Author Produced

La secuenciación de la microflora bacteriana en la sangre periférica: Nuestra experiencia con pacientes infectados por VIH

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nuestro experimento muestra cómo realizar un análisis de la secuencia de translocación de especies de bacterias en la sangre periférica de los pacientes VIH positivos.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El tracto gastrointestinal es fisiológicamente sanos colonizados por una gran variedad de microbios comensales que influyen en el desarrollo de la humoral y celular 1,2 mucosa del sistema inmunológico.

Microbiota está protegido del sistema inmune a través de una fuerte barrera de la mucosa. Las infecciones y los antibióticos son conocidos por alterar la barrera normales del tracto gastrointestinal y la composición de las bacterias residentes, lo que puede resultar en posibles anomalías inmunológicas 3.

El VIH causa una brecha en la barrera gastrointestinal con insuficiencia progresiva de la inmunidad de la mucosa y la fuga hacia la circulación sistémica de bioproductos bacterianos, tales como lipopolisacárido y fragmentos de ADN bacteriano, lo que contribuye a la activación inmune sistémica 4-7. Translocación microbiana está implicado en el VIH / SIDA inmunopatogénesis y respuesta al tratamiento 4,8.

El objetivo fue caracterizar la composición de las bacterias translocación en la sangre periférica de los pacientes infectados por VIH. Para perseguir nuestro objetivo hemos creado una reacción de PCR para el gen 16S panbacteric ribosomial seguido de un análisis de secuenciación.

En pocas palabras, toda la sangre de ambos sujetos infectados por el VIH y saludable se utiliza. Dado que los individuos sanos presentan homeostasis intestinal normal sin desplazamiento de la microflora se espera que en estos pacientes. Tras la recogida de sangre entera por punción venosa y la separación del plasma, el ADN se extrae del plasma y se utiliza para llevar a cabo una amplia gama de reacción de PCR para el gen 16S panbacteric ribosomial 9. Tras la purificación análisis de productos PCR, clonación y secuenciación se llevan a cabo.

Protocol

Manejo de las muestras de sangre infectada por VIH requiere de algunas recomendaciones importantes.
Todas las muestras de sangre deben ser transportados en robusta a prueba de fugas de contenedores. Se debe tener cuidado en la recogida de la muestra para evitar la contaminación del exterior del recipiente y de cualquier documentación que acompaña la muestra.
Todas las personas de procesamiento de la sangre infectada debe usar guantes. Los guantes deben ser cambiados y lavarse las manos después de la finalización del procesamiento de las muestras.
Procesamiento de muestras de sangre infectadas con el VIH deben realizarse en una campana de clase II cámara de bioseguridad.
Mecánicos de pipeteo debe utilizarse.
El uso de agujas u otros objetos punzantes (como por ejemplo las pipetas de vidrio o tubos capilares) debe limitarse a situaciones en las que no hay otra alternativa.
Superficies de laboratorio deben ser descontaminados con un desinfectante químico apropiado después de un derrame de sangre y cuando las actividades son el trabajo realizado.
Los materiales contaminados utilizados deben ser descontaminados antes de su reutilización o deben ser eliminados correctamente por la vía de desechos clínicos.
Todos los incidentes de exposición ocupacional a sangre o fluidos potencialmente infecciosos (es decir, aquellos que requieren precauciones universales) y debe ser tratada como una emergencia médica ya que las intervenciones deben iniciarse pronto posible para ser eficaz.
El protocolo requiere 5 días para su finalización. El plazo se detalla en la Figura 1.
Las especies bacterianas se identifican utilizando los métodos descritos en la Figura 2.

1. Recogida de muestras

  1. 9 ml de sangre entera se extrae en los tubos que contienen EDTA.
  2. Tubos se centrifugan a 2000 rpm durante 10 minutos a temperatura ambiente para obtener el plasma.
  3. Plasma se recoge en un estéril de 2 ml Eppendorf-tubo.

2. Extracción de ADN de muestras de plasma

  1. Desinfectar adecuadamente cubierta, pipetas y materiales necesarios para el experimento con el fin de garantizar la esterilidad.
  2. Posición de todos los materiales bajo luz UV por lo menos durante 30 minutos.
  3. Limpie los guantes con un desinfectante.
  4. Remojar algunas toallas de papel en etanol y colocarlos bajo el capó. Cada vez que un extremo se descarta limpiar la pipeta sobre las toallas de papel húmedo.

Se extrae el ADN utilizando un kit comercial siguiendo las instrucciones del fabricante (Easy-ADN Kit, Invitrogen, Carlsbad CA, EE.UU.).

  1. 350 L de plasma se colocan en un tubo estéril de 2 ml eppendorf.
  2. 350 L de agua ultra pura filtrada se utilizó como control negativo.
  3. Añadir 10 l de lisozima (1mg/ml) a las muestras.
  4. Incubar durante 30 minutos a 37 ° C.
  5. Añadir 500 l de solución de lisis y mezclar suavemente con las muestras.
  6. Incubar durante 7 minutos a 65 ° C.
  7. Añadir 900 l de cloroformo para las muestras.
  8. Agitar vigorosamente hasta que las muestras están uniformemente viscosa.
  9. Añadir 200 l de solución de precipitación y agitar vigorosamente.
  10. Centrifugar las muestras a 10.500 rpm durante 10 minutos a temperatura ambiente para separar las fases y formar la interfase.
  11. Transferir la fase acuosa superior a un tubo de microcentrífuga fresco que contiene 1 ml de etanol al 100%.
  12. Centrifugar las muestras a 10.500 rpm durante 10 minutos a 4 ° C.
  13. Eliminar el etanol.
  14. Añadir 1 ml de etanol al 70%.
  15. Centrifugar las muestras a la máxima velocidad durante 10 minutos a 4 ° C.
  16. Eliminar el etanol. El etanol residual debe ser eliminado con un pipettator.
  17. Resuspender el precipitado en 50 L de agua ultrapura.
  18. Lea la concentración de ADN con un espectrofotómetro.

3. Gen 16S rRNA PCR

Amplificación por PCR se lleva a cabo como se describió previamente 9.

  1. Amplificar el ADN en una mezcla de reacción 100 L consta de 10 l de buffer 10X PCR, 5 l de 25 mM MgCl2, 5 l de dNTPs 2 mM totales, 1 l de imprimación M 50 RW01 (AACTGGAGGAAGGTGGGGAT), 1 l de imprimación M 50 DG74 (AGGAGGTGATCCAACCGCA), 34 L de H20 y 0,5 l de Taq polimerasa (AmpliTaq Gold, Applied Biosystems, Foster City, CA, EE.UU.).
  2. La transferencia de la mezcla de PCR en los filtros a fin de evitar la posible contaminación por bacterias de Taq polimerasa.
  3. Filtros de centrífuga (Microcon, Millipore, Billerica, MA, EE.UU.) durante 30 minutos a 500 fcr a 4 ° C.
  4. Alícuota de la mezcla de PCR en función del número de muestras que deben ser amplificado (PCR controles positivos y negativos, y las muestras de agua que se extrae).
  5. Use las siguientes condiciones termociclador: 94 ° C durante 10 minutos, 40 veces durante 1 minuto cada vez que a 94 ° C, 55 ° C y 72 ° C, y 10 min a 72 ° C.
  6. Visualizar el producto de PCR en un 2% en gel de agarosa. Use escalera de 100 bp de ADN. Tamaño del producto de PCR es de alrededor de 360 ​​pb (Figura 3).

4. PCR Purificación del producto

Sólo las muestras positivas de PCR debe ser purificado. Purificación se realiza medianteun fabricante de equipo comercial de las instrucciones siguientes (PCR PureLink MICROKIT, Invitrogen, Carlsbad CA, EE.UU.).

  1. Agregar 4 volúmenes de tampón de unión que contiene isopropanol por un volumen de producto de PCR.
  2. Transferencia del producto de PCR con tampón de unión a una columna.
  3. Centrifugar durante 1 minuto a 10.000 RCF a temperatura ambiente.
  4. Lavar la columna con el tampón de lavado con etanol.
  5. Centrifugar durante 1 minuto a 10.000 RCF a temperatura ambiente.
  6. Centrifugar a máxima velocidad durante 1 minuto a temperatura ambiente para secar la membrana de sílice y eliminar cualquier solución de lavado residual con etanol.
  7. Añadir 10 l de agua ultrapura.
  8. Incubar durante 1 minuto a temperatura ambiente.
  9. Centrifugar a máxima velocidad durante 2 minutos a temperatura ambiente para recoger el ADN purificado.

5. La clonación

Lisogenia caldo (LB) Preparación Plate

  1. Disolver 25 gr de la mezcla de LB en aproximadamente 800 ml de agua.
  2. Llevar el volumen final de 1 L.
  3. Añadir 15 gr de Bactoagar.
  4. Autoclave durante 20 minutos.
  5. Después del autoclave, removerlo vigorosamente la solución en el matraz para mezclar el agar fundido.
  6. Enfriar la solución a 50 ° C.
  7. Añadir ampicilina (50 mg / ml) y agitar hasta que se disuelva.
  8. En placas a una profundidad de aproximadamente 3 mm.
  9. Dejar las placas a temperatura ambiente.
  10. Corre X-Gal (40mg/ml) y IPTG (100 mM) en cada placa de LB y se incuba a 37 ° C hasta que esté listo para su uso.

La transformación de células competentes

La transformación se realiza mediante las instrucciones de un fabricante de equipo después de comercial (Topo TA kit de clonación, Invitrogen, Carlsbad CA, EE.UU.).

  1. Prepare la mezcla de reacción de clonación (1-4 l de agua dulce producto de PCR, 1 l de solución de sal, 1 l de vectores y el agua si es necesario).
  2. Mezcla de reacción suavemente y se incuba durante 5-10 minutos a temperatura ambiente.
  3. Lugar la reacción en hielo.
  4. Añadir 2 l de la reacción de la clonación en un vial de células competentes y mezclar suavemente.
  5. Incubar en hielo durante 30 minutos.
  6. De choque térmico de las células durante 30 segundos a 42 ° C.
  7. Transferir inmediatamente el tubo en hielo.
  8. Añadir 250 ml del medio.
  9. Tape el tubo tighly y agitar el tubo horizontal a 37 ° C durante 1 hora.
  10. Corre 50 L de cada transformación en un plato precalentado selectiva.
  11. Incubar toda la noche a 37 ° C.

Después de la incubación, las colonias de color blanco y azul se desarrollan en las placas. Las colonias blancas son positivas para la inserción de producto de PCR y las colonias azules son negativos para la inserción de producto de PCR.

6. El análisis de secuenciación

La reacción de secuenciación

  1. Una mezcla se realiza con estos reactivos: 2,5 l de ADN, una imprimación l (5pmol / l) 1,1 l BigDye (Applied Biosystems, Foster City, CA, EE.UU.).
  2. Condiciones termociclador: 96 ° C durante 1 minuto, 25 veces de 96 ° C durante 10 segundos, 55 ° C durante 15 segundos y 60 ° C durante 4 min.

Columna de purificación

  1. Para cada reacción, preparar una columna MicroSpin (Qiagen, Milán, Italia).
  2. Invertir columna y agitar para mezclar la resina.
  3. Quite la parte inferior de la columna, afloje la tapa de ¼ de vuelta, y la columna en un tubo de microcentrífuga.
  4. Centrífuga 3200 rpm durante 1 minuto.
  5. Transferencia de columna a un tubo de microcentrífuga limpio.
  6. Pipeta cuidadosamente toda la secuencia de reacción de PCR en el centro de la columna.
  7. Centrífuga 3200 rpm durante 1 minuto.
  8. ADN purificado se eluite en el tubo (20 l de agua ultrapura).

El análisis de secuenciación

  1. Cargue la muestra purificada (20 l) en 96-pocillos de la placa.
  2. La carga de la placa en el secuenciador. Secuenciadores automáticos de ADN generan un cromatograma de cuatro colores que muestra los resultados de la ejecución de la secuencia.
  3. Entrada de la secuencia de nucleótidos como una consulta en las bases de datos públicos de secuencias. La búsqueda se realiza sobre la base de datos NCBI y servidores, con herramientas básicas de búsqueda local de alineación (BLAST).
  4. Tenga en cuenta sólo las bacterias con homologías 98-100%.

7. Resultados representante

Figura 1
Figura 1. Cronología del procedimiento.

Figura 2
Figura 2. Diagramas de flujo del procedimiento de identificación de bacterias enteras.

Figura 3
Figura 3. 2% en gel de agarosa que muestra una amplia gama de 16S rRNA gen PCR. El carril 1 contiene una escalera de 100 pb de ADN, el carril 2 contiene el control positivo de PCR, carril 3 muestra el control negativo de PCR. Carril 4 muestra ejemplos de un paciente VIH-positivo, y la calle 5 contiene el agua. Carril 6 SHujos de muestras de un individuo sano y una negativa reacción de PCR; carril 7 contiene agua. Sólo los pacientes con VIH positivo muestra una amplificación por PCR. Agua ultrapura utilizada como control negativo durante la etapa de extracción, indica que no hubo contaminación.

Figura 4
Figura 4. 0,7% en gel de agarosa mostrando plásmido extraído con el procedimiento minipreparación. El carril 1 contiene una escalera de 1 kilobase ADN, carril 2 contiene la colonia de control azul, calles 3 y 12 contienen colonias de color blanco. El plásmido de la colonia azul no contiene el prospecto del producto de PCR. Todas las 10 colonias de color blanco contienen el plásmido con el inserto correcto.

Figura 5
Figura 5. Muestra un ejemplo de análisis de secuenciación de bacterias en el plasma de una persona VIH-positiva individual. Nuestros resultados muestran que la translocación microbiana en la infección por VIH supone una flora polimicrobic, que no se ve en personas VIH negativas temas, lo que sugiere el fracaso sustancial de la inmunidad intestinal en el control de la translocación de bacterias.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No hay conflictos de interés declarado.

Acknowledgements

Estamos muy agradecidos a Scimone Gianni por su excelente asistencia con la fabricación de video.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics