מי הוא מי? שיטות לא פולשנית בנפרד כדי סקס ואפרוחים חובשי קן מארק

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

פרוטוקול זה מספק ערכה נוחה של שיטות, אשר מאפשרת מהיר מאוד, קל, לא פולשנית, אמין ובעלות נמוכה, נחישות מולקולרית מין של ציפורים ולא פולשנית מהירה, בטוח וקלה לזיהוי לסימונם, זמן קצר לאחר הבקיעה. רק טיפול מוגבל של אפרוחים נדרש. ארגז כלים נוחים זה של שיטות תואם לחלוטין עם RRR-ההנחיות.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ניסויים רבים דורשים נחישות מוקדמת של המין של הצאצאים, כמו גם מוקדם סימון של יילודים לזיהוי פרט. על פי הנחיות לרווחת בעלי החיים, יש להעדיף טכניקות לא פולשנית בכל פעם שישימה. בקבוצה שלנו, אנחנו עובדים על מינים שונים של ציפורים שיר במעבדה ובשדה, ואנחנו מיישמים בהצלחה בשיטות שאינן פולשנית למין ובנפרד לסמן אפרוחים. מאמר זה מציג ארגז כלים לא פולשנית מקיף. זיהוי מין ציפורים לפני הביטוי של תכונות מיניות משניים דורש איסוף חומר DNA נושא עבור ה-PCR. הקמנו שיטה מהירה וקלה לציפורים ממין בכל גיל (לאחר בקיעה) על ידי מיצוי DNA ממטליות buccal. ניתן להשיג תוצאות בתוך 3 שעות. לנוצות במורד של חומוס סימון בודד הם גזומים בדפוסים מסוימים המאפשרים זיהוי מהיר בתוך סדר הבקיעה. זו קבוצה של שיטות היא ישימה בקלות במעבדה סטנדרטית מאובזרת ומתאים במיוחד לעובדg בתחום כללא ציוד מיוחד הנדרש לדגימה ואחסון. טיפול באפרוחים הוא ממוזער וטכניקות לסימון וזיהוי מין הן לא פולשנית וכך תומכות RRR-העיקרון של קווים מנחים לרווחת בעלי החיים.

Introduction

הכרת פרט, זיהוי מין באמצעים וגנוטיפ הם תנאים מוקדמים בסיסיים במגוון רחב של מחקרים ניסיוניים. השגת חומר נושאות דנ"א וסימון נושאים באופן חד משמעי (גם בגיל צעיר) צריכה להיות השפעה מינימאלית על פיזיולוגיה, התנהגות והישרדות. במידת האפשר, יש להימנע מפרוצדורות פולשניות על פי עיקרון RRR 1.

שיטות לא פולשנית אינן מועילות רק לבעלי החיים אלא גם עשויה לשפר את הנתונים המתקבלים כחיות מושפעות פחות מהטיפולים.

בציפורים, זיהוי מין באמצעי DNA יכולים להתבצע על מספר חומרים בר השגה הלא פולשני כגללים 2, נוצות 3,4 או מטליות buccal 3,5,9. ללא קשר למטליות buccal המצב וגיל של הנבדק הן שיטת בחירה של זיהוי מין באמצעי עופות, כי הם קלים לביצוע, רק לעתים נדירות מצליחות והטיפול הוא קצר.

עד כה, ה-DNA ממטליות buccalהופק גם עם ערכות זמינות מסחרי 3,6 או זמן רב פרוטוקולי מיצוי DNA סטנדרטיים 3,6-8. ערכות הן לא רק יקרות למדי, אבל בפרוטוקולים שלהם יכולים להטיל אתגרים לעבודת שטח. כמה פרטים פרוצדורליים, כגון ייבוש ודגירה של דגימות, אינם מעשיים בתחום. במיוחד בסביבה שבי פרוטוקולי ניסוי דורשים טיפול תלוי מין ממוקדם ככל שלאחר דקות ספורות בקיעה, יש דחף לשיטה מהירה, לא פולשנית, אמינה וקלה להשגת תוצאות.

מעבר למיני עופות ארגז כלים משמעותיים ליחידים לציון פותחו 10. המגוון הרחב של הטכניקות זמינות חשבונות עבור מגוון רחב של מטרות מחקר, מינים ותקציבים. עם זאת, סימון גוזלים קטנים התמודד חוקרים עם אתגרים נוספים. בכמה מיני אפרוחים (למשל passerines) הם קטנים מדי כדי להחיל להקות רגל ודורשים שיטות חלופיות, אשראינו משנה הורה לצאצאי התנהגות. כמודעות ועניין בשיפור רווחת בעלי חיים וטכניקות במחקרי שדה ומעבדה גדלה, השימוש בטכניקות לא פולשנית הוא מומלץ מאוד ועדיף.

פרוטוקול זה מספק שיטה לא פולשנית, מהירה, קל לזיהוי ומתמשכת לציון גוזלים צעירים מאוד אינדיבידואלי לפני יישום להקות רגל אינו ריאלי. שיטת סימון זו הציגה באחד מיני מודל מעבדת עופות החשובים ביותר, הזברה פינק (guttata Taeniopygia) 11-13. הפרוטוקול עומד בכל המטרות שפורסמו בעבר לטכניקות סימון בודד 10 וכבר הוחל 14,15 בהצלחה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל הנהלים בוצעו בעמידה בחוק הגרמני להגנה על בעלי חיים (TierSchG).

1. הכנה של חומרים כימיים ומתכלה

  1. הכן במי כיתה מולקולרית Chelex-100 5% (w / w) פתרון. הכן aliquots של 200 μl בצינורות תגובת 1.5 מיליליטר סטנדרטיים. כמו שרף Chelex משקעים מהר מההשעיה יש צורך מחדש homogenize ההשעיה במהלך תקופת ההכנה של aliquots כל הזמן. זה רצוי להכין 50 מיליליטר או יותר בצרור אחד ולשמור על ההשעיה הומוגני באמצעות בוחש מגנטי. פתרון Chelex יכול להיות מאוחסן במשך שנים בתנאי הסביבה.
  2. חותכים חתיכות של נייר Whatman עם רוחב קטן יותר מאשר רוחב המקור של ציפור להיבדק. אורכו של הנייר תלוי בשיטה לקחת המדגם:
    1. בעזרת מלקחיים, החתיכה צריכה להיות ארוכה מספיק כדי לאפשר איסוף דגימה בלי המלקחיים להיות מוכנסים לתוך המקור של ציפור. בתורהערכה גסה, לאורך מקור של 0.5 סנטימטר פיסת נייר עם האורך של 1 סנטימטר צריכה להיות בסדר.
    2. אם לא משתמש במלקחיים, החתיכה צריכה להיות ארוכה יותר, אך את הנוקשות של פיסה עדיין צריכה לאפשר דגימה של תאי האפיתל.
  3. הכן aliquot אחד premix PCR עבור כל דגימה להיות מנותחים. עבור ה-PCR בנפח כולל של 25 μl התערובת מכילה 0.18 מ"מ dNTPs, 2 מ"מ MgCl 2, 70 מ"מ טריס-HCl, אמוניום סולפט 17.25 מ"מ, 0.1% (TCTGCATCGCTAAATCCTTT), P8 0.32 מיקרומטר Tween-20, פריימר P2 0.32 מיקרומטר פריימר פולימראז תקי (CTCCCAAGGATGAGRAAYTG) 16 ו -2 יחידות. ניתן להשתמש פולימראז תקי תוצרת בית 17. כדי לאפשר תוספת של הסכום המקסימאלי של ה-DNA פתרון, premix 6 μl יכולה להיות מוכנה ומאוחסן ב -20 מעלות צלזיוס למשך מספר שבועות.

2. אוסף דוגמאות

לבישת כפפות אינה חיונית לקביעת מין עופות כprimers PCR לא יכול לחשל את ה-DNA האנושי. עבורמטרות גנוטיפ אחרות זה יכול להיות מומלץ.

  1. ללכוד את ציפור של עניין ובעדינות להחזיק אותו ביד לדוגמא, אחד עם "אחיזתו של הצלצול '18. ודא שלא לסחוט את ציפור.
  2. להחזיק פיסת נייר Whatman עם מלקחיים ולסחוב אותה כמה פעמים על פני החלק הפנימי של הלחיים, הלשון וchoana. בדרך כלל דגימות מתקבלות בתוך פחות מ 30 שניות.
    1. בעלי חיים מבוגרים: בהתאם למין זה עלול להיות קשה כדי לקבל את ציפור לפתוח את מקורו. בדרך כלל מלגעת בצד של המקור והפעלת לחץ עדין יעבוד.
    2. גוזלים: דגימה מגוזלים או גוזלים היא קלה במיוחד שימוש בטכניקה זו, כהתנהגות מתחננת מספקת גישה קלה לחלק הפנימי של המקור. זה יכול להיות אפילו להסיג לך את המדגם ללא טיפול בהם בכלל, כפי שהם בקלות להתחנן למשל, כאשר nestbox נפתח.
  3. מייד לאחסן את הנייר בcontai צינור תגובה מוכןנינג 200 μl של 5% (w / w) Chelex-100 פתרון.

אם גם אתם מתכוונים / צריכים לסמן את הגוזלים, לעשות זאת עכשיו כאמור בסעיף 6.

3. אחסון של דגימות לפני הפקת DNA

  1. אם עובד במעבדה, דגימות חנות ב -20 ° C. אם זה לא דגימות חנות אפשרי או קשה (למשל בתחום) בטמפרטורות סביבה.
  2. דוגמאות יכולות להיות מאוחסנות במשך יותר מ -3 שנים בטמפרטורות הנעות בין טמפרטורת חדר ל-20 ° C.

4. הפקת DNA

  1. אם המדגם הוא קפוא, להפשיר אותו בטמפרטורת חדר.
  2. ודא שפיסת נייר היא בחלק התחתון של הצינור השקוע בפתרון Chelex-100.
  3. דגירה דגימות ל15 דקות ב 56 ° C.
  4. וורטקס בקצרה ספין למטה את התוכן של הצינור.
  5. דגירה הדגימות במשך 8 דקות ב100 ° C.
  6. ספין הדגימות ב 15,000 XG במשך 3 דקות.
  7. השתמש ביםupernatant לגנוטיפ שלאחר מכן.

5. קביעת מין מולקולרית

  1. הכן אחד צינור PCR עם 6 premix μl לדגימה בתוספת שני צינורות נוספים עבור שלילי שליטה (חובה) וחיובית (אופציונלית). לקביעת מין שגרתית כולל מדגם מזיהוי המין באמצעים המוצלחים האחרונים כביקורת חיובית.
  2. הוספת 19 μl של supernatant ממיצוי DNA לpremix ה-PCR. הקפד פיפטה מפני שטח של הפתרון כדי למנוע שריד של חרוזים Chelex. זה חיוני, כמו Chelex הוא מחליף קטיון ולכן קשה מעכבת את כל התגובות אנזימטיות.
  3. הפעל את תכנית ה-PCR הבאה: דגירה ב94 מעלות צלזיוס במשך 3 דקות, 45 מחזורים כל אחד עם צעד 30 שניות היתוך 94 מעלות צלזיוס, ואחריו צעד 30 שניות חישול על 55 מעלות צלזיוס, ואחריו צעד התארכות 45 שניות ב72 ° ג בשלב אחרון מרדף כבוי, התגובות שלהם טופחו במשך 5 דקות ב72 ° C.
  4. הכן TBE סטנדרטי 2% או agaro טה ג'ל se להפריד את מוצרי ה-PCR.
  5. הרץ את הג'ל agarose עם הגדרות מתח מתאימות.
  6. דמיינו את הלהקות תחת אור UV ולצלם. ודא שתי הלהקות בדגימות שמקורן בנקבות מופרדות היטב.
  7. להבדיל זכר מדגימות נשיות על ידי הנוכחות של אחד (זכר) או שתי להקות (נקבה).

6. סימון גוזלים

  1. בדקו קינים לגוזלים שזה עתה בקעו על מתאים לוח זמנים למינים / המחקר (כגון שיקים מדי יום בשעתי הבוקר מומלץ כמו רוב האפרוחים יבקעו לאחר מכן).
  2. חותכים את הנוצות למטה של ​​כל אפרוח בתוך קן במיקום אופייני שונה. בזברה פינק קווצות מורדות לצמוח בארבעה תחומים אופייניים ומובהקים על פני (איור 4 א) גופו של הגוזל. עבור כל אפרוח לחתוך תחום אחד (איור 4). אם יש יותר מארבעה אפרוחים בתוך קן אחד, ארבעה "התספורות" הייחודיות ניתן לשלב.
ove_content "> לזברה פינק: למרוח להקות רגל בעשרה ימים שלאחר הבקיעה, כאשר למטה הנוצות להיות קשה לזהות וגודל גוזל מאפשר לצלצל.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

מטליות buccal יכולות לשמש כדי להשיג DNA לקביעת מין במגוון רחב של ציפורים קטנות

דגימות נאספו מהזברה פינק (guttata Taeniopygia, 99 אנשים, גיל 0 ימים - 5 שנים), כנריות (קנריה Serinus), Bengalese פינק (striata Lonchura), זמירים (megarhynchos זמיר), שדיים גדול (Parus הגדול) ושחרורים (Turdus merula) (לכל מינים האחרים: גודל מדגם 1-3, לא ידוע גיל) (איור 1).

לדגימות שנלקחו מהזברה פינק, שיעור ההצלחה לPCRs היה 100%. תוצאת PCR תמיד תואמת את המין שנקבע על ידי קודם (במבוגרים) או במאוחר (בגוזלים) בדיקת פנוטיפי. האינטנסיביות של להקות לא הייתה שונה באופן שיטתי בין גוזלים או מבוגרים מצביעים על כך שכמויות דומות של חומר DNA הנושאות צברו מכל הגילים.

איור 1 "עבור: תוכן width =" 6in "עבור: src =" "/> /" = src "/ files/ftp_upload/51429/51429fig1.jpg files/ftp_upload/51429/51429fig1highres.jpg
זיהוי מין באמצעי איור 1. מולקולרי. דוגמאות לתוצאות זיהוי מין באמצעים ממטליות buccal מתקבלות ממינים עופות שונים. 2% agarose ג'ל מוכתם ברומיד ethidium. משמאל לימין: סמן גודל, זכר הזברה פינק, נקבת Bengalese פינץ', זכר Blackbird, זכר ציצי גדול, זכר נייטינגייל, זכר הקנריים, בקרת מים, סמן גודל.

זה חשוב על מנת למנוע זיהום שריד Chelex בPCRs

כדי להדגים את ההשפעה של זיהום שרף Chelex בתגובת PCR, כללנו כמות קטנה של חרוזים Chelex בתגובת PCR (איור 2). כפי שניתן לראות באיור 2 א, זיהום שריד של חרוזים Chelex מונע ההגברה של ה-DNA שבא לידי ביטוי עוד יותר על ידי חוסר היווצרות דימר פריימר במדגם המזוהם (<> חזק איור 2). באיור 2 א מסלול 2 השתמשנו במדגם זהה לPCR מבלי לשאת מעל Chelex. דגימות מזוהמות בדרך כלל הן לזיהוי בקלות על ידי כתמים כהים בכיסי agarose ג'ל (איור 2).

איור 2
איור 2. זיהום Chelex. א) שריד Chelex לתגובת PCR מעכב את ההגברה של ה-DNA. משמאל לימין:. סמן גודל, זכר הזברה פינק, נקבת הזברה פינק, מדגם זהה עם שריד מכוון של Chelex, בקרת מים, סמן גודל B) חרוזים Chelex הן בקלות נראות לעין ככתמים כהים בכיס ג'ל (משמאל ללא Chelex , תקין עם Chelex. העיכוב החמור של תגובת PCR בנוכחות Chelex גם מאויר על ידי ד פריימר החסרהיווצרות imer במדגם המזוהם.

דוגמאות ניתן לאחסן בטמפרטורת חדר לפני מיצוי DNA במשך יותר משלוש שנים

כדי לחקור האם חילוץ מוצלח עדיין יכול להתבצע לאחר אחסון ארוך, דגימות נלקחו שוב ושוב מאותה ציפור ומאוחסנות במעבדה בטמפרטורת הסביבה למקסימלי שלוש שנים. הדגימות אוחסנו בסמוך לחלון עם חשיפה טבעית לאור וחום מהשמש. לאחר שלוש שנות DNA הופק וPCR זיהוי המין שבוצע. התוצאה תאמה את אחד ביצעה שלוש שנים קודם לכן (מייד אחרי הדגימה) ולא הצביע על השפעה כלשהי של אחסון (איור 3).

איור 3
איור 3. Chelex מאפשר אחסון לטווח הארוך של דגימות befoמחדש ואחרי ה-DNA חילוץ. דוגמאות של שתי חיות (משמאל זכר, נכון נקבה) אוחסנו בתנאים שונים כפי שמצוינות בטבלה. אותות התקבלו בהצלחה מכל המדגמים.

איור 4
איור 4. סימון של אפרוחים. א) ייצוג ומינוח של ארבעה האזורים נפרדים של צמיחת נוצות למטה בגוזלים פינק זברה סכמטי:. תמונות = הראש, B = גב, C = כנפיים (שניהם), D = אגפים (שני) ב ') דוגמא של גוזלים אשר גם קיבל אחד "התספורות" המתאימות לא 'תספורת' (E) (AD) או.

ה-DNA שחולץ יכולה להיות מאוחסן במשך יותר משלוש שנים על 4 מעלות צלזיוס

דגימות זברה פינק מהניסוי הראשון היו מאוחסנות במשך שלוש שנים ביום שישי מעבדה סטנדרטיתdge על 4 מעלות צלזיוס ובהצלחה להערכה מחדש. כל הדגימות הניבו את אותן תוצאות כמו ה-PCR ישירות לאחר מיצוי DNA (איור 3).

יכולים להיות מסומנים על ידי זמירה גוזלים הנוצות למטה שלהם כדי לאפשר הכרה בודדת מבקיעה על

סימון גוזלים בודדים מייד אחרי הבקיעה על ידי קיצוץ נוצותיהם במורד גרם להם קל לזיהוי (איורים 4, 5, 6). למטה יש נוצות מראה רך כמו העקיצות שלהם לא חבר יחד כדי ליצור שבשבת חלקה. הם עדיין יכולים להיות מוכרים בposthatch יום 10 על קצות הנוצות מתפתחות, שעד אז לכסות את הגוף (איור 5). היעדרם במקומות שונים הופך את זיהוי קל, לפעמים גם ללא טיפול בגוזלים (איור 6). יישום שנקרא `תספורות" אלה הוא טכניקה אלגנטית, שממלאת בהצלחה את הפער בפעם מבקיעה עד לגודל הגוף של גוזל finc זברההס הופך את היישום של להקות רגל אפשרית.

איור 5
איור 5. מסומנת גוזלי הזברה פינק בהודעת הפתח יום 10. תמונות להראות גוזלים או עם (מספריים) או בלי סימונים (חץ). חץ מצביע למיקום של עניין על פי המינוח בהתאמה של "תספורות" נוצות: = ראש, B = גב, C = כנפיים, D = אגפים.

איור 6
איור 6. הכרת גוזלים מסומנים (גיל ממוצע = 10 ימים) בתוך קן הלידה על פי המינוח.= ראש, קל לזהות בשל הנוצות למטה הבולטות שלו, שחסרים רק על הראש. B = גב, למטה נוצות גלויות בכל המקומות, אבל על הגב. C = הכנפיים, זקוק לצופה קשוב כשני האגפים חסרים למטה נוצות, היציבה אבל גוזל של הופכת את הנוצות למטה מראשו לכסות את האגף הימני. D = חביות, יכולות להיות מוכרות רק על ידי התהליך של אלימינציה שלא ניתן לראות צלעותיו. זה יכול להיות מוכר באופן אמין כD כפי שהיא מציגה צמיחת נוצות ברורה למטה בראש, בגב ובכנפיו. E = שילוב של הראש "תספורות" () ובחזרה (ב '), קל להבחין בפלומת נוצות על הראש והגב חסר. F = שילוב של "תספורות" (ראש) ו-D (צלעות), שיכול להיות מובחן רק באמצעות ביטול אפשרויות אחרות בראשה הסימון ברור ולא גוזל לא מזוהה אחר מציג את הראש לציון. = G לאקיבל כל סימונים והוא הרבה יותר קטן האחים שלו כפי שהוא היה אחרון לבקוע. בנוסף G הוא דוגמא טובה לגוזל שאינו מבטא את נוצות בכל המקומות.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

זיהוי מין ממטליות buccal באמצעות Chelex הראה שיעור הצלחה גבוה מאוד. הנוצות למטה של ​​גוזל חיתוך אפשרו הבחנה בין גוזלים עד פסי רגל היו אפשריים.

חילוץ Chelex-DNA ממטליות buccal הניב מספיק DNA כדי לבצע זיהוי מין באמצעים מולקולריים בהצלחה. קביעת מין הייתה 100% נכונה כאומת על ידי נוצות מיניות דימורפית. שיעור ההצלחה המדווח כאן הוא גבוה במידה ניכרת מהשיעור שדווח על ידי שני מחקרים קודמים 7,9. מיצוי DNA עם Chelex ממזער צעדי pipetting ומשקעים שבו יכול ללכת לאיבוד חומר. עם זאת, אחד ממחקרי אימות הפרוטוקול שלנו במינים שונים (ציפור גן עדן ציפור הגן עדן) עדיין השיג שיעורי הצלחה נמוכים יותר של 89% 9 למרות שזה כבר היה גבוה במידה ניכרת מאשר 82% שדווחו בארימה et al. 7.

מה יכול להיות הסיבה לכך? החלק החשוב ביותר הוא לעקוב בתשומת לב protocol, כולל חלק לאיך לקחת דגימות (מספר פעמים רקמות בעדינות לסחוב בפה) וכדי למנוע לשאת על חרוזים Chelex לתגובת PCR. כChelex הוא מחליף קטיון זה קשה מעכב את תגובת PCR מניעת הגברה בדגימות מזוהמות. יכולות להיות מוכרות על דגימות מזוהמות בקלות על ידי חרוזים גלויים בכיסים של ג'ל agarose וחוסר הדימרים פריימר.

פחות סיבות לכישלון להצלחת דגימות מין יכולה להיות גם בשל הבדלי מין או השימוש בטכנולוגיה שונה כדי לזהות את ההבדל בלהקה הנשית הדגימות.

חיתוך הנוצות למטה של ​​פרושים זברה גוזל הוא דרך בטוחה כדי לסמן בנפרד נושאים. "תספורות" אלו היו קלה לזהות עד הגוזלים היו מבוגרים מספיק כדי לקבל להקות ממוספרות רגל (למשל ביום 10 בזברה פינק). טכניקת סימון זה עשויה להיות מותאם בקלות לפגוש experim שונהדרישות ental; למשל להקלטות וידאו יכולים להיות מוגבלות סימנים לראש של אפרוחים. שילובים של קיצוצים בשתי עמדות יכולים להיות מיושמים אם קינים גדולים יותר מחמישה גוזלים. שמירה על רצף מוגדר מראש ביישום 'תספורות "(לדוגמא: הגוזל הראשון בקן תמיד מקבלת" תספורת ", השני תמיד מקבלת' ב 'תספורת' וכו ') מאפשר זיהוי מהיר בתוך סדר הבקיעה בכל שלב הגוזל. זה מאפשר זיהוי מהיר, אשר יכול להפחית או אפילו למנוע טיפול באפרוחים. בזברה פינק, חוסר ירידות באחד מארבעת המקומות יכול להתרחש עקב תנודות טבעיות. לכן, זה לא יכול להיות תמיד אפשר לדבוק ברצף לציון שהוגדר מראש.

אפילו למישהו מנוסה בטיפול בגוזלים זה מהר ללמוד, טכניקת סימון בטוחה וקלה לחתוך את הנוצות למטה. עם זאת, כתגובה הפעורה המולדת של גוזלים כוללת תנועות ראש, חלק מאנשים מוצאים את זה קשה יותר למקם מרץמלכים על הראש. זיהוי נוטה שגיאה מסתמך על סימונים מדויקים. זה הוא בעל חשיבות נודע לחתוך ביסודיות את כל נוצות למטה בנקודה מסוימת, כנוצות סימונים לא מושלמים שמאל מחוץ ליחיד / מטה עשויות מאוחר יותר לבלבל את הזהות.

זו קבוצה של שיטות מאפשרת מהר מאוד, קל, לא פולשנית, אמין ובעלות נמוכה, קביעת מין של ציפורים ולא פולשנית מהירה, בטוח וקל לזיהוי לסימון שלהם, בתוך דקות לאחר הבקיעה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש המחברים אין לחשוף.

Acknowledgements

תודה רבות לסלקו קיפר, שרה קיפר, מיכאל וייס, קוני Bartsch וסלק ויגט-Heucke לאוסף נלהב מדגם בתחום, לJanett ירקנפלד להמשך סיוע, לאולה Kobalz לג'לים היפה וטוביאס קראוזה לתמיכה מוראלית.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics