에 상처 응답에 대한 피부 상처에 대한 방법 및 분석 실험

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

C. elegans의 표피와 표피는 부상으로 인한 국부적 손상을 복구 할 수있는 간단하면서도 정교한 피부 층을 형성한다. 이 모델에 상처 응답 및 수리의 연구는 세포 골격과 조직 손상에 대한 게놈의 답변에 대한 우리의 이해를 조명했다. 두 개의 가장 일반적으로 사용되는 방법을 권취하기 C. 엘레 성인 피부는 미세 주사 바늘 및 지역의 레이저 조사와 거시기 있습니다. 로컬 부상 바늘은 표피, 표피 및 관련 세포 외 매트릭스를 방해하고, 또한 내부 조직에 손상을 줄 수 있습니다. 더 현지화 된 손상에 레이저 조사 결과. 상처는 상승 표피 칼슘 (초 분) 형성과 상처 사이트 (1-2 시간), 항균 펩타이드 유전자의 높은 전사에서 액틴 함유 링의 폐쇄를 포함하여 쉽게 분석 응답의 연속 (2-24 트리거 시간), 흉터 형성. 본질적으로 모든 야생형 성인 동물 여기서 상처 생존상처 수리 또는 다른 응답에 결함이있는 돌연변이로 생존을 감소 보여줍니다. 자세한 바늘과 레이저 상처에 대한 프로토콜 및 정량 상처 응답 및 복구 프로세스 (칼슘 역학, 굴지 역학, 항균 펩타이드 유도, 생존)의 시각화에 대한 분석은되게됩니다.

Introduction

피부 상처 치유 메카니즘은 기초 생물학이 관심있는 인간의 건강에 관련된. 척추 동물 및 포유 동물에서 상처 치유가 코디 응답 여러 조직 및 1 시그널링의 복잡한 시리즈를 포함한다. 많은 간단한 유전자 모델 생물은 피부 상처 (2)를 치유 할 수있다. 이는 피부 상처 복구 유전자 취급 용이 모델을 분석하는 것이 흥미 롭다. 우리와 다른 피부 상처에 대한 새로운 모델이 3,4 치유로 예쁜 꼬마 선충을 사용하기 시작했다. 이 프로토콜의 목적은 C.을 사용하는 연구자의 ​​광범위한 세트를 활성화하는 것 도구로 elegans의 표피 상처 치유의 분자 및 세포 메커니즘을 조사합니다.

C. 엘레 피부 (피하도라고도 함) 및 표피 세포 외 5 표피를 포함한다. 성인 표피가 가장 큰 k를 syncytium 인 multinucleate syncytia의 소수로부터 형성된다nown으로 hyp7. 표피는 선 단면에 표피를 분비 단순한 상피이다. 피부는 적극적으로 피부를 관통 병원균에 대한 방어 및 작은 상처 (4)를 복구 할 수 있습니다. C.의 상처 수리 엘레 피부 모두 야생형 동물 바늘, 또는 레이저 조사에 의한 로컬 피부 손상에 의한 작은 천공 상처 견딜 수 생존 거의 견고하다. C. 엘레 피부 상처는 표피 선천성 면역 반응, 상처 폐쇄 및 흉터 형성 (4)를 포함하여 응답의 제품군을 트리거합니다. 성인 표피 포스트 - 유사 분열하고, 상처 치유 표피 증식 또는 세포 이동과 반대로 지방 세포 반응을 포함한다. 우리는 피부에 상처가 막 TRPM 채널 GTL-2 및 내부 칼슘 저장 (3)을 필요로하는, 칼슘 2 + 표피에 큰 지속적인 증가를 유발 보여 주었다. 표피 칼슘 신호에서 F - 굴지 고리의 형성과 폐쇄 WO 필요싶게 사이트. 상처를 입는 또한 NLP-29 암페어의 전사를 활성화 선천성 면역 반응을 유도한다. 앰프의 상처에 의한 전사는 TIR-1 표피 4 자율적으로 행동 / PMK-1 P38의 MAP 키나제 캐스케이드에 따라 달라집니다. 중 칼슘 신호 전달 경로 또는 선천성 면역 반응의 결함은 낮은 생존 후 상처로 이어질 것입니다. C.의 비교적 간단한 구조 elegans의 표피, 생체 내 이미징을위한 유전의 취급 용이성 및 장점은 상처 수리의 여러 측면을 연구하기 위해 그것에게 우수한 시스템을 확인합니다.

바늘 상처 및 레이저 상처 : 여기에서 우리는 상처의 두 가지 일반적인 방법에 대한 프로토콜을 제시한다. 바늘 상처는 (바늘 풀러 제외)에는 전문 장비가 필요하지 않으며, 경험 하루에 벌레 수백 수행 할 수 있습니다. 바늘 상처는 한천 플레이트에 성장 동물에서 수행됩니다. 대조적으로, 레이저는 상처에 대해 수행된다 anesthetized 동물 커버 슬립 아래 패드 한천에 장착하고, 손상 세포 반응의 라이브 영상에 적합합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

다음 프로토콜은 C.에 대한 자세한 절차를 설명 엘레 피부 상처와 상처 응답을 분석합니다.

1. 바늘 상처 3,4

  1. 표준 NGM (선충 성장 매체) E.와 함께 접시에 건강한 unstarved 웜 성장 20 ° C 배양기에서 유지 음식으로 대장균 OP50 박테리아,.
    참고 : NGM 한천 플레이트와 C의 일상 재배하는 방법 엘레 www.wormbook.org (6)에서 확인할 수있다.
  2. 20 ° CO / N에서 부상과 문화 전에 갓 시드 플레이트 일일 25 L4 무대 웜을 선택합니다.
  3. 부상하기 전에 바늘 풀러를 사용하여 모세 혈관에서 바늘을 빼냅니다. 상처에 사용되는 바늘의 C. 마이크로 인젝션에 사용되는 것과 동일하다 엘레.
  4. 모든 벌레 젊은 성인 단계에 있는지 확인합니다. 약 30 분 동안 얼음에 벌레의 접시를 놓습니다. 냉각 동물 바늘 상처를 용이 부진 할됩니다.
  5. 해부 실체 현미경으로 얼음에서 한천 플레이트를 제거합니다. 웜 픽을 사용하여 한천 플레이트의 중심에 25 벌레를 이동합니다.
  6. 더 쉽게 바늘을 잡고 100 μL 피펫 팁에 바늘을 놓습니다. 생식선을 피하고, 바늘 웜 본체의 전방 또는 후방 부 천공. 일반적으로, 후방 및 전방 인두 생식선 사이 또는 후방 생식소와 항문 사이에 감겨 시도. 재사용 바늘 여러 번, 깨지까지.
    주 : 동물에 ~ 5 ~ 10 μm의 침투, 상처가 표피와 피부에 구멍을 간략하게, 부드러운 거시기 있는지 확인. 바늘 ANIM를 입력해야합니다피부 알 대략 직각. 상처는 내부 장기에 손상이 없는지, 또는 신체의 즉각적인 파열의 원인이 안됩니다. 세포질 상처 후 몇 초 스며 나오는 모습을 소량 관찰; 휴대 내용이 장시간에 걸쳐 누출 그러나 동물들은 살아남지 못할 것이다. 최적 영상화, 횡 표피 syncytium (hyp7) 또는 측면 솔기 상처.
    참고 :이 절차는 유리 바늘의 사용을 포함한다.
  7. 웜은 20 ° C에서 다음 실온에서 문화를 복구 할 수 있습니다. 아래에 설명 된 분석의 수에 의하여 바늘 상처의 성공을 판사. 야생형 동물의 95 % 이상은 바늘이 젊은 성인 단계에서 부상 후 24 시간 생존. 유충 세 이상 성인에서 부상의 효과는 아직 광범위하게 분석되지 않았습니다.

2. 레이저 상처 3

보다 정확한 상처를 수행 할 펨토초 레이저 조사 (800 나노 미터)를 사용합니다.

  1. 한천 페이지 준비용융 2 % 한천 7 유리 슬라이드에 광고. C. 패드의 라이브 영상을 위해 사용 한천 패드 비슷 확인 엘레.
  2. 웜 선택과 아가로 오스 패드에 10 젊은 성인 웜을 전송, 12 mM의 levamisole을 용액 2 μL 드롭을 추가합니다. 동물과 커버 슬립와 액체를 커버. 벌레가 마비 1-2 분을 기다립니다.
  3. 회전 디스크 공 초점 현미경 상으로 유리 슬라이드를 놓습니다. 벌레를 찾아 100X의 목적으로 측면 전방 또는 후방 세포 융합 표피 (NA 1.4-1.46)에 초점을 무대로 이동합니다.
  4. 140 메가 와트 펨토초 레이저의 파워를 설정 (목적 전에 측정). 80 MHz의 반복율로 펨토초 레이저를 사용한다.
    참고 : (20 밀리로 구분) 200 밀리 초 각의 두 펄스가 우리 손에 상처 충분합니다.
  5. 표피 세포의 꼭대기의 표면에 초점 표피 상처. 세포질 (버블)의 현지 중단, 또는 로컬 표백 O를 관찰사용 된 형광 마커 바.
    참고 : 펨토초 레이저를 사용하는 경우 적절한 레이저 안전 절차를 따르십시오. 이러한 두 광자 현미경에서와 펨토초 레이저를 사용하여 라인 또는 포인트 스캔 레이저 상처에 대한 충분한 전력을 제공해야한다.
    참고 : 우리는 다른 레이저를 사용하여 직접 경험을하지 않지만, 원칙 상처에 (C. 세포 절제 엘레 간스에서 사용) 기존의 UV 레이저를 사용하여 수 있어야한다. 선택적으로, 표피 (N. 푸욜, 개인 통신) 상처는 디스크 공 초점을 회전에 (FRAP) 모듈을 광표백 후 형광 복구를 사용합니다.

상처에 표피 칼슘 응답 3. 시각화

  1. 유전자 변형 C.를 사용하여 성인 상피 세포 특이 적 프로모터 COL-19 (그림 1A의 제어하에, 표피 (예 : GCaMP 시리즈의 것과 같은) 칼슘 센서를 표현 엘레 균주, 유전자는에 나열되어 있습니다 참고 : 우리는 표피 tdTomato 형광이 상대적으로 안정적으로 유전자 발현을위한 내부 통제로 tdTomato를 사용하고 GCaMP 영상을 방해하지 않습니다.
  2. 표피에 트리거 칼슘 상승 부상 바늘과 레이저 모두. 니들 상처 용이 스피닝 디스크 촛점을 수행 할 수 없습니다 그러나, 레이저 상처는 칼슘 응답 (도 1)의 정량 분석을하는 것이 바람직하다.
  3. 100X의 목적으로 회전 디스크 공 초점 (NA 1.4-1.46) 및 적절한 필터 세트를 사용하여 다차원 획득 모드 (간격 시간 114 밀리 초 여기 레이저 노출 2 초)의 시간 경과 이미지를 획득 (GFP 필터는 GCaMP3에 대해 작동합니다).
    참고 : 칼슘 RESP를 검사하는 데 약 2 시간 동안 시간 경과 이미지마다 30 초를 취득긴 시간의 과정을 통해 부상에 온세.
  4. 이미지 분석 소프트웨어를 사용하여 백그라운드에서 표피 세포 세포질 다섯 중심 다섯 관심있는 (ROI)의 열 동등한 영역에서 평균 GCaMP 형광을 측정한다.
  5. 그때 부상 전에 배경 5의 ROI 평균을 감산 표피에서의 ROI에서 5 형광의 평균을 기준선 형광 (F 0)을 얻었다. 기준선 [(F T는 -F 0) / F 0]에 대한 변화의 비율 ΔF 형광의 변화를 표현한다.

부상 후 F - 굴지 역학 4. 시각화

  1. 주 : 바늘 상처에 응답하여, 서서히 상처 주위 폐쇄 상처 부위에서 액틴 링을 관찰한다. 이 프로토콜 부 분석법 액틴 링 직경을 측정함으로써 폐쇄 권취.
  2. 이러한 융합 초파리 moesin 액틴 결합 도메인으로 F - 굴지 마커를 표현하는 유전자 변형 벌레를 생성GFP, 예컨대 (트랜스 juIs352) COL-19 (도 2a)로 표피 특이 적 프로모터의 제어하에 발현.
    참고 : 우리는 Lifeact 또는 F-tractin (게시되지 않은 결과)로 도메인 마커 바인딩 다른 액틴을 사용하여 유사한 결과를 얻었다.
  3. P COL-19- GFP-moesin 유전자 변형 웜에 상처 바늘을 수행합니다. 바늘 상처 후 ~ 5 분으로 상처 부위 주변 GFP-moesin의 반지를 관찰합니다. 액틴 링 직경이 작아지고 결국 야생형 동물 (그림 2A)에 부상 2 ~ 3 시간 게시물을 닫습니다.
  4. 유리 슬라이드에 2 % 한천 패드를 준비하고 12 mM의 2 μL의 levamisole 용액에 패드 (10) 상에 웜을 전송. 기존의 공 초점 현미경을 사용하여 부상 후 이미지 GFP-moesin 반지 1 시간.
    참고 : 사용 공 초점 현미경은 1 시간 부상 후 액틴 링의 Z-스택 (13 X 0.5 μm의)을 취득합니다.
  5. 부상 후 액틴 링의 직경을 측정한다. 표피 G를 정량하는 방법FP-moesin 먼저 Z 스택의 최대 강도 투사을 다음 4 라인 스캔을 그릴 GFP-moesin 링을 통해 (서로 45 °에서). 링 직경은 4 개의 라인 스캔 (그림 2B)의 피크 거리에 평균 피크로 정의된다. 이미 닫은 반지를 들어, 직경은 0 μm의로 정의된다.
    참고 :이 야생형에 상처 봉합 과정을 통해 약 절반 방법이기 때문에 F - 굴지 링 편리 부상 1 시간 게시물을 측정한다. F 액틴 링은 또한 상처 폐쇄 시간 코스를 유도하도록 여러 시점에서 측정 될 수있다. 상처 폐쇄의 시간 경과 영화의 levamisole 고정화 웜을 사용하여 디스크 공 초점 현미경을 회전 얻을 수있다.

표피 항균 펩타이드의 5 분석 유도

참고 : 상처도 C에서 선천성 면역 반응을 유발 엘레 피부. 항균 펩타이드 (AMPS)를 코딩하는 유전자의 전사 산업사입니다표피 uced. NLP-29 (신경 펩타이드와 같은 단백질) AMP 강력 4 명이 부상에 의해 유도된다. 표피 상처 후 AMP 발현을 조절하는 방법을 개별 AMP 사체 레벨을 검출하는 트랜스 제닉 리포터 또는 실시간 PCR을 사용하여 분석한다.

  1. 4 명이 부상에 대한 선천성 면역 반응에 대한 유전자 변형 기자 분석.
  2. 내부 통제로 P의 NLP-29- GFP 및 P COL-12을 DsRed를 포함하는 유전자 변형 기자 frIs7을 표현 성인 동물 (프로토콜 1과) 바늘 상처를 수행합니다. GFP 긴 패스 필터에 어두운 빨간색이나 주황색 unwounded 성인 동물을 관찰한다.
    참고 : 상처 야생 형 웜 P의 NLP-29 -GFP 발현을 유도하지만 GFP 긴 패스 조명 아래 오렌지, 노란색 또는 녹색을 표시 벌레 결과, P의 COL-12 -dsRed에 영향을 미치지 않습니다. 이러한 PMK-1 또는 p38 MAPK 경로에서의 유전자의 기능의 상실 nsy-1 차단 NLP-29 -GFP4 명이 부상 후 유도. P의 NLP-29- GFP는 유충 단계에서 높은 수준으로 발현된다
  3. 젊은 성인 동물 AMP 유도 분석을 수행합니다. unwounded 제어 동물 GFP의 낮은 수준을 가지고 있는지 확인하십시오.
    주 : P-29- NLP GFP 발현은 또한 삼투 스트레스 (8)에 의해 유도되고, 다른 환경 스트레스에 민감 할 수있다.
  4. 상처 후 6 시간은 GFP 긴 패스 필터와 범위를 해부 형광을 이용하여 P의 NLP-29 -GFP 유도 (그림 3) 9이 웜의 수를 점수.
    참고 : 1 시간 후 상처의 P NLP-29- GFP가 눈에 띄게 유도에서, 다음 6 시간 후 - 상처에 대한 피크에 도달하고하면 24 시간 후 상처까지 상승 남아. 시각 득점 4,9에 의해 발현을 정량화. 대안 적으로, 형광 활성화 웜 소터 4를 사용 발현 수준을 정량화. 웜 분류기를 들어, 적어도 50 동물 부상 될 필요가있다.
  5. ...로서 실시간 PCR 분석AMP 개별 유전자의 전 사체 수준을 ntitating. 여러 유전자 ​​분석 성적 수준 : NLP-29, NLP-30, CNC-1 및 CNC-5.
  6. 야생형 또는 돌연변이 웜에 상처 바늘을 수행합니다 (프로토콜 1 참조)
  7. 원하는 시간에 50 명이 부상 웜 및 50 unwounded 웜 (예 : 3, 6, 24 시간) 후 상처를 수집합니다.
  8. RNA는 제조업체의 지침에 따라 상용 키트를 사용하여 압축을 풉니 다.
  9. 상업 역전사 효소 키트를 사용하여 총 20 μl의 cDNA의를 얻기 위해 역전사를 수행합니다.
  10. RT-PCR의 경우, 녹색 형광 및 수퍼 믹스와 0.2 μM 프라이머와 조합하여 각 샘플 0.2 μL의 cDNA (1/40)을 사용한다. RNA의 질을 비교하기 위해 기준으로서 AMA-1 또는 SNB-1 RT-PCR을 사용한다; 내부 통제 (AMA-1 또는 SNB-1)로 정규화하여 AMP 상대적 발현 량을 비교, 또는 규범에 의해 (부상 웜 / unwounded 웜에 AMP 유도) 배 유도 후 상처를 비교내부 통제를 지향 모델.
    참고 : CNC-1과 CNC-5는 누구의 전사 10 명이 부상에 의해 활성화되는 가족 항균 펩티드를 caenacin 있습니다. 전형적으로, 바늘 상처가 발현을 유도 (CNC-1 ~ 500 배) 4 시간 10 시간 걸쳐. 출판 작업에 사용되는 프라이머는 표 2에 나열되어 있습니다.

6. 분석 생존 후 부상

  1. 참고 : 칼슘 의존 상처 수리 경로 및 선천성 면역 반응 경로 : 상처는 표피에 적어도 두 개의 독립적 인 신호 전달 경로를 활성화합니다. 두 경로 멸균 상처의 전체 생존을 위해 필요합니다. 돌연변이 또는 RNAi의 치료는 상처 치유에 영향을 미치는 여부를 테스트하기 위해, 24 ~ 48 시간 포스트 상처에서 생존을 측정한다. 선택적으로, 장에 -4,9- 부상의 효과를 결정하기 위해 종래의 수명 세이를 사용한다.
  2. (젊은 성인 (L4 + 24 시간) 웜에 50 벌레 부상 바늘을 수행, 반복 세비위의 프로토콜 한 다음 RAL 회). 컨트롤과 같은 unwounded 웜의 동등한 수를 유지한다.
  3. 생존에게 (새로운 한천 판 매 24 시간에 전송 부상 웜) 매 24 시간을 확인합니다. 이러한 GTL-2 또는 사격-1, 정규화 unwounded 제어 동물로 상처 수리에 결함이 돌연변이 체에서 부상 후 50 %의 생존율 ~ 24 시간을 관찰한다. 죽음은 웜의 선택에 의해 접촉하는 전위의 응답의 부족으로 정의된다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

이러한 GCaMPs 같은 칼슘 센서 (그림 1)과 시각으로 레이저 또는 바늘 상처는 표피 칼슘 수준의 신속하고 지속적인 상승을 트리거합니다. 칼슘 상승 초 이내에 발생하고 수십 분에 대한 높은 남아있다. 재현성 부상 바늘 상처 사이트 (그림 2)에서 F - 굴지 고리의 형성을 초래; 이러한 분 이내에 나타나며, 부상 후 점차 가까이 1-2 이상의 시간. 액틴 링이 적게보다 정확한 레이저 상처 후에 형성된다. 두 바늘과 레이저 상처는 전사 기자 (그림 3)로 검출 표피 항균 펩타이드 등 NLP-29 등 (AMPS)의 발현을 유도한다. AMP 유도는 부상 후 2-4 시간 내에 알 수있다 약 24 시간 지속됩니다. 야생형의 바늘 상처가 크게 (부상 후 24 시간 측정) 생존 또는 수명에 영향을 미치지 않습니다.

그림 1
그림 1. 레이저 상처는 C에서 칼슘 응답을 트리거 elegans의 표피. (A) 표피 GCaMP3 형광 (P COL-19 -GCaMP3 (juIs319)) 펨토초 레이저 상처 후 수준. 전방 몸에 표피의 측면보기; X, 레이저 상처; N, 표피 핵. 회전 디스크 공 초점 이미지, 강도 코드입니다. UW : unwounded, W :. / F 0 GCaMP3 ΔF의 상처 (B) 정량 20, 40, 상처 사이트에서 60 μm의에서; 대표 추적. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2. 바늘 상처는 상처 사이트 주위 액틴의 중합을 트리거합니다. (A) COL-19- GFP-moesin (juIs352)로 시각화 상처 마진에서 액틴 링의 형성을 트리거합니다. 규모 : 10 μm의. UW : unwounded, W :.. 선 검사에서 액틴 링 직경의 상처 (B) 정량은, 동물 당 4 라인 스캔 (패널에 빨간색 점선에게 (A), WT) 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3. 표피 상처가 선천성 면역 반응을 활성화합니다. 대표 이미지를 바늘 상처 후 P의 NLP-29 -GFP (frIs7) 유도 (WT는 unwounded, WT는 + 3 시간을 부상). 규모 :. 200 μm의 를 보려면 여기를 클릭하십시오이 그림의 더 큰 버전.

보고자 형질 전환 유전자 형광 대립 유전자
칼슘 PCOL-19 GCaMP3, PCOL-19 tdTomato GFP / tdTomato juIs319 X
굴지 PCOL-19-GFP :: moesin GFP juIs352 I
NLP-29 Pnlp-29-GFP / PCOL-12을 DsRed GFP / DsRed를 frIs7 IV

권취 응답 분석을 표 1에 사용 된 도입 유전자. 이 표는 염색체 Caenorhabditis 엘레 유전학 센터 (http://www.cbs.umn.edu/research/resources/cgc)에서 확인할 수 형질 전환 유전자를 통합 나열합니다.

유전자 이름 순서
NLP-29 F : cttctcgcctgcttcatggc
R : gtccgtatccaccatatcctcc
NLP-30 F : TT​​CTTCTCGCCTGCTTCATGG
R : CATAACCTCTACCATATCCACCG
CNC-1 F : gccattgtcgccatttcctc
R : cctccatacattggatatcctc
CNC-5 F : CTTCTTCTAGCAATGCTCGCTC
R : GTATCCTCCACCATACCCTCC
AMA-1 F : ACTCAGATGACACTCAACAC
R : GAATACAGTCAACGACGGAG
SNB-1 F : tccagcagacacaagctcagg
R : gagacaacttctgatcacgctc

AMP 성적 증명서의 RT-PCR에 사용되는 표 2. 프라이머. 농도를 작업 0.2 μM. SNB-1 내부 통제의 역할을한다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

바늘과 레이저 상처 여기 제시된 방법은 손상을 복구하는 표피 상피의 능력을 평가하기위한 보완적인 접근법을 제공한다. 바늘 상처가 표피, 표피 및 내부 가능성 기저막을 방해하는 반면 레이저 상처는 표피에 국한 될 수 비교적 지역화 및 (레이저 구성에 따라)이다. 바늘 상처보다 정확하게 병원균이나 자연 환경에서 기계적 손상에 의해 입은 상처과 유사 할 수 있습니다. 일반적으로, 바늘 상처는 동물의 생존과 호환되는 정확한 상처를 달성하기 위해 더 많은 연습이 필요합니다. 바늘과 레이저 상처 디스플레이 많은 유사점에 대한 세포 반응. 그러나 그것은 액틴 고리 형성이 재현 펨토초 레이저 상처 후에 관찰되지 않는다는 것을 알아야한다.

또한 바늘 기여 웜에 손​​해 내부 조직 : 바늘 구멍의 한계는 정확한 상처되지 않는 것입니다생존 기간은 조사되지 않음. 이 프로토콜의 수정 가능한 사항은보다 정확한 물리적 상처를 수행하기 위해 미세 유체 기반의 미세 주사 시스템 (11)과 형광 기자를 결합하는 것입니다.

여기에 설명 된 바늘과 레이저 상처 방법은 어려운 상처 응답의 특성에 게놈 또는 생화학 적 방법을 사용할 수 있도록, 아직 상당히 노동 집약적, 기껏 중간 처리량 간단하다. 균류 또는 원충 (12, 13) 등의 표피 관통 동물 병원균의 큰 집단에게 전달 될 ​​수 있고, 상처에 대한 반응과 중첩 반응을 유발하면서도 특정 병원체 응답의 추가적인 복잡성을 초래할 수있다. 또한 작품은 같은 탄도 충격 (14) 또는 마이크로 기계 피어싱 구조 (15)의 배열과 같은 다른 비 생물 적 방법이 대규모 상처에 대해 적용 할 수 있는지 여부를 조사해야합니다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics