Qui est qui? Méthodes non-invasives pour Individuellement sexe et Mark nidicoles poussins

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ce protocole fournit un ensemble pratique de méthodes, ce qui permet extrêmement rapide, facile, non invasif, fiable et à faible coût, la détermination du sexe moléculaire des oiseaux et de leur non-invasive, rapide, sécurisé et facilement reconnaissable marquage peu après l'éclosion. Seulement manipulation limitée des poussins est nécessaire. Cette boîte à outils pratique de méthodes est conforme entièrement aux RRR-directives.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De nombreuses expériences nécessitent détermination précoce du sexe de la progéniture ainsi que tôt le marquage des nouveau-nés pour la reconnaissance individuelle. Selon les directives de protection des animaux, les techniques non invasives devraient être privilégiées cas échéant. Dans notre groupe, nous travaillons sur différentes espèces d'oiseaux chanteurs dans le laboratoire et sur le terrain, et nous appliquons avec succès des méthodes non invasives pour le sexe et individuellement marquons poussins. Cet article présente une boîte à outil non invasif complet. Sexage des oiseaux avant l'expression de caractères sexuels secondaires nécessite la collecte de matériel ADN portant pour la PCR. Nous avons établi une méthode rapide et facile pour les oiseaux de tout âge (post-éclosion) de sexe par extraction d'ADN à partir d'un frottis buccal. Les résultats peuvent être obtenus dans les 3 heures. Pour les duvet de marquage individuel chiches sont garnis de motifs spécifiques permettant l'identification rapide dans l'ordre d'éclosion. Cet ensemble de méthodes est facilement applicable dans un laboratoire standard équipée et particulièrement adapté pour Working dans le domaine comme aucun équipement spécial n'est requis pour l'échantillonnage et le stockage. Manipulation des poussins est minimisée et le marquage et la détermination du sexe techniques sont non-invasive soutenant ainsi le RRR-principe de directives de protection des animaux.

Introduction

Reconnaissance individuelle, sexage et le génotypage sont des préalables fondamentaux à une série d'études expérimentales. Obtenir du matériel d'appui de l'ADN et le marquage des sujets clairement (même à un âge précoce) devrait avoir un impact minimal sur la physiologie, le comportement et la survie. Chaque fois que possible, des procédures invasives doivent être évitées selon le principe de RRR 1.

Les méthodes non-invasives ne sont pas seulement bénéfique pour l'animal, mais aussi peut améliorer les données obtenues car les animaux sont moins affectés par les traitements.

Chez les oiseaux, l'ADN sexage peut être effectuée sur un certain nombre de matériaux obtenus de façon non invasive les fientes, les plumes 2 3,4 ou frottis buccal 3,5,9. Indépendamment de la condition et de l'âge des écouvillons buccaux de question sont la méthode de choix pour le sexage aviaire, car ils sont faciles à réaliser, peu sûr et la manipulation est courte.

Jusqu'à présent, l'ADN de prélèvements buccauxa été extrait avec de l'une ou l'autre des kits disponibles dans le commerce ou 3,6 chronophages protocoles d'extraction d'ADN standards 3,6-8. Les kits sont non seulement assez cher, mais leurs protocoles peuvent imposer des défis pour le travail de terrain. Certains détails de la procédure, par exemple, le séchage et l'incubation des échantillons, ne sont pas pratiques dans le domaine. Surtout dans un contexte où les protocoles expérimentaux nécessitent un traitement dépendant du sexe à partir dès que quelques minutes après l'éclosion, il est instamment pour une méthode rapide, non invasive, fiable et facile d'obtenir des résultats.

Dans l'ensemble du taxons aviaire une boîte à outils considérable pour les personnes de marquage a été développé 10. Le large éventail des techniques disponibles représente la variété des objectifs de la recherche, des espèces et des budgets. Toutefois, le marquage des petits oisillons a été confrontée à des chercheurs avec des défis supplémentaires. Chez certaines espèces (par exemple les passereaux) poussins sont trop petits pour appliquer des bandes de jambe et nécessitent des méthodes alternatives, quine modifie pas le comportement des parents-enfants. La prise de conscience et l'intérêt dans l'amélioration du bien-être et les techniques dans des études de terrain et de laboratoire animal est de plus en plus, l'utilisation de techniques non invasives est fortement encouragée et préférée.

Ce protocole fournit une méthode non-invasive, rapide, facilement reconnaissable et persistant pour marquer individuellement les très jeunes oisillons avant d'appliquer des bandes de jambe est possible. Cette méthode de marquage est introduit sur ​​l'une des espèces les plus importantes du modèle de laboratoire aviaire, le Finch Zebra (Taeniopygia de guttata) 11-13. Le protocole est conforme à tous les objectifs précédemment publiés pour les techniques de marquage individuels 10 et a déjà été appliquée avec succès 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les procédures ont été effectuées en conformité avec la loi allemande pour la protection des animaux (TierSchG).

1. Préparation des réactifs et consommables

  1. Préparer une 5% (p / p) de Chelex-100 solution dans l'eau de qualité moléculaire. Préparer des aliquotes de 200 pl dans des tubes de réaction de 1,5 ml standard. Comme la résine Chelex précipite rapidement à partir de la suspension, il est nécessaire de ré-homogénéiser la suspension constamment au cours de la préparation des fractions aliquotes. Il est conseillé de préparer 50 ml ou plus en un seul lot et maintenir la suspension homogénéisée à l'aide d'un agitateur magnétique. La solution Chelex peut être stocké pendant des années dans les conditions ambiantes.
  2. Couper des morceaux de papier Whatman avec une largeur inférieure à la largeur du bec de l'oiseau à tester. La longueur du papier dépend de la méthode de prélever l'échantillon:
    1. En utilisant des pinces, la pièce doit être suffisamment longue pour permettre le prélèvement de l'échantillon sans la pince étant insérée dans le bec de l'oiseau. En tant queestimation approximative, pour une longueur de bec de 0,5 cm un morceau de papier avec la longueur de 1 cm doit être fine.
    2. Si ce n'est pas l'aide de pinces, la pièce doit être plus long, mais la rigidité de la pièce doit toujours permettre l'échantillonnage des cellules épithéliales.
  3. Préparer une aliquote de prémélange de PCR pour chaque échantillon à analyser. Pour une PCR dans un volume total de 25 ul du mélange contient mM dNTP à 0,18, 2 mM de MgCl2, 70 mM Tris-HCl, le sulfate d'ammonium 17,25 mM, 0,1% de Tween-20, 0,32 uM amorce P2 (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 amorce (CTCCCAAGGATGAGRAAYTG) 16 et 2 unités de Taq polymérase. Maison Taq polymerase 17 peut être utilisé. Afin de permettre l'addition de la quantité maximale d'ADN-solution, un pré-mélange de 6 pi peut être préparé et conservé à -20 ° C pendant plusieurs semaines.

2. Prélèvement des échantillons

Le port de gants n'est pas essentielle pour la détermination du sexe aviaire que les amorces de PCR peuvent pas s'hybrider avec l'ADN humain. Pourd'autres fins de génotypage, il pourrait être souhaitable.

  1. Capturer l'oiseau d'intérêt et tenir doucement dans un exemple de pair avec la «prise de sonnerie» 18. Assurez-vous de ne pas presser l'oiseau.
  2. Placez une feuille de papier Whatman avec une pince et la glisser à plusieurs reprises dans l'intérieur des joues, la langue et la choane. Habituellement, les échantillons sont obtenus en moins de 30 secondes.
    1. Les animaux adultes: selon les espèces, il pourrait être difficile d'obtenir l'oiseau d'ouvrir son bec. Habituellement toucher le côté du bec et appliquant une légère pression va fonctionner.
    2. Les oisillons: échantillonnage de nouveau-nés ou des oisillons est particulièrement facile en utilisant cette technique, que leur comportement mendicité offre un accès facile à l'intérieur du bec. Il pourrait même être possible d'obtenir l'échantillon sans les manipuler à tous, comme ils mendient facilement par exemple lorsque leur nichoir est ouvert.
  3. Stocker immédiatement le papier dans un préparés contai tube de réactionning 200 ul de 5% (p / p) Chelex-100 solution.

Si vous avez l'intention aussi / besoin de marquer les poussins, faites-le maintenant comme décrit dans la section 6.

3. Stockage des échantillons avant l'extraction de l'ADN

  1. Si travaillant dans le laboratoire, les échantillons à -20 ° C. Si ce n'est pas possible de stocker des échantillons ou difficile (par exemple dans le domaine) à température ambiante.
  2. Les échantillons peuvent être conservés pendant plus de 3 ans à des températures allant de la température ambiante à -20 ° C.

4. DNA Extraction

  1. Si l'échantillon est congelé, le décongeler à la température ambiante.
  2. Assurez-vous que le morceau de papier est présent dans le fond du tube immergé dans la solution Chelex-100.
  3. Incuber les échantillons pendant 15 min à 56 ° C.
  4. brièvement Vortex et centrifuger le contenu du tube.
  5. Incuber les échantillons à 8 min à 100 ° C.
  6. Faites tourner les échantillons à 15 000 g pendant 3 min.
  7. Utilisez les supernatant pour le génotypage ultérieur.

5. Moléculaire Détermination du sexe

  1. Préparer un tube PCR avec 6 pi prémélange par échantillon plus deux tubes supplémentaires pour le négatif (obligatoire) et contrôle positif (en option). Pour la détermination du sexe de routine inclure un échantillon de la dernière sexage réussie en tant que contrôle positif.
  2. Ajouter 19 ul de surnageant provenant de l'extraction de l'ADN de la pré-mélange PCR. Assurez-vous de la pipette de la surface de la solution pour éviter le report des perles Chelex. Ceci est crucial, comme Chelex est un échangeur de cations et par conséquent inhibe fortement les réactions enzymatiques.
  3. Exécuter le programme de PCR suivant: incubation à 94 ° C pendant 3 min, 45 cycles chacune avec une fusion de l'étape 30 sec 94 ° C, suivie d'une étape de recuit de 30 secondes à 55 ° C, suivie d'une étape d'élongation de 45 secondes à 72 ° C. Dans une étape finale chasser, les réactions sont incubées pendant 5 min à 72 ° C.
  4. Préparer un TBE standard de 2% ou TAE agaro soi gel pour séparer les produits de PCR.
  5. Exécuter le gel d'agarose avec des réglages de tension appropriées.
  6. Visualiser les bandes sous lumière UV et prendre une photo. Assurez-vous que les deux bandes dans les échantillons provenant de femmes sont bien séparés.
  7. Distinguer mâle à partir d'échantillons de femmes par la présence d'un deux bandes (femelle) (mâle) ou.

6. Marquage oisillons

  1. Vérifiez nids pour les poussins nouvellement éclos sur une appropriée de calendrier pour l'espèce / étude (par exemple, les contrôles quotidiens le matin est conseillé que la plupart des poussins éclosent alors).
  2. Couper le duvet de chaque poussin dans un nid à un endroit caractéristique différente. Dans les diamants mandarins touffes de bas poussent à quatre zones caractéristiques et distinctes de l'organisme (figure 4A) de l'oisillon. Pour chaque poussin couper une zone (figure 4B). Si il ya plus de quatre poussins dans un nid, les quatre «décotes» uniques peuvent être combinés.
ove_content "> Pour les diamants mandarins: Appliquer des bandes de jambe à une dizaine de jours après l'éclosion quand duvet deviennent difficiles à détecter et la taille des oisillons permet de sonner.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Prélèvements dans la bouche peuvent être utilisées pour obtenir de l'ADN pour la détermination du sexe dans une variété de petits oiseaux

Les échantillons ont été prélevés diamants mandarins (Taeniopygia guttata, 99 personnes, âge 0 jours - 5 ans), Canaries (Serinus canaria), bengalis Pinsons (Lonchura striata), des rossignols (Luscinia megarhynchos), Mésanges (Parus major) et merles (Turdus merula) (pour toutes les autres espèces: taille de l'échantillon 1-3, âge inconnu) (figure 1).

Pour les échantillons prélevés diamants mandarins, le taux de réussite pour les PCR était de 100%. Le résultat PCR toujours de pair avec le sexe, déterminée par la technique (chez les adultes) ou plus tard (dans oisillons) inspection phénotypique. L'intensité des bandes ne diffère pas systématiquement entre les oisillons ou adultes indiquant que des quantités similaires de matériau ADN portant sont obtenus à partir de tous les âges.

Figure 1 "fo: contenu width =" 6 po "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figure 1. Moléculaire sexage. Exemples de résultats de sexage de prélèvements buccaux provenant de diverses espèces aviaires. Gel d'agarose à 2% coloré au bromure d'éthidium. De gauche à droite: marqueur de taille, Zebra Finch mâle, femelle Bengale Finch, Blackbird mâle, Grande mâle Mésange, Nightingale mâle, Canary mâle, maîtrise de l'eau, marqueur de taille.

Il est important de prévenir la contamination de report Chelex dans les RAP

Pour démontrer l'effet de la contamination de la résine Chelex dans une réaction de PCR, nous avons inclus une petite quantité de perles Chelex dans une réaction de PCR (Figure 2). Comme on peut le voir sur la figure 2A, la contamination report de billes Chelex empêche l'amplification de l'ADN, qui est illustrée en outre par l'absence de l'amorce la formation du dimère dans l'échantillon contaminé (<strong> Figure 2B). Dans la figure 2A voie 2, nous avons utilisé le même échantillon pour la PCR sans retenue Chelex. Habituellement échantillons contaminés sont facilement reconnaissables par les taches sombres dans les poches de gel d'agarose (figure 2B).

Figure 2
Figure 2. Contamination Chelex. A) Chelex report dans la réaction de PCR inhibe l'amplification de l'ADN. De gauche à droite:. Marqueur de taille, Zebra Finch mâle, Zebra Finch femme, même de l'échantillon avec report intentionnel de Chelex, maîtrise de l'eau, marqueur de taille B) perles Chelex sont facilement visible que la coloration sombre dans la poche de gel (à gauche sans Chelex , à droite avec Chelex. L'inhibition sévère de la réaction PCR en présence de Chelex est également illustrée par l'amorce manquant dformation imer dans l'échantillon contaminé.

Les échantillons peuvent être conservés à la température ambiante avant l'extraction de l'ADN de plus de trois ans

Afin de déterminer si l'extraction réussie peut encore être effectuée après un long stockage, les échantillons ont été prélevés à plusieurs reprises de la même volaille et stockées dans le laboratoire à des températures ambiantes pendant au maximum trois ans. Les échantillons ont été stockés à proximité d'une fenêtre à une exposition naturelle à la lumière et à la chaleur du soleil. Après trois ans ADN a été extrait et le PCR sexage effectué. Le résultat correspondait à la une réalisée trois ans plus tôt (à droite après le prélèvement) et n'a pas montré d'effet de stockage (Figure 3).

Figure 3
Figure 3. Chelex permet le stockage à long terme des échantillons before et après extraction d'ADN. échantillons de deux animaux (mâle gauche, droit des femmes) ont été stockés dans des conditions différentes, comme indiqué dans le tableau. Les signaux ont été obtenus avec succès à partir de tous les échantillons.

Figure 4
Figure 4. Marquage des poussins. A) Représentation schématique et la nomenclature des quatre zones distinctes de croissance des plumes dans zèbre oisillons de pinson:. A = tête, B = back, C = ailes (deux), D = flancs (à la fois) B) Exemple de photos de oisillons qui soit reçu l'un des «décotes» respectives (AD) ou non "coupe de cheveux" (E).

ADN extrait peut être stocké pendant plus de trois ans à 4 ° C

Échantillons Zebra Finch de la première expérience ont été stockés pendant trois ans dans un fri standard de laboratoiredge à 4 ° C et avec succès un nouveau test. Tous les échantillons ont donné les mêmes résultats de la PCR en tant que directement après l'extraction de l'ADN (figure 3).

Les nouveau-nés peuvent être marqués par le parage leurs duvet pour permettre la reconnaissance individuelle de l'éclosion sur

Marquage oisillons individuelles juste après l'éclosion en coupant leurs duvet rendait facilement reconnaissable (figures 4, 5, 6). Duvet ont un aspect pelucheux que leurs barbes ne sont pas réunies pour former une palette lisse. Ils peuvent encore être comptabilisés à jour après l'éclosion 10 sur les extrémités des plumes en développement, qui alors couvrent le corps (figure 5). Leur absence à des endroits distincts permet une reconnaissance facile, parfois même sans avoir à manipuler les oisillons (figure 6). L'application de ces soi-disant `coupes de cheveux" est une technique élégante, qui remplit avec succès l'écart pour le moment de l'éclosion jusqu'à ce que la taille du corps de niché finc zébréeshes rend l'application de bandes de jambe possible.

Figure 5
Figure 5. Marqué Zebra Finch oisillons à jour post trappe 10. Photos montrent oisillons soit avec (ciseaux) ou sans (flèche) marques. Une flèche indique l'emplacement d'intérêt selon la nomenclature respective de «décotes» duvet: A = B = la tête, le dos, les ailes, C = D = flancs.

Figure 6
Figure 6. Reconnaissance des oisillons marqués (âge moyen = 10 jours) dans le nid natal selon la nomenclature.A = tête, faciles à repérer en raison de ses duvet de premier plan, qui ne manquent sur ​​la tête. B = dos, duvet visible sur tous les sites, mais sur le dos. C = ailes, a besoin d'un observateur attentif comme les deux ailes sont absents duvet, la posture mais niché fait le duvet de la tête couvrent l'aile droite. D = flancs, ne peuvent être reconnus par le processus d'élimination que ses flancs ne sont pas visibles. Il peut être fiable reconnu comme D car il montre une nette croissance en baisse de plume à la tête, le dos et ses ailes. E = une combinaison de la tête "coupes de cheveux (A) et arrière (B), est facile à distinguer que le duvet sur la tête et le dos sont absents. F = une combinaison de 'A' coupes de cheveux (de la tête) et D (flancs), qui ne peut être différencié en éliminant d'autres options comme la tête de marquage est évidente et aucune autre oisillon non identifié présente une tête de marquage. G = ont pasrecevoir des marques et est beaucoup plus petit que ses frères et sœurs comme ce fut le dernier à éclore. En outre G est un bon exemple pour un oisillon qui n'exprime pas le duvet sur tous les sites.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sexage de frottis buccal à l'aide de Chelex ont montré un taux de réussite très élevé. Les duvet de nouveau-nés de coupe ont permis la différenciation entre les oisillons jusqu'à ce que la jambe bandes était possible.

Extraction Chelex-ADN à partir d'un frottis buccal a donné suffisamment d'ADN pour réaliser avec succès le sexage moléculaire. La détermination du sexe était de 100% correctes, validé par le plumage dimorphisme sexuel. Le taux rapporté ici de réussite est nettement plus élevé que le taux rapporté par deux études précédentes 7,9. L'extraction de l'ADN avec Chelex minimise pipetage et de précipitation des étapes dans lesquelles la matière peut être perdu. Cependant, l'une des études de validation de notre protocole dans une espèce différente (Apus apus) encore atteint un plus bas taux de réussite de 89% 9 même si cela était déjà nettement plus élevé que les 82% rapporté à Arima et al. 7.

Quelle pourrait être la cause? La partie la plus cruciale est de suivre attentivement la protocol, y compris la partie de la façon de prélever des échantillons (tissu délicatement glisser plusieurs fois dans la bouche) et à empêcher report de perles Chelex dans la réaction de PCR. Comme Chelex est un échangeur de cations, il inhibe fortement la réaction de PCR empêchant l'amplification dans les échantillons contaminés. Les échantillons contaminés peuvent être facilement reconnus par des perles visibles dans les poches des gels d'agarose et de l'absence de dimères d'amorces.

Raisons moins probables pour défaut de succès échantillons de sexe peut aussi être due à des différences ou l'utilisation d'une technologie différente pour détecter la différence de bande dans les échantillons de femmes.

Couper le duvet de nouveau-nés diamants mandarins est un moyen sûr de marquer individuellement les sujets. Ces «coupes» étaient faciles à reconnaître que les oisillons étaient assez vieux pour recevoir des bagues numérotées (par exemple au jour 10 dans les diamants mandarins). Cette technique de marquage peut être facilement ajustée pour répondre aux différents expérimdemandes ent, par exemple pour les enregistrements vidéo des marques peuvent être limitées à la tête des poussins. Combinaisons de coupes à deux positions peuvent être appliquées si les nids sont plus grands que cinq oisillons. Garder une séquence prédéfinie dans l'application «décotes» (par exemple, le premier nouveau-nés dans un nid reçoit toujours décote A ', le second reçoit toujours décote B ", etc) permet la reconnaissance rapide au sein de l'ordre durant toute la phase d'éclosion des oisillons. Cela permet une identification rapide, ce qui peut réduire ou même prévenir la manipulation de poussins. Dans les diamants mandarins, le manque de bas à l'un des quatre emplacements peut se produire en raison des fluctuations naturelles. Ainsi, il n'est pas toujours possible de s'en tenir à une séquence de marquage prédéfini.

Même pour quelqu'un sans expérience dans le traitement des oisillons est une rapidement à apprendre, technique de marquage sûr et facile à couper le duvet. Cependant, comme la réponse innée béant des oisillons comprend mouvements de la tête, certaines personnes trouvent qu'il est plus difficile de placer des marrois sur la tête. Erreur d'identification sujettes s'appuie sur des marques précises. Il est d'une importance éminente de couper complètement l'ensemble du duvet à un endroit donné, comme des plumes marques imparfaites / unique gauche sur la baisse, peuvent plus tard confondre identité.

Cet ensemble de méthodes permettant extrêmement rapide, facile, non invasif, fiable et à faible coût, la détermination du sexe des oiseaux et de leur non-invasive, rapide, sécurisé et facilement reconnaissable marquage quelques minutes après l'éclosion.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à révéler.

Acknowledgements

Un grand merci à Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch et Silke Voigt-Heucke pour la collecte de l'échantillon enthousiaste dans le domaine, à Janett Birkenfeld d'une assistance continue, à Ulla Kobalz pour les beaux gels et Tobias Krause pour un soutien moral.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics