micropipette holder through Luer lock fitting. The glass needle for transplantation is then inserted into the micropipette holder. (B) Photograph of the assembled transplantation device mounted onto a micromanipulator (please note that background and labels have been removed from the picture). (C) When using the transplantation device, it is important to ensure that the water level in the transplantation needle remains at the tapered end. (D) The device is used under a stereomicroscope to withdraw and insert cells from and into teleost embryos placed in individual wells of a transplantation dish. (E) For the generation of ectopic sources, cells are taken from the animal pole of a donor embryo (i-ii) and transferred into the animal pole of a host embryo (iii-vi). (F) For germline transplantation, a larger number of cells is taken from the margin of a donor embryo (i-ii), where the germ cells are located. The cells are then transferred into the margin of host embryos (iii-vi). Please click here to view a larger version of this figure.

Figure 2: Generating clones by cell transplantation. (A) Example of a double clone generated by sequential transplantation of fluorescent cells (green) from a zebrafish donor into a zebrafish host embryo. Single and double clones can be used to study how secreted signaling molecules form spatiotemporal gradients2,4,5,6. (B) Example of a single clone generated by transplanting cells from a transgenic eGFP-expressing medaka donor (Wimbledon)17 into a wild-type medaka host. Scale bars represent 100 µm. Please click here to view a larger version of this figure.

Figure 3: Generating size-reduced embryos by cell extirpation. (A) Before removing cells by extirpation, the YSL can be labeled by injecting fluorescent dyes into two opposing sides of the YSL. (B) Example of an embryo after YSL injection. (C) To generate size-reduced embryos, cells from the animal pole are removed by extirpation5. (D) Example of an embryo after cell extirpation. Note that the YSL stays intact. Scale bars represent 100 µm. Please click here to view a larger version of this figure.

Figure 4: Germline transplantation. (A) Example of a successful transplantation of donor cells (green) into the host's marginal zone. (B) Example of an unsuccessful transplantation. The yolk of the host embryo was severely damaged, and the embryo will not be able to develop normally. (C) At 30 hpf, successfully transplanted germ cells will be found solely in the gonadal mesoderm at the anterior region of the yolk extension. (D) Example of a successful transplantation in which several GFP-labeled donor germ cells have populated the host's future gonad. (E) Example of an unsuccessful transplantation. Although germ cells have reached the gonadal mesoderm, the host embryo is severely deformed and will not develop normally. (F) Example of an unsuccessful transplantation. Fluorescent germ cells that failed to migrate into the correct location will not repopulate the gonads. Scale bars represent 100 µm. Images in D-F were taken at a total magnification of approximately 50x. Please click here to view a larger version of this figure.
The success of a transplantation experiment strongly relies on the fine motor skills of the experimenter. To successfully carry out the procedures, practice is required. However, the instrument presented here is relatively easy to learn and use compared to others on the market, and, in general, only a few days of practice are needed.
The success of the transplantation procedure can be enhanced by taking several precautions. One step is to ensure that the micromanipulator is of good quality and capable of smooth operation. Adding an ocular with higher magnification to the stereomicroscope can help to precisely position the needle relative to the embryo. Using well-breeding zebrafish or medaka to acquire healthy embryos and taking care not to damage the embryos during handling (especially during and after the dechorionation step) will also enhance the success rate.
Problems with delayed toxicity can be more difficult to troubleshoot. If an embryo dies after a few hours - but not immediately following transplantation - the yolk might have been damaged by the needle (e.g., by entering the embryo too deeply), or perhaps the cells were ejected too forcefully. Delayed toxicity and embryonic death can also result from yolk or cell debris injected along with the donor cells; another cause can be deteriorating HEPES buffer in the Ringer's solution. These problems can be overcome by washing the cells (see step 1.3.8) or by simply using a fresh batch of buffer, respectively. Furthermore, deformed host embryos in germline transplantation experiments might result from excessively high morpholino concentrations. It is crucial to use enough morpholino to fully ablate the host's wild-type germline, thereby preventing these cells from contributing to the offspring - but at the same time, excessively high morpholino concentrations need to be avoided. Consistent morpholino amounts across all injected host embryos (a few hundred in a typical experiment) are therefore key to the success of germline transplantations. This can be helped by supplementing the morpholino injection mix with an easily visible tracer dye14, which can be tracked under a fluorescence stereomicroscope to ensure that all embryos receive the same injection volume.
The procedures described in this protocol exclusively involve manipulations of cells in blastula-stage zebrafish or medaka embryos, but in the future, it will likely be possible to adapt the device to different stages and species by changing the diameter and shape of the transplantation needle.
The authors have no conflicts of interest to declare.
This project was supported by the Max Planck Society and received funding from the European Research Council (ERC) under the European Union's Horizon 2020 research and innovation program (grant agreement No. 637840 (QUANTPATTERN) and grant agreement No. 863952 (ACE-OF-SPACE)).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 1.0 mm glass capillary, ends cut without filament | To make the transplantation needle | ||
| 1.0 mm glass capillary, ends cut with filament | To make injection needles | ||
| 200 mL glass beaker | For embryo dechorionation | ||
| 24-well plastic plate | To be coated with agarose in order to incubate embryos | ||
| 5 cm diameter glass Petri dish | For embryo dechorionation | ||
| 6-well plastic plate | To be coated with agarose in order to incubate embryos | ||
| Agarose | To coat plastic dishes | ||
| dnd1 morpholino | Gene Tools | Sequence: GCTGGGCATCCATGTCTCCGAC CAT | |
| Embryo medium | 250 mg/L Instant Ocean salt, 1 mg/L methylene blue in reverse osmosis water adjusted to pH 7 with NaHCO3 | ||
| Fluorescence stereomicroscope with GFP/RFP filters and light source | To assess YSL injections and germ-line transplantations | ||
| Glass micropipette puller | Sutter Instrument Company | P-1000 | To make the transplantation needle |
| Glass pasteur pipette | Kimble Chase (via Fisher) | 63A53WT | For pipetting embryos; the tips can be flamed to smoothen out the edge |
| Incubator at 28 °C | For incubating zebrafish embryos | ||
| Luer tip 25 μL Hamilton syringe, 1700 series | Hamilton | Ref: 80201 | Part of the transplantation device |
| Manual micromanipulator with 3 axes of movement | Narishige | M-152 | For controlling the transplantation device |
| Manual pipetting pump | Bio-Tek | Cat. # 641 | For use with the glass pipettes to transfer embryos |
| Metal dissecting probe | For moving and rotating zebrafish embryos | ||
| Microforge | Narishige | MF2 | To make the transplantation needle |
| Microinjection apparatus | For injection of mRNA and morpholino into embryos | ||
| Microinjection molds, triangular grooves | Adaptive Science Tools | TU-1 | To prepare microinjection plates with agarose |
| Microinjection-molds, single wells | Adaptive Science Tools | PT-1 | To prepare transplantation plates with agarose |
| Micropipette holder with Luer fitting for a 1.0 mm glass capillary | World Precision Instruments | MPH6S10 | Part of the transplantation device |
| mMessage mMachine Sp6 transcription kit | Life Technologies | AM1340M | To generate capped mRNA for injection into embryos |
| Plasmid with GFP-nos1 3'UTR | Plasmid that can be transcriped to produce mRNA encoding GFP with the 3'UTR of nos1 | ||
| Plastic petri dish 100 mm | To be coated with agarose in order to make injection and transplantation dishes | ||
| Protease from Streptomyces griseus | Sigma | P5147 | For embryo dechorionation: Make a 5 mg/ml stock and use at 1 mg/ml to dechorionate embryos |
| Ringer’s solution | For 1 L: Add 6.78 g of NaCl, 0.22 g of KCl, 0.26 g of CaCl2 and 1.19 g of HEPES; then fill to 1 L; adjust pH to 7.2; sterilize by filtration | ||
| Stereomicroscope | For injection and transplantation |