Quem é Quem? Métodos não-invasivos para Individualmente Sexo e Mark altriciais Chicks

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este protocolo fornece um conjunto conveniente de métodos, que permite extremamente rápido, fácil, não-invasivo, confiável e de baixo custo, a determinação do sexo molecular de aves e sua não-invasivo, rápido, seguro e facilmente reconhecível marcando logo após a eclosão. É necessária apenas a manipulação limitado de pintos. Esta caixa de ferramentas conveniente de métodos cumpre totalmente com as diretrizes-RRR.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Muitos experimentos exigem determinação precoce do sexo do filho, bem como início de marcação de recém-nascidos para o reconhecimento individual. De acordo com as diretrizes de bem-estar animal, devem ser preferidos sempre que aplicável técnicas não invasivas. Em nosso grupo, nós trabalhamos em diferentes espécies de pássaros da canção no laboratório e no campo, e aplicar com êxito métodos não-invasivos para sexo e individualmente marcar pintos. Este trabalho apresenta uma abrangente ferramenta de caixa não-invasiva. Sexagem aves antes da expressão de características sexuais secundárias exige a coleta de material de suporte de DNA para PCR. Nós estabelecemos um método rápido e fácil para as aves do sexo de qualquer idade (pós eclosão) por extração de DNA a partir de zaragatoas bucais. Os resultados podem ser obtidos em 3 horas. Por baixo do bico penas marcação indivíduo são cortados em padrões específicos que permitam identificar rapidamente dentro da ordem de eclosão. Este conjunto de métodos é facilmente aplicável em um laboratório padrão equipada e especialmente adequado para trabalhandog no campo como nenhum equipamento especial é necessário para a amostragem e armazenamento. Manipulação de pintos é minimizado e técnicas de marcação e sexagem não são invasivos apoiando assim o RRR-princípio de diretrizes de bem-estar animal.

Introduction

O reconhecimento individual, sexagem e genotipagem são pré-requisitos fundamentais em uma variedade de estudos experimentais. Obtenção de material com DNA e marcação assuntos de forma inequívoca (mesmo em tenra idade) deve ter um impacto mínimo sobre a fisiologia, comportamento e sobrevivência. Sempre que possível, os procedimentos invasivos deve ser evitada de acordo com o princípio da RRR 1.

Os métodos não-invasivos não são apenas benéfico para o animal, mas também pode melhorar os dados obtidos como os animais são menos afetadas pelos tratamentos.

Nas aves, sexagem de DNA pode ser executada em uma série de materiais obtidos não invasiva como excrementos 2, 3,4 ou penas zaragatoas bucais 3,5,9. Independentemente do estado e idade swabs bucais do sujeito são o método de escolha para a sexagem das aves, porque são fáceis de executar, raramente falham e manuseio é curto.

Até agora, o DNA de swabs bucaisou foi extraído com kits disponíveis no mercado 3,6 ou demoradas protocolos de extração de DNA padrão 3,6-8. Kits não são apenas um pouco caro, mas os protocolos podem impor desafios para o trabalho de campo. Alguns detalhes do procedimento, por exemplo, de secagem e de incubação de amostras, não são práticos na área. Especialmente em um ambiente onde protocolos experimentais requerem tratamento dependente sexo já a partir de alguns minutos após a eclosão, há exortar por um método rápido, não-invasivo, confiável e fácil de obter resultados.

Do outro lado da taxa aviária uma caixa de ferramentas considerável para os indivíduos de marcação foi desenvolvido 10. A grande variedade de técnicas disponíveis explica a variedade de objetivos de pesquisa, espécies e orçamentos. No entanto, a marcação das pequenas filhotes confrontou pesquisadores com desafios adicionais. Em algumas espécies (por exemplo, passerines) pintos são demasiado pequena para aplicar bandas de perna e requerem métodos alternativos, quenão alteram o comportamento de pais e filhos. Enquanto a consciência e interesse em melhorar o bem-estar e técnicas em estudos de campo e de laboratório animais está crescendo, o uso de técnicas não-invasivas é fortemente encorajado e preferencial.

Este protocolo fornece um método não-invasivo, rápido e facilmente reconhecível e persistente para marcar individualmente muito jovens filhotes antes de aplicar bandas de perna é viável. Este método de marcação é introduzido em uma das espécies de aves modelo de laboratório mais importantes, a Zebra Finch (Taeniopygia guttata) 11-13. O protocolo em conformidade com todos os objectivos previamente publicados para as técnicas de marcação individuais 10 e já foi aplicada com êxito 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os procedimentos foram realizados em conformidade com a lei alemã para a protecção dos animais (TierSchG).

1. Preparação de reagentes e consumíveis

  1. Prepare a 5% (w / w) de Chelex-100 em solução de água de grau molecular. Preparar alíquotas de 200 ul em tubos de reacção de 1,5 ml de padrão. Como a resina Chelex precipita rapidamente a partir da suspensão, é necessário re-homogeneizar a suspensão constante durante a preparação das aliquotas. É aconselhável preparar 50 ml ou mais de uma só vez e manter a suspensão homogeneizada usando um agitador magnético. A solução de Chelex pode ser armazenado durante anos em condições ambientais.
  2. Cortar pedaços de papel Whatman com uma largura menor do que a largura do bico de pássaros a serem testados. O comprimento do papel depende do método de levar a amostra:
    1. Utilizando uma pinça, a peça deve ser suficientemente longo para permitir a coleta de amostras sem a pinça sendo inseridos no bico da ave. Comoestimativa aproximada, para um comprimento de 0,5 cm bico um pedaço de papel com o comprimento de 1 cm deve ser fino.
    2. Se não, utilizando um fórceps, a peça deve ser maior, mas a rigidez da peça deve ainda permitir que a amostragem de células epiteliais.
  3. Prepare uma alíquota da PCR pré-mistura para cada amostra a ser analisada. Para a técnica de PCR num volume total de 25 ul da mistura de dNTPs 0,18 mM contém, 2 mM de MgCl 2, 70 mM Tris-HCl, sulfato de amónio 17,25 mM, 0,1% de Tween-20, 0,32 uM de iniciadores P2 (TCTGCATCGCTAAATCCTTT), P8 0,32 fiM iniciador com polimerase (CTCCCAAGGATGAGRAAYTG) 16 e 2 unidades de Taq. Caseiro Taq polimerase 17 pode ser usado. Para permitir a adição da quantidade máxima de solução de ADN, uma pré-mistura de 6 uL pode ser preparada e armazenada a -20 ° C durante várias semanas.

2. Coleta de Amostras

O uso de luvas não é essencial para a determinação do sexo das aves como os iniciadores de PCR não pode hibridar com o ADN humano. Paraoutros fins de genotipagem pode ser aconselhável.

  1. Capture a ave de interesse e gentilmente segure-o numa mão, por exemplo, com o "aperto de campainha '18. Certifique-se de não apertar o pássaro.
  2. Segure um pedaço de papel Whatman com uma pinça e passe-o várias vezes em toda a parte interna das bochechas, da língua e da coana. Normalmente as amostras são obtidas em menos de 30 segundos.
    1. Animais adultos: dependendo da espécie, pode ser difícil conseguir o pássaro para abrir seu bico. Normalmente tocar no lado do bico e aplicando uma ligeira pressão vai trabalhar.
    2. Filhotes: Amostragem de filhotes ou filhotes é especialmente fácil, utilizando esta técnica, como o seu comportamento implorando proporciona fácil acesso ao interior do bico. Pode até ser possível obter a amostra sem manuseá-los em tudo, como eles prontamente implorar por exemplo, quando seu ninho é aberto.
  3. Imediatamente armazenar o papel em uma preparados contai tubo de reaçãoning 200 ul de 5% (w / w) de Chelex-100 da solução.

Se você também pretende / precisa marcar os filhotes, faça-o agora, como descrito na seção 6.

3. Armazenamento de Amostras Antes de DNA Extraction

  1. Se trabalham no laboratório, amostras armazenar a -20 ° C. Se isso não for possível ou difícil (por exemplo, no campo) armazenar as amostras à temperatura ambiente.
  2. As amostras podem ser armazenadas durante mais de três anos, a temperaturas variando desde a temperatura ambiente até -20 ° C.

4. Extração de DNA

  1. Se a amostra for congelado, descongele-o em temperatura ambiente.
  2. Certifique-se de que a folha de papel é no fundo do tubo mergulhado na solução de Chelex-100.
  3. Incubar as amostras durante 15 min a 56 ° C.
  4. Brevemente Vortex e girar o conteúdo do tubo.
  5. Incubar as amostras durante 8 minutos a 100 ° C.
  6. Gire as amostras a 15.000 xg por 3 min.
  7. Use as supernatant para genotipagem subseqüente.

5. Molecular Determinação do Sexo

  1. Prepare um tubo PCR com 6 premix mL por amostra, mais dois tubos adicionais para o negativo (obrigatório) e controle positivo (opcional). Para a determinação do sexo de rotina incluem uma amostra a partir da última sexagem sucesso como um controlo positivo.
  2. Adicionar 19 mL do sobrenadante a partir da extracção de ADN para a pré-mistura de PCR. Certifique-se de pipeta da superfície da solução para evitar a transição de contas Chelex. Isto é crucial, como Chelex é um permutador de catiões e, assim, inibe severamente todas as reacções enzimáticas.
  3. Executar o seguinte programa de PCR: A incubação a 94 ° C durante 3 min, 45 ciclos cada um com um passo de fusão de 30 seg 94 ° C, seguido por um passo de emparelhamento de 30 segundos a 55 ° C, seguido por um passo de alongamento de 45 segundos a 72 ° C. Em uma etapa final perseguição fora, as reacções são incubadas durante 5 min a 72 ° C.
  4. Prepare uma TBE padrão de 2% ou TAE agaro si em gel para separar os produtos de PCR.
  5. Execute o gel de agarose com configurações adequadas de tensão.
  6. Visualize as bandas sob luz UV e tirar uma foto. Certifique-se que as duas bandas nas amostras provenientes de fêmeas são bem separados.
  7. Distinguir masculino a partir de amostras do sexo feminino pela presença de um dois (feminino) bandas (masculino) ou.

6. Marcação Filhotes

  1. Verifique ninhos para pintos recém-nascidos em um apropriado cronograma para a espécie / estudo (por exemplo, verificações diárias no período da manhã são aconselhados como a maioria dos filhotes nascem em seguida).
  2. Corte as penas para baixo de cada garota dentro de um ninho em um local característica diferente. Em tentilhões-zebra tufos de penas crescer em quatro áreas característicos e distintos em todo o corpo (Figura 4A) do filhote. Para cada pinto cortar uma área (Figura 4B). Se houver mais de quatro filhotes dentro de um ninho, os quatro 'haircuts' exclusivos podem ser combinados.
ove_content "> Para tentilhões-zebra: Aplicar anilhas em dez dias após a eclosão, quando estabelece penas tornam-se difíceis de detectar e tamanho filhote permite tocar.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Cotonetes bucais podem ser usadas para obter DNA para a determinação do sexo em uma variedade de aves pequenas

Foram coletadas amostras de Passarinhos da zebra (Taeniopygia guttata, 99 indivíduos, idade 0 dias - 5 anos), Canárias (Serinus canaria), Bengalese Passarinhos (Lonchura striata), rouxinóis (Luscinia megarhynchos), Great Tits (Parus major) e melros (Turdus merula) (para todas as outras espécies: tamanho da amostra 1-3, desconhecidas idade) (Figura 1).

Para amostras colhidas dos Passarinhos da zebra, a taxa de sucesso para os PCRs foi de 100%. O resultado PCR sempre combinava com o sexo determinado pela anterior (em adultos) ou mais tarde (em filhotes) Inspecção fenotípica. A intensidade das bandas não diferiram entre sistematicamente filhotes ou adultos indicando que quantidades semelhantes de material de suporte de DNA são obtidos a partir de todas as idades.

Figura 1 "fo: Content-width =" 6 pol "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figura 1. Molecular sexagem. Exemplos de resultados de sexagem de zaragatoas bucais obtidos a partir de várias espécies de aves. 2% de gel de agarose corado com brometo de etídio. Da esquerda para a direita: marcador de tamanho, Zebra Finch masculino, Bengalese Finch feminino, masculino Blackbird, Chapim-real macho, macho Nightingale, Canary masculino, controle da água, marcador de tamanho.

É importante evitar a passagem de contaminação Chelex nos PCRs

Para demonstrar o efeito de contaminação de resina Chelex numa reacção de PCR, que inclui uma pequena quantidade de pérolas de Chelex numa reacção de PCR (Figura 2). Como pode ser visto na Figura 2A, a contaminação residual dos grânulos Chelex impede a amplificação de ADN que é ainda ilustrada pela ausência de formação de dímero de primer na amostra contaminada (<strong> Figura 2B). Na Figura 2A pista 2 foi utilizada a mesma amostra para a PCR, sem levar mais de Chelex. Normalmente amostras contaminadas são facilmente reconhecíveis por manchas escuras nos bolsos do gel de agarose (Figura 2B).

Figura 2
Contaminação Figura 2. Chelex. A) Chelex transição para a reacção de PCR inibe a amplificação de ADN. Da esquerda para a direita:. Marcador de tamanho, Zebra Finch masculino, Zebra Finch feminino, mesma amostra com extravasamento intencional de Chelex, controle da água, marcador de tamanho B) contas Chelex são facilmente visíveis como manchas escuras no bolso do gel (esquerda sem Chelex , bem com Chelex. A inibição grave da reacção de PCR, na presença de Chelex é também ilustrada pelo iniciador ausente dformação imer na amostra contaminada.

As amostras podem ser armazenadas à temperatura ambiente antes da extracção do ADN de mais de três anos

A fim de investigar se a extracção ainda bem sucedido pode ser realizada após um longo armazenamento, as amostras foram colhidas repetidamente a partir da mesma ave e armazenados no laboratório, à temperatura ambiente para maximamente três anos. As amostras foram armazenadas perto de uma janela com a exposição natural a luz e ao calor do sol. Após três anos de ADN foi extraído e o PCR realizado sexagem. O resultado correspondeu a realizada três anos antes (logo após a amostragem) e não indicam qualquer efeito do armazenamento (Figura 3).

Figura 3
Figura 3. Chelex permite o armazenamento a longo prazo de amostras befoe depois re-extracção do ADN. Amostras de dois animais do sexo masculino (esquerda, direita fêmea) foram armazenadas em condições diferentes como indicado na tabela. Os sinais foram obtidas com sucesso a partir de todas as amostras.

Figura 4
Figura 4. Marcação de pintos. A) Representação esquemática e nomenclatura das quatro áreas distintas de crescimento de penas em filhotes de tentilhões zebra:. A = cabeça, B = costas, C = asas (ambos), D = flancos (os dois) B) Exemplo de imagens de filhotes que quer recebeu um dos respectivos 'haircuts' (AD) ou não "corte de cabelo" (E).

O DNA extraído pode ser armazenada por mais de três anos, a 4 ° C

Amostras passarinho Zebra do primeiro experimento foram armazenados por três anos em uma sex padrão de laboratóriodge a 4 ° C e testadas novamente com sucesso. Todas as amostras revelaram os mesmos resultados de PCR directamente como após a extracção de DNA (Figura 3).

Os filhotes podem ser marcadas por aparar as penas para baixo para permitir o reconhecimento individual de incubação em

Marcação filhotes individuais logo após a eclosão, cortando suas penas para baixo fez facilmente reconhecível (Figuras 4, 5, 6). Abaixo penas têm uma aparência macia como as farpas não estão ligados em conjunto para formar um cata-lisa. Eles ainda podem ser reconhecidos no dia 10 pós-nascimento nas pontas das penas em desenvolvimento, que até então cobrem o corpo (Figura 5). Sua ausência em locais distintos faz reconhecimento fácil, às vezes mesmo sem manipular os filhotes (Figura 6). Aplicando estes chamados `margens 'é uma técnica elegante, que preenche a lacuna com sucesso para o tempo de incubação até que o tamanho do corpo de aninhada Finc zebrahes torna a aplicação de bandas de perna viável.

Figura 5
Figura 5. Marcado filhotes Zebra Finch em dia pós escotilha 10. Imagens mostram filhotes ou com (tesoura) ou sem (seta) marcações. Uma seta aponta para o local de interesse de acordo com a respectiva nomenclatura de 'haircuts' penas para baixo: A = B = cabeça, costas, C = D = asas, flancos.

Figura 6
Figura 6. Reconhecimento dos filhotes marcados (média de idade = 10 dias) dentro do ninho natal de acordo com a nomenclatura.A = cabeça, fácil de identificar devido às suas proeminentes estabelece penas, que só estão faltando na cabeça. B = costas, para baixo penas visível em todos os locais, mas nas costas. C = asas, precisa de um observador atento que ambas as asas estão desaparecidos para baixo penas, mas a postura do filhote faz com que as penas para baixo da cabeça cobrir a ala direita. D = flancos, só pode ser reconhecida pelo processo de eliminação de seus flancos não pode ser visto. Ele pode ser reconhecido de forma confiável como D, pois mostra claramente o crescimento de penas na cabeça, as costas e as asas. = E uma combinação de cabeça 'haircuts' (A) e para trás (B), é fácil distinguir como para baixo penas em a cabeça e as costas estão faltando. F = a combinação de A 'haircuts' (cabeça) e D (flancos), que só podem ser diferenciadas através da eliminação de outras opções como o seu cabeça de marcação é óbvio e nenhum outro filhote não identificado apresenta uma cabeça de marcação. L = nãoreceber quaisquer marcas e é muito menor do que seus irmãos, uma vez que foi a última a eclodir. Além disso G é um bom exemplo para um filhote que não expressa para baixo penas em todos os locais.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sexagem de zaragatoas bucais utilizando Chelex mostrou um alto índice de sucesso. Para baixo penas de corte do hatchling permitiu a diferenciação entre filhotes até que a perna bandas era possível.

Extração Chelex-DNA a partir de zaragatoas bucais rendeu DNA suficiente para realizar com êxito a sexagem molecular. A determinação do sexo foi de 100% correta, conforme validado pela plumagem dimorfismo sexual. A taxa de sucesso relatado aqui é significativamente maior do que a taxa relatada por dois estudos anteriores 7,9. A extração do DNA com Chelex minimiza passos de pipetagem e precipitação em que o material pode ser perdida. No entanto, um dos estudos de validação de nosso protocolo de uma espécie diferente (Apus apus) ainda alcançado uma menor taxa de sucesso de 89% 9, embora este já era significativamente maior do que os 82% registrados em Arima et al. 7.

O que poderia ser a causa? A parte mais importante é seguir atentamente o protocol, incluindo a parte de como tirar amostras (tecido suavemente furto várias vezes na boca) e para evitar que o reporte das contas Chelex na reação de PCR. Como Chelex é um permutador de catiões, inibe severamente a reacção de PCR, impedindo a amplificação em amostras contaminadas. Amostras contaminadas podem ser facilmente reconhecidos por esferas visíveis nos bolsos de gel de agarose e da falta de dímeros de primers.

Menos razões prováveis ​​para a falta de sucesso amostras sexuais também pode ser devido a diferenças entre as espécies ou a utilização de uma tecnologia diferente para detectar a diferença de banda nas amostras de mulheres.

Cortar as penas para baixo de tentilhões-zebra hatchling é uma forma segura para marcar individualmente assuntos. Estes 'haircuts' eram fáceis de reconhecer até filhotes tinham idade suficiente para receber anilhas numeradas (por exemplo, no dia 10 de tentilhões-zebra). Esta técnica de marcação pode ser facilmente ajustado para satisfazer Experim diferentedemandas ental; por exemplo, para as gravações de vídeo marcações podem ser limitados ao cabeça de pintos. Combinações de cortes em duas posições podem ser aplicadas se ninhos são maiores do que cinco filhotes. Mantendo uma seqüência predefinida na aplicação 'haircuts' (por exemplo, o primeiro hatchling em um ninho sempre recebe 'corte de cabelo A', o segundo sempre recebe 'haircut B', etc) permite o reconhecimento rápido dentro da ordem incubação durante a fase de filhote. Isso permite a identificação rápida, o que pode reduzir ou até mesmo evitar a manipulação dos pintos. Em tentilhões-zebra, a falta de penas em um dos quatro locais podem ocorrer devido a flutuações naturais. Assim, pode não ser sempre possível se ater a uma seqüência de marcação pré-definida.

Mesmo para alguém inexperiente em lidar com filhotes é uma forma rápida de aprender, técnica de marcação segura e fácil de cortar as penas para baixo. No entanto, como a resposta escancarado inato de filhotes inclui movimentos de cabeça, algumas pessoas acham que é mais difícil colocar marreis na cabeça. Erro identificação propenso conta com marcações precisas. É de importância primordial para cortar completamente o todo para baixo penas em um determinado local, como marcas imperfeitos / única esquerda de saída para baixo penas podem confundir mais tarde identidade.

Este conjunto de métodos permite extremamente rápido, fácil, não-invasivo, confiável e de baixo custo, a determinação do sexo de aves e sua não-invasivo, rápido, seguro e facilmente reconhecível marcação dentro de minutos após a eclosão.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgements

Muito obrigado a Silke Kipper, Sarah Kiefer, Michael Weiss, Conny Bartsch e Silke Voigt-Heucke para coleta de amostras entusiasmado no campo, para Janett Birkenfeld de assistência continuada, para Ulla Kobalz para as belas géis e Tobias Krause para dar apoio moral.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics