Produksjon og målretting av Monovalent Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

Dynamikken av enkle molekyler på levende celler bidrar til deres biologiske funksjon. Enkelt molekyl fluorescens bildebehandling er en populær metode for å studere enkelt molekyl dynamikk på celleoverflaten 1,2,3. Men de mest brukte avbildningsfølere i disse studiene har flere viktige ulemper. For eksempel konvensjonelle organiske fargestoffer og fluorescerende proteiner gir moderat lysstyrke, ca 10 5 -10 6 M -1 cm -1, men er fotokjemisk ustabilt, bleking etter utslipp av ca 10 5 -10 6 fotoner under typiske levende celle bildeforhold 4,5. I kontrast, halvleder nanopartikler, ofte kalt kvanteprikker (QDS), er betydelig lysere og mer stabil, med ekstinksjonskoeffisienter i størrelsesorden 10 6 -10 7 M -1 cm -1 og over 10 7 -10 8 slippes ut fotoner før photobleaching fem. Den forbedrede lysstyrke og fotostabilitet av QDS enn organiske fluoroforene muliggjør observasjon av enkle molekyler til betydelig raskere bildefrekvens og over mye lengre baner seks.

Til tross for sine fordeler og kommersiell tilgjengelighet, flere forpliktelser forblir for disse kraftige bildebehandlings agenter. For det første har de dårlig definert målretting valens, noe som kan resultere i tverrbinding av målrettede biomolekyler 6. For det andre, de har generelt et stort hydrodynamisk størrelse (> 20 nm) som begrenser tilgjengeligheten til visse fylt cellulære miljøer 7. For det tredje har de begrenset målretting modularitet 7. Flere strategier har forsøkt å løse disse problemene 8,9,10, men generelt krever spesialisert kunnskap og reagenser å implementere.

For å løse disse problemene, vi nylig rapportert en "sterisk Utelukkelse" strategi for å forberede enverdige, liten, ogmodulære QDS 11. De QDS er pakket med en eneste lang fosfortioat DNA (ptDNA) polymer. Den ptDNA bindes til QD overflate gjennom flere Zn-S-interaksjoner mellom overflateeksponerte Zn-atomer og de Fosfortioat-grupper av den ptDNA polymer. En enkelt bundet polymer sterisk og elektrostatisk utelukker binding av flere ekvivalenter av polymer uten i vesentlig grad å øke partikkelens samlede størrelse (ca 2 nm). Alle reagenser er kommersielt tilgjengelige, produkter dannes i høyt utbytte, og prosessen krever bare avsaltingstrinn for rensing. Når merket, QDS innpakket med et enkelt ptDNA (mQDs) binder seg til komplementære DNA-trådene peiling rettet domener (f.eks benzylguanine (BG), benzylcytosine eller alkylhalides).

Disse funksjonene målrette mQDs spesifikt til enzymatiske koder som SNAP, CLIP & HALO som er genetisk smeltet til protein av interesse. Dette er en protokoll for syntese, Målretting, og live-cell imaging av mQDs produsert av sterisk eksklusjon.

Protocol

1. Produksjon av Monovalent Quantum Dots

  1. Fase overføring av QDS fra organisk til vannfasen
    1. Fortynn 200 pl av en 1 mM oppløsning av organiske fase QDS med 400 pl av kloroform i en 5 ml glassampulle.
    2. Bland 400 ul av en 0,3 M tetrabutylammoniumbromid (TBAB) kloroform-løsning med 36 pl av pen mPEG tiol (CH3 O (CH 2 CH 2 O) 6 C 2 H 5 SH) og rist O / N.
    3. Legg 800 pl av en 0,2 M NaOH, vandig løsning, og rist i 30 sek. En faseoverførings oppstår i løpet av noen få minutter, vist ved overføring av de fargede partikler til den vandige fasen ovenfor tettere organiske fase.
    4. Hvis partiklene aggregerer i en tredje fase mellom de vandige og organiske faser, øke inkubasjonstid med mPEG tiol. Dersom den vandige fase forblir klar, ikke de QDS faseoverføring (se figur 3A). Alternativt, øke concentrasjon av mPEG tiol i trinn 2 for å lindre dårlig faseoverføring.
    5. Gjenvinn (farget) vandig fase og deretter konsentrere de innsamlede QDS med en Centricon spin-kolonne (30 kDa molekylvekt cut-off) til 1 ml.
    6. Tilsett konsentrert QD-løsning inn i en Sephadex NAP10-kolonne pre-ekvilibrert med 10 mM Tris-buffer inneholdende 30 mM NaCl (pH 8,0). Eluer QDS med 1,5 ml av eluerings-buffer ved tyngdekraftstrøm.
    7. Måle konsentrasjonen av QDS med absorpsjon-spektroskopi ved 350 nm.
  2. Utarbeidelse av mQDs
    1. Purchase (eller syntetisere) ptDNA. Denne protokollen bruker sekvensen 5'-A S 50 (CT) 10 (ACTG) 5 -3 '(se tabell 1).
DNA Sekvens
5'-A S 50 (CT) 10 (ACTG) 5 En S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
En S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
En S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH 2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG- / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

Tabell 1. DNA-sekvenser brukt for å produsere og target mQDs.

  1. Forbered 1 ml 100 nM QD-løsning i 10 mM Tris-buffer inneholdende 30 mM NaCl (pH 8).
  2. Legg slippe klok 500 pl av 100 nM ptDNA løsning på de vandige QDS i 1 min under kraftig omrøring. Rør eller plassere på en shaker for ytterligere 9 hr.
    Merk: Dette skal teoretisk gi en 1: 2 forhold på ptDNA: QD. Imidlertid er selve støkiometri aldri perfekt - vanligvis resultatet er nærmere til 1: 1,5. For å produsere en 1: 1-forhold av ptDNA: QD, er det nødvendig densitometry etter gelelektroforese for å kvantifisere det nøyaktige forholdet mellom konjugering gitt de kjente volumer benyttet ovenfor.
  3. Fjern ~ 10 pl av den QD blandingen for å kjøre på en analytisk agarosegel. Fjerner også en tilsvarende konsentrasjon av ukonjugerte QDS i vannfasen (fra trinn 1.2.1).
    1. Legg ~ 2 μ, L av 6x Ficoll lastebuffer (for å øke oppløsningen densitet) og drives av disse to prøvene sammen på en 0,8% vekt / volum agarosegel i natriumboratbuffer i 15 min ved 150 V. En enkelt bånd i det ukonjugerte styre lane migrerer nær brønnen, og to band i kjørefelt med konjugerte QDS blir sett (se gels i figur 2B).
  4. Beregn ukonjugert QD fraksjon ved hjelp av den relative intensitet av de to båndene (se ligningen i figur 2B). Bruk så at fraksjonen for å beregne den ekstra volum på 100 nM ptDNA løsning som kreves for å passe til antallet av QDS.
  5. Gjenta trinn 1.2.3 til 1.2.5 igjen med denne beregnede volumet eller til konjugerte QDS kollaps i ett enkelt band på gelen som indikerer komplett konjugering av alle QDS.
  6. Tilsett 100 pl av 10 mM (CO 2 H) CH2 O (CH2 CH2 O) 6 C 11 H 23 SH (karboksy PEG6 alkantiol) i 10 mM Tris buffer containing 30 mM NaCl (pH 8) til de konjugerte mQDs produsert ovenfor, og rist i 10 min.
    Merk: Disse PEG ligander passivate QD overflaten. En lengre PEG vil bedre passivere de QDS, men det vil også øke sin størrelse. Den hydrofobe alkantiol funksjonalitet har en mye høyere affinitet for QDS, samlet, enn mindre hydrofobe PEG-tiol brukt for fase overføring. Derfor bør man ikke tillate dette trinnet for å fortsette for lenge eller ptDNA vil bli erstattet av alkan-PEG-tiol. Etter en ~ 30 min inkubering, vil en betydelig andel av DNA er blitt fortrengt fra QDS (figur 3B).
  7. For å fjerne overskudd av alkan PEG-tiol, tilsett 0,5 ml av QD-løsning til en Sephadex NAP5 kolonne pre-ekvilibrert med elueringsbuffer (10 mM Tris-buffer inneholdende 30 mM NaCl). Samle mQDs med 1.0 ml elueringsbuffer ved tyngdekraftstrøm.
  8. Konsentrer de innsamlede QDS med Centricon spin kolonne (30 kDa). Lagre disse mQDs ved 4 ° C i månedsvis. Ikke freeze dem.
    Merk: Hvis en farget pellet i bunnen av røret er sett, har prikkene aggregeres og vil sannsynligvis ikke lenger er brukbar.

2. Produksjon av Targeting (Benzylguanine-) DNA

  1. Produsere eller kjøpe amin-terminert DNA. Denne protokollen bruker sekvensen 5'-NH 2 - (CT) 10 - (CAGT) 5 -3 '(se tabell 1). Poly-CT linker øker tilgjengeligheten til funksjonalitet begravd dypt i glycocalyx men kan ikke være nødvendig for alle applikasjoner. Hvis det er tilgang til en DNA-syntetisator, produserer amino-modifisert DNA ved hjelp av et passende 5'-amino-modifikator (5 'amino-modifikator C6).
  2. Oppløs BG-N-hydroksysuksinimid (NHS-BG) i tørr dimetylsulfoksyd (DMSO) ved en konsentrasjon på 10 mg / ml.
    Merk: BG-NHS vil absorbere vann fra luft og føre til hydrolyse av det reaktive NHS-ester, særlig i hydroskopiske løsningsmidler som DMSO og dimetylformamid (DMF). BG-NHS er best butikkd ved -80 ° C som et pulver i sin egen hetteglass i en sekundær beholder inneholdende tørkemiddel. Oppvarmes til romtemperatur før du åpner flasken. Alternativt umiddelbart alikvot for engangsbruk BG-NHS-ester i en tørr polart løsningsmiddel og fryse på -80 ° C, eller reagere fullt ut med amin-DNA i trinn 2.2.
  3. React ved å blande BG-NHS i DMSO fra trinn 2.1 med amin-terminerte DNA i HEPES (4-(2-hydroksyetyl) -1-piperazineethanesulfonic syre) bufret (pH 8,5) vann. I en typisk reagere 20 pl av 10 mg / ml BG-NHS i DMSO med 2 ul av 2 mM NH 2 - (CT) 10 - (CAGT) 5 i 58 mL deionisert vann bufret med 20 ul 0,5 M HEPES pH 8,5. Utføre reaksjoner i et 1,5 ml mikrosentrifugerør. Bland så raskt at reaksjonen forløper raskt og må konkurrere med NHS-ester-hydrolyse.
  4. Sonicate for 5-10 min for å sikre grundig blanding. Inkuber i ~ 1 time ved RT Det støkiometriske forhold mellom BG: DNA kan bli endret for å drive reaksjonen til fullførelse.
  5. Rens det BG-DNA fra ikke-omsatt amin-DNA ved hjelp av revers-fase HPLC som kjører en 100 mM TEAA: acetonitril (ACN) gradient mellom 8% og 95% acetonitril over 30 min. Ureagert amin-DNA vil eluere før BG-DNA. Samle BG-DNA fraksjonen i et konisk rør.
    1. Bruk en Zorbax kolonne C 18 for standard oligonukleotid rensing og følgende gradient:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30-90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Fryse i flytende nitrogen og lyofilisere den oppsamlede fraksjon. Resuspender DNA i avionisert vann. For å være ekstra forsiktig, lyofilisere to flere ganger for å fjerne rester av TEAA. Residual TEAA kan være giftig for celler ved høyere konsentrasjoner.
  7. Resuspender lyofilisert BG-DNA i vann, og pass på å vaske sidene av the tube, og fortynne til ~ 25 mikrometer lager. Delmengde og oppbevar ved 4 ° C. Prøvene ble lagret i ~ 9 måneder uten merkbar degradering.

3. Merking levende celler med Monovalent Quantum Dots

  1. Eventuelt passivere de mQDs like før en avbildning eksperiment ved hjelp av reagenser slik som kasein (0,5%) eller bovint serumalbumin (BSA, 1-3%).
  2. Plate celler uttrykker SNAP-tagget protein på total intern refleksjon fluorescens (TIRF) -quality glass. I dette eksperimentet, bruker vi en U2OS cellelinje som uttrykker en SNAP-merket Notch1 reseptor og glassflater høy kvalitet.
  3. Etter at cellene er festet til glasset (~ 24 timer), fjernes vekstmedier, vask med PBS, og cellene inkuberes i 10-30 minutter ved RT i ~ 100-150 pl av PBS eller cellemedier inneholdende 1 mM ~ BG- DNA fra trinn 2.6 ovenfor.
  4. Etter inkubasjon med BG, omhyggelig vaskes cellene med PBS eller cellemediet. Inkuber cellene for ~ 5-10 min med the mQDs produsert i trinn 1.2.9 (og eventuelt passivert i trinn 3.1).
  5. Eventuelt, vaskes de ikke-bundne mQDs og returnere cellene til en buffer / media egnet for både avbildning og kultur. For celler som var skal bli avbildet i TIRF modus, et endelig vasketrinn var ofte unødvendig som ubundne mQDs i løsning diffundert så raskt sammenliknet med bundne mQDs som å være ikke-detekterbar i løpet av analysen.

4. Mikros og analyse

  1. Bilde cellene ved hjelp av en TIRF mikroskop.
    Merk: Omfanget må ha delbar eksitasjon og emisjonsfiltre, eller en tilpasset QD filter kube. QDS er best spent med en lav-bølgelengde laser (405 eller 488 nm). QDS av ulik diameter har karakteristiske utslippsbølgelengder, vanligvis forbundet med en stor Stokes shift.
  2. På grunn av lysstyrken mQDs, samle bilder med høy bildefrekvens i TIRF mens bildebehandling basal siden av en levende celle.
    Merk: Alternativt kan enkelt-molekyl dynamikk være Folloons på andre knutepunkter flyene ved hjelp av en roterende disk confocal mikroskop. Automatisert single-partikkel sporing programvare er generelt vellykket på nøyaktig sporing de lyse og photostable mQDs.

Representative Results

Fasen overføring av QDS fra et organisk til vandig fase er kritisk for produksjon av mQDs, men kan være både betingelse og QD-spesifikke. Faseoverførings i avsnitt 1.1 skal vises så ren som de to første hetteglassene i figur 3. Dersom overføring vises mer som hetteglass tre, så man bør prøve igjen med andre forhold.

Når QDS belegges med en negativt ladet DNA bør de migrerer på en gel adskilt fra de ikke-innpakket QDS. Ved hjelp av en alikvot av uemballerte QDS som en kontroll, en andre, bør hurtigere-trekkende bånd vises ved tilsetning av ptDNA, som sett i det første gelen i figur 2B. Fullstendig dannelse av mQDs demonstreres med tap av den immobile band, og dets sammenbrudd i den mobile bånd som vist i den siste gel i figur 2B. Hvis en delmengde av din MQD produktet vandrer som en enkelt band skilles fra de uåpnende QDS, så din mQDs er enverdige og r eady å bli brukt i ytterligere trinn.

Cell merking bør være spesifikke for målet for ditt valg og bør være avhengig av protein uttrykk nivåer og MQD konsentrasjon. Empirisk optimalisering av både MQD konsentrasjon og MQD passivisering er ofte nødvendig for en gitt applikasjon. Figur 4B viser merking av U2OS celler uttrykker en SNAP-merket Notch reseptoren med mQDs varierer i konsentrasjon fra 0,5 nM til 10 nM.

Figur 1
Figur 1. Modular målretting av mQDs. MQDs hybridiserer til ssDNA funksjon av ulike målsøkende molekyler. Benzylguanine bundet DNA mål mQDs å knipse-merket fusjonsproteiner. Andre 5 'modifikasjoner og DNA-sekvenser tillater målretting av mQDs til en rekke andre biomolekyler./files/ftp_upload/52198/52198fig1highres.jpg "target =" _blank "> Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Scheme for produksjon av mQDs. (A) Organisk fase QDS blir overført til den vandige fase ved behandling med mPEG tiol og TBAB, pakket med ptDNA, og passivert med karboksy PEG6 alkantiol. Representant TEM bilder er organisk QD545, QD585, og QD605, henholdsvis. (B) En fremgangsmåte for empirisk bestemmelse av støkiometrien for interaksjon mellom QDS og ptDNA i trinn to ovenfor. QD & ptDNA støkiometrier er empirisk verifisert av densitometry slik at slutt reaksjonsstøkiometrien er 1: 1 (QD: ptDNA). Den innledende antall mol ptDNA er multiplisert med forholdet mellom QD: MQD, og ​​justert av det faktiske volum af ter konjugering å gi antall føflekker som kreves for å oppnå 1:. en konjugering Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Eksperimentelle detaljer for produksjon av mQDs. (A) Representative bilder av vellykkede og mislykkede fase overføring. QDS bør visuelt overføre mellom den tette organiske fase og den mindre tette vandige fase. Ufullstendig faseseparasjon indikerer dårlig overføring. (B) ptDNA kan erstattes av alkan-PEG-tiol. Høyre gel data er representativ for en reaksjon der en betydelig andel av ptDNA har blitt fordrevet fra QDS på grunn av over-passivisering.es.jpg "target =" _blank "> Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. Merking SNAP-merket proteiner på levende celler. (A) Skjematisk demonstrere uttrykk, feste og merking av en SNAP-tagget reseptoren med en BG-målrettet MQD. (B) Representant merking av celler som uttrykker en SNAP-Notch-mCherry konstruere på ulike MQD konsentrasjoner. mQDs passive med PEG12 colocalize med mCherry indikerer spesifikk merking. Lavere merking tettheter (<0,5 nM) er generelt å foretrekke for enkelt partikkel sporing. Scale bar er 10 mikrometer. Vennligst klikk her for å se en større versjon av dette tallet.

Discussion

Modulariteten MQD design gir en økt grad av eksperimentell fleksibilitet. For eksempel kan en rekke mQDs raskt fremstilt i unike farger som muliggjør den samtidige avbildning av flere mål. SsDNA målsøkende sekvens kan direkte mQDs til proteiner, sukker, lipider og 12 flater 13. En rekke enzymatiske koder er tilgjengelig med ortogonale reaktiviteter slik at flere mål som skal avbildes samtidig med ulikt målrettede mQDs. I tillegg til målretting med SNAP tag, merking av target proteiner med mQDs bruke Klipp tag, HALO tag, og biotinylerte proteiner var også vellykket. Denne protokollen demonstrerer spesifikk merking av en overflate-reseptor på levende celler med disse mQDs, men protokollen kan lett tilpasses til en rekke ulike sammenhenger.

Den betydelige metodiske innsikt i å produsere mQDs med definert valens er at ~ 50 fosfortioat bundetbaser er pålagt å vikle QDS (og dermed hindre at to molekyler fra binding samtidig). En poly-A S 50 sekvens reproduserbart og stabilt bundet 605 nm QDS fra Life Technologies. Selv om dette produktet er utgått, er den sterisk utelukkelse strategi generaliseres til lignende produkter fra andre leverandører har ulike størrelser, former, spektrale egenskaper.

Effektivitet og stabilitet ptDNA-innpakket QDS avhenger kritisk på overflatekjemi og struktur av QDS. Derfor vil lykkes i en protokoll avhenge av kommersiell kilde og kjemiske struktur av de QDS. Ved anvendelsen av denne protokollen, tre store poeng av forskjellen finnes mellom ulike kommersielle kilder QDS: en forskjell i forutsetninger for fase overføring; en forskjell i styrken av initial PEG-tiol-ligand binding, eventuelt hindrer forskyvning av ptDNA; og en forskjell i mengden av eksponert CdSe kjerne, som kan leannonsen til slukke av QD av MPEG tiol faseoverføringsforhold.

Som for offentliggjøring, QDS med den beste strukturen for produksjon av mQDs er 4-10 nm CdSe / ZnS kjerne / skall QDS kjøpt fra Life Technologies med utslipp spektra ved 545, 585, 605 og 625 nm (figur 2A). QDS basert på 'Vivid' formulering (545, 605, etc.) slukke ved tilsetning av mPEG tiol og er ikke egnet for dette programmet. QDS fra Aldrich og Ocean Nanotech fungerer bra, men krever lengre Phase Transfer trinn og forbehandling med trioktylfosfinoksyd. Denne protokollen er optimalisert for QDS fra Life Technologies.

Den poly-A fosfortioat-sekvens som brukes for å vikle den QDS er avsluttet med et opprinnelig 20-mer DNA-halen inneholdende sekvensen av (ACTG) 5 til hvilken en rettet tråd kan hybridisere. Denne sekvensen er praktisk, som det har liten eller ingen sekundærstruktur, og vil forbli hybridized ved 37 ° C i PBS. Hvis det er tilgang til en DNA-syntetisator, kan ptDNA ved syntetisert og deretter renset ved revers-fase høyytelses-væskekromatografi (HPLC) under anvendelse av en C 8 kolonne. Den ptDNA vil elueres senere på HPLC enn tilsvarende oligonukleotider med en innfødt ryggrad. Vi vanligvis forlate 5 'DMT-beskyttende gruppe på våre Fosfortioat oligonukleotider etter rensing.

Passivisering av ptDNA-innpakket QDS er vanligvis nødvendig for å forbedre kolloidalt stabilitet QDS og redusere bakgrunns bindende for de fleste eksperimentelle applikasjoner. Protokollen bruker en PEG-lag for å passivate QDS. Karboksy PEG alkantiol med ekstra PEG-enheter ((CO 2 H) CH2 O (CH2 CH2 O) 12 C 11 H 23 SH, karboksy-PEG12 alkantiol) gir betydelig redusert bakgrunn, skjønt de lengre tappene er både større, og generelt mer kostbare. mQDs belagt med karboksy PEG alkane tiol-ligander er meget stabil i fysiologiske buffere slik som fosfat-bufret salines og kulturmedier. Langtidslagring (> 8 måneder) av mQDs ved 4 ° C viste ingen signifikant aggregering eller ptDNA avløsning 11. Avhengig av eksperimentet, PEG passivering av de QDS alene ikke alltid er tilstrekkelig å redusere ikke-spesifikk binding av de mQDs. Inkubering av begge celler og mQDs i fosfatbufret saltvann (PBS) inneholdende 3% BSA i 20 min før bruk i det vesentlige reduserer ikke-spesifikk binding til celler, selv om det øker den tilsynelatende hydrodynamisk radius av mQDs ved ~ 50%. Passive med 0,5% kasein reduserer ikke-spesifikk binding enda mer, men det øker den tilsynelatende størrelse til en større grad enn BSA.

Den 5 'ende av en DNA-tråd komplementær til mQDs kan bli modifisert for å muliggjøre målretting av et antall forskjellige biomolekyler. Det finnes en rekke etablerte teknikker tilgjengelig for kovalent å modifisere proteiner, lipids og sukkere med enkelt-trådet DNA (ssDNA). Så lenge ssDNA blir presentert ekstracellulært, er det tilgjengelig for oppløselige mQDs. mQDs med de ovennevnte sekvenser som hurtig vil hybridisere med deres komplementære DNA-tråd i henhold til cellekulturbetingelser. En 10-20x poly (CT) spacer mellom ptDNA og den målsøkende sekvens kan være nødvendig for effektiv målretting derved å heve bindende sekvens ovenfor den tykke og negativt ladet glycocalyx av cellen. For denne protokollen valgte vi å produsere en BG-DNA med en komplementær sekvens av (CAGT) 5 som vil både hybridisert til mQDs og kovalent knytte seg til en SNAP-tag protein for rask og spesifikk merking. En lignende protokoll fungerer godt for kobling andre NHS-estere til amino-modifisert oligonukleotider.

For enkelt-molekyl avbildning, er en lav tetthet av merking som vanligvis kreves for å løse de enkelte molekyler. En endelig MQD konsentrasjon av ~ 0,5 nM i PBS med passiviserende middeler et godt mål. Men disse høye fortynninger av og til resulterte i under-merking av cellene. Hvis dette skjer, kan ytterligere MQD legges inntil en optimal tetthet av merking er observert. I tilfelle av SNAP-tagget humant Notch1, konsentrasjoner på> 10 nM MQD produsert tette merking celler, mens 0,5 nM MQD resulterte i festingen av ~ 20 mQDs på den basale overflaten av målrettet celle (se figur 4B). Cell merking med mQDs var svært avhengig av konfluens av belagt celler. Altfor konfluente celler ikke merke på sine basale overflater.

I sammendraget, til en enkel metode generere mono og modul QDS ble beskrevet. Disse mQDs finne verktøyet i bredt spekter av levende celle bildebehandlingsprogrammer, som demonstrert av imaging Notch reseptor på levende U2OS celler. Anvendelse av mQDs er ikke begrenset til dette spesifikke tilfellet, men kan eventuelt utvides til andre cellulære mål, for eksempel andre proteiner, nukleinsyrer, og enzymer.

Acknowledgements

Finansiering fra DOD W81XWH-10-1-1023 (ZJG), Grant P50 GM081879 fra UCSF Center for Systems og syntetisk biologi (ZJG), NIH 5R21EB015088-02 (YJ) og NIH 1R21EB018044 (ZJG & YJ). DS ble støttet av Human Frontier Science Program Tverrfaglig postdoc stipendiat.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats