Produção e Segmentação de Monovalent Quantum Dots

1Department of Otolaryngology, University of California, San Francisco, 2Department of Chemistry, University of California, Berkeley, 3Materials Science Division, Lawrence Berkeley National Laboratory, 4Department of Pharmaceutical Chemistry, University of California, San Francisco, 5Tetrad Graduate Program, University of California, San Francisco, 6Center for Systems and Synthetic Biology, University of California, San Francisco, 7Chemistry and Chemical Biology Graduate Program, University of California, San Francisco
* These authors contributed equally
Published 10/23/2014
0 Comments
  CITE THIS  SHARE 
Bioengineering
 

Summary

Cite this Article

Copy Citation

Seo, D., Farlow, J., Southard, K., Jun, Y. w., Gartner, Z. J. Production and Targeting of Monovalent Quantum Dots. J. Vis. Exp. (92), e52198, doi:10.3791/52198 (2014).

Please note that all translations are automatically generated through Google Translate.

Click here for the english version. For other languages click here.

Abstract

Introduction

A dinâmica de moléculas individuais em células vivas contribui para a sua função biológica. Imaging molécula de fluorescência único é um método popular para estudar a dinâmica única molécula na superfície das células 1,2,3. No entanto, as sondas de imagem mais comumente usados ​​nestes estudos têm várias desvantagens importantes. Por exemplo, corantes orgânicos convencionais e as proteínas fluorescentes proporcionam brilho moderado, cerca de 10 5 a 10 6 M -1 cm -1, mas são fotoquimicamente instável, de branqueamento após a emissão de cerca de 10 5 -10 6 fotões sob condições típicas de processamento de imagens de células vivas 4,5. Em contraste, as nanopartículas de semicondutores, freqüentemente chamados de quantum dots (QDs), são significativamente mais brilhante e mais estável, com coeficientes de extinção na faixa de 10 6 -10 7 M -1 cm -1 e superior a 10 7 a 10 8 fótons emitidos antes photobleaching 5. O melhor luminosidade e fotoestabilidade de QDs mais de fluoróforos orgânicos permite a observação de moléculas individuais em taxas de quadro significativamente mais rápidas e mais muito mais tempo trajetórias 6.

Apesar de suas vantagens e disponibilidade comercial, vários passivos permanecer para esses agentes de imagem poderosos. Em primeiro lugar, eles têm pouco definida valência de segmentação, o que pode resultar na ligação cruzada de biomoléculas-alvo 6. Em segundo lugar, eles geralmente têm um tamanho grande hidrodinâmico (> 20 nm) que limita a acessibilidade a determinados ambientes celulares lotados 7. Terceiro, eles têm limitado visando modularidade 7. Várias estratégias têm tentado resolver estes problemas 8,9,10, mas geralmente exigem conhecimento e reagentes especializada para implementar.

Para resolver estes problemas, informou recentemente uma estratégia "de exclusão espacial" para a preparação monovalente, pequenas emodulares QDs 11. Os QDs são envolvidos com um único polímero de DNA fosforotioato longa (ptDNA). O ptDNA se liga à superfície através de interacções múltiplas QD Zn-S entre átomos de Zn expostos à superfície e os grupos fosforotioato do polímero ptDNA. Um único polímero estericamente ligada electrostaticamente e exclui a ligação de equivalentes adicionais do polímero sem aumentar significativamente o tamanho total da partícula (cerca de 2 nm). Todos os reagentes estão comercialmente disponíveis, os produtos são formados com um rendimento elevado, e o processo requer poucos passos de dessalinização para purificação. Uma vez marcado, QDs embrulhados com um único ptDNA (MQDS) se ligam a cadeias de DNA complementares que ostentem domínios de segmentação (por exemplo, benzilguanina (BG), benzilcitosina, ou halogenetos de alquilo).

Estas funcionalidades alvo as MQDS especificamente para etiquetas enzimáticas, tais como SNAP, CLIP & HALO que são geneticamente fundido com a proteína de interesse. Este é um protocolo para a síntese, Direcionamento e imagem ao vivo de células de MQDS produzidos por exclusão estérica.

Protocol

1 Produção de vacina monovalente Quantum Dots

  1. De transferência de fase a partir de QDs orgânica para a fase aquosa
    1. Dilui-se 200 ul de uma solução 1 | iM de QDs fase orgânica com 400 mL de clorofórmio num frasco de vidro de 5 mL.
    2. Misturar 400 mL de uma solução 0,3 M de brometo de tetrabutilamónio (TBAB) de clorofórmio com 36 jil de tiol puro mPEG (CH 3 S (CH 2 CH 2 O) 6 C 2 H 5 SH) e agitar S / N.
    3. Adicionar 800 ul de uma solução aquosa 0,2 M de NaOH e agita-se durante 30 seg. Uma transferência de fase ocorre dentro de poucos minutos, indicadas pela transferência de partículas coloridas para a fase aquosa acima da fase orgânica mais denso.
    4. Se as partículas de agregado em uma terceira fase entre as fases aquosa e orgânica, aumentar o tempo de incubação com o tiol mPEG. Se a fase aquosa continua a ser evidente, as QDs não de transferência de fase (ver Figura 3A). Como alternativa, aumentar a concentração de mPEG tiol no passo 2 para aliviar transferência de fase pobre.
    5. Recuperar o (colorido) fase aquosa e, em seguida, concentrar os QDs recolhidos com uma coluna Centricon rotação (30 kDa peso molecular de corte) a 1 ml.
    6. Adicionar a solução QD concentrada em uma coluna de Sephadex NAP10 pré-equilibrada com tampão Tris 10 mM contendo NaCl 30 mM (pH 8,0). Eluir QDs com 1,5 ml de tampão de eluição por fluxo de gravidade.
    7. Medir a concentração de QDs com a espectroscopia de absorção a 350 nm.
  2. Preparação de MQDS
    1. Compra (ou sintetizar) ptDNA. Este protocolo utiliza a sequência 5'-S Um 50 (CT) 10 (ACTG) 5 -3 '(ver Tabela 1).
DNA Sequência
5'-A S 50 (CT) 10 (ACTG) 5 A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S A S
CTCTCTCTCTCTCTCTCTCTACTGACTGACTGACTGACTG
5'-NH2 - (CT) 10 (CAGT) 5 -3 ' NH 2 - / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT
BG-DNA BG / C6spacer / CTCTCTCTCTCTCTCTCTCTCAGTCAGTCAGTCAGTCAGT

1. sequências de ADN Tabela utilizada para produzir e MQDS alvo.

  1. Prepare uma solução de 100 ml de QD nM em tampão Tris 10 mM contendo NaCl 30 mM (pH 8).
  2. Adicionar gota a gota, 500 mL da solução de 100 nM para os ptDNA QDs aquosas durante 1 minuto, enquanto se agitava vigorosamente. Agita-se ou colocar num agitador durante uma hora adicional 9.
    Nota: Isto deve, teoricamente, produzir uma relação de 1: de ptDNA 2: QD. No entanto, a estequiometria real nunca é perfeita - geralmente o resultado é mais próximo de 1: 1,5. A fim de produzir uma relação de 1: 1 de ptDNA: QD, densitometria após electroforese em gel é necessária para quantificar a proporção exacta de conjugação, dados os volumes conhecidos utilizados acima.
  3. Retirar ~ 10 ml da mistura QD para rodar em um gel de agarose analítico. Também remover uma concentração semelhante de QDs não conjugados em fase aquosa (do passo 1.2.1).
    1. Adicionar ~ 2 μ; L de tampão de carregamento de 6x Ficoll (para aumentar a densidade da solução) e executar estas duas amostras em conjunto sobre um gel de 0,8% p / v de agarose em tampão de borato de sódio durante 15 min a 150 V. Uma única banda na pista de controlo não conjugada a migrar perto o bem, e as duas bandas na faixa com QDs conjugados são vistos (ver em géis Figura 2B).
  4. Calcula-se a fracção QD não conjugada usando a intensidade relativa das duas bandas (ver a equação na Figura 2B). Em seguida, use essa fração para o cálculo do volume adicional de 100 nM solução ptDNA necessário para corresponder ao número de QDs.
  5. Repita os passos de 1.2.3 a 1.2.5, mais uma vez com este volume calculado ou até o colapso QDs conjugados numa única banda no gel, indicando conjugação completa de todos os QDs.
  6. Adicionar 100 ul de 10 mM (CO 2 H) CH 2 O (CH 2 CH 2 O) 6 C 11 H 23 SH (carboxi PEG6 alcano tiol) em tampão Tris 10 mM containing NaCl 30 mM (pH 8) para os conjugados produzidos MQDS acima, e agita-se durante 10 min.
    Nota: Estes ligantes PEG passivate superfície do QD. A PEG já vai melhor passivate os QDs, no entanto, que também irá aumentar o seu tamanho. A funcionalidade alcano tiol hidrofóbico tem uma afinidade muito maior para os QDs, no total, do que os menos hidrofóbico PEG-tiol utilizado para a transferência de fase. Portanto, não permita que este passo para continuar por muito tempo ou o ptDNA será substituído pelo alcano-PEG-tiol. Após um minuto de incubação ~ 30, uma fracção significativa de DNA terá sido deslocado da QDs (Figura 3B).
  7. Para remover o excesso de PEG-alcano tiol, adicionar 0,5 ml da solução QD para uma coluna Sephadex NAP5 pré-equilibrada com tampão de eluição (tampão Tris 10 mM contendo NaCl a 30 mM). Recolher os MQDS com 1,0 ml de tampão de eluição por fluxo de gravidade.
  8. Concentrar os QDs recolhidos com uma coluna Centricon rotação (30 kDa). Armazenar estes MQDS a 4 ° C durante meses. Não freeze eles.
    Nota: Se uma pastilha de cor na parte inferior do tubo é visto, os pontos foram agregadas e são provavelmente já não utilizável.

2 Produção de Segmentação DNA (Benzylguanine-)

  1. Produzir ou adquirir DNA terminada em amina. Este protocolo utiliza a sequência 5'-NH2 - (CT) 10 - (CAGT) 5 -3 '(ver Tabela 1). O ligante poli-CT aumenta a acessibilidade a funcionalidade enterrado no glycocalyx mas pode não ser necessário para todas as aplicações. Se não há acesso a um sintetizador de DNA, produzir ADN modificado com amino usando um 5 'amino-modificador (5' apropriado amino-modificador C6).
  2. Dissolve-BG-N-hidroxissuccinimida (NHS-BG) em dimetilsulfóxido seco (DMSO) a uma concentração de 10 mg / ml.
    Nota: BG-NHS irá absorver a água a partir do ar e provocar a hidrólise do NHS-éster reactivo, em especial em solventes como DMSO hidroscópicos e dimetilformamida (DMF). BG-NHS é melhor lojad a -80 ° C como um pó no seu próprio frasco dentro de um recipiente contendo dessecante secundário. Aquece-se para a TA antes de abrir o frasco. Como alternativa, imediatamente aliquotar para uso único, o éster de NHS-BG num solvente polar seco e congelar a -80 ° C, ou de reagir totalmente com o ADN de amina no passo 2.2.
  3. Reagir misturando o BG-NHS em DMSO a partir do passo 2.1 com ADN terminada com amina em HEPES (4 (2-hidroxietil) -1-piperazinoetanossulfónico) tamponada (pH 8,5) de água. Num típico reagem 20 ul de 10 mg / mL de bG-NHS em DMSO com 2 mL de 2 mM de NH 2 - (CT) 10 - (CAGT) 5 em 58 mL de água desionizada tamponada com 20 uL de 0,5 M de HEPES pH 8,5. Realizar reações em um tubo de microcentrífuga de 1,5 ml. Misture rapidamente medida que a reacção prossegue rapidamente e deve competir com a hidrólise do NHS-éster.
  4. Sonicar durante 5-10 minutos para garantir a mistura completa. Incubar ~ 1 hora à temperatura ambiente. A razão estequiométrica de BG: ADN pode ser alterada para dirigir a reacção até ao fim.
  5. Purifica-se o BG-ADN que não reagiu a partir da amina-DNA por HPLC de fase inversa a execução de um de TEAA 100 mM: acetonitrilo (ACN) gradiente entre 8% e 95% de acetonitrilo ao longo de 30 min. O ADN-amina que não reagiu antes de se eluir o ADN-BG. Recolher a fracção de BG-ADN num tubo cónico.
    1. Use uma coluna C 18 Zorbax para a purificação de oligonucleótidos padrão e o gradiente seguinte:
      0 → 15 min: 8 → 30% ACN;
      15 → 21 min: 30-90% ACN;
      21 → 25 min: 90 → 8% ACN;
      25 → 30 min: 8% ACN;
  6. Congelar em nitrogênio líquido e liofilizar a fracção recolhida. Ressuspender o ADN em água desionizada. Para ser mais cautelosos, liofilizar mais duas vezes para remover TEAA residual. TEAA residual pode ser tóxico para células em concentrações mais elevadas.
  7. Ressuspender o BG-DNA liofilizado em água, certificando-se de lavar as laterais do the tubo, e diluir a ~ 25 mM estoque. Alíquotas e armazenar a 4 ° C. As amostras foram armazenadas durante 9 meses ~ sem degradação perceptível.

3. Labeling células vivas com monovalente Quantum Dots

  1. Opcionalmente, passivar os MQDS imediatamente antes de uma experiência de imagem, utilizando reagentes, tais como a caseína (0,5%) ou de albumina de soro bovino (BSA, 1-3%).
  2. Células da placa que expressam a proteína SNAP-marcado em total de fluorescência de reflexão interna (TIRF) vidro -quality. Neste experimento, usamos uma linha de células U2OS expressando um receptor Notch1 SNAP-marcados e superfícies de vidro de alta qualidade.
  3. Após as células terem ligado ao vidro (~ 24 horas), remover o meio de crescimento, lavagem com PBS, e incubar as células durante 10-30 min à temperatura ambiente em ~ 100-150 ul de PBS ou meio celular contendo 1 uM ~ BG ADN do passo 2.6 acima.
  4. Após a incubação com a BG, lava-se cuidadosamente as células com PBS ou meio celular. Incubar as células de ~ 5-10 min com the MQDS produzidos no passo 1.2.9 (e opcionalmente passivado na etapa 3.1).
  5. Opcionalmente, lavar os MQDS não ligados e devolver as células a um buffer / media adequado tanto de imagem e cultura. Para as células que estavam a ser trabalhada no modo TIRF, uma etapa de lavagem final foi muitas vezes desnecessários como MQDS não ligados em solução difundido tão rapidamente em comparação com MQDS vinculado como para não ser detectável durante a análise.

4. Microscopia e Análise

  1. Imagem as células usando um microscópio TIRF.
    Nota: O escopo deve ter excitação separáveis ​​e filtros de emissão, ou um filtro de cubo QD personalizado. QDs são mais animado com um laser de baixa comprimento de onda (405 ou 488 nm). QDs de diferentes diâmetros têm comprimentos de onda de emissão características, normalmente associada a uma grande mudança do Stoke.
  2. Por causa do brilho do MQDS, coletar imagens em altas taxas de quadros em TIRF enquanto a imagem do lado basal de uma célula viva.
    Nota: Como alternativa, dinâmica única molécula pode ser seguinwed outros planos focais, utilizando um microscópio confocal de disco giratório. Software de rastreamento de partícula única automatizada é geralmente bem sucedido em seguir com precisão os MQDS brilhantes e fotoestável.

Representative Results

A transferência de fase dos QDs de uma orgânica para uma fase aquosa é crítico para a produção de MQDS, mas pode ser tanto condicionamento e QD-específico. Transferência de fase na secção 1.1 deve aparecer tão limpo como os dois primeiros frascos na Figura 3. Se a transferência se parece mais com frasco 3, em seguida, deve-se tentar novamente com diferentes condições.

Uma vez que os QDs são revestidas com o DNA carregado negativamente devem migrar num gel separadamente dos QDs não enrolado. Utilizando uma aliquota de QDs desembrulhados como um controlo, um segundo banda de migração mais rápida deve aparecer no momento da adição do ptDNA, como visto na primeira gel na Figura 2B. A formação completa do MQDS é demonstrado com a perda da banda de imóveis, e o seu colapso na faixa móvel, como visto na última gel na Figura 2B. Se uma alíquota de seu produto MQD migra como uma única banda separáveis ​​dos QDs Sugerido, então seus MQDS são monovalentes e r eady para ser usado em passos adicionais.

Rotulagem celular deve ser específico para o alvo de sua escolha e deve ser dependente de níveis de expressão de proteínas e concentração MQD. Otimização empírica de ambos concentração MQD e MQD passivation é muitas vezes necessária para uma determinada aplicação. 4B demonstra a marcação das células U2OS que expressam um receptor Notch SNAP-marcado com MQDS variando em concentração de 0,5 nM e 10 nM.

Figura 1
Figura 1 direcionamento Modular de MQDS. MQDS hibridizam com ssDNA funcionalizada por várias moléculas alvo. Benzilguanina ligada alvos de ADN MQDS a SNAP-tag proteínas de fusão. Outras modificações 5 'e sequências de ADN que permitem que o direccionamento de MQDS para uma variedade de outras biomoléculas."target =" /files/ftp_upload/52198/52198fig1highres.jpg _blank "> Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2 Esquema para a produção de MQDS. (A) da fase orgânica QDs são transferidos para a fase aquosa por tratamento com mPEG tiol e TBAB, embrulhado com ptDNA e passivado com carboxi PEG6 alcano tiol. Imagens representativas TEM são QD545 orgânico, QD585 e QD605, respectivamente. (B) Um método para determinar empiricamente a estequiometria da interacção entre QDs ptDNA e no passo dois acima. QD & ptDNA estequiometrias são empiricamente verificado por densitometria de tal modo que a estequiometria final da reacção é de 1: 1 (QD: ptDNA). O número inicial de moles de ptDNA é multiplicado pela relação de QD: MQD, e ajustado pela af volume real ter conjugação para produzir o número de moles necessários para atingir 1: 1. conjugação Por favor, clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. detalhes experimentais para produção de MQDS. (A) fotos representativas de sucesso e falha de transferência de fase. QDs deve transferir visualmente entre a fase orgânica e densa da fase aquosa menos densa. Separação de fases indica incompleta pobre transferência. (B) ptDNA pode ser substituído por alcano-PEG-tiol. Dados gel Direito é representativa de uma reação em que uma fração significativa da ptDNA foram deslocados dos QDs devido ao excesso de passivação."target =" es.jpg _blank "> Clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4 proteínas Labeling SNAP-marcado em células vivas. (A) Esquema demonstrando a expressão, o apego e rotulagem de um receptor SNAP-identificado com o MQD BG-alvo. (B) rotulagem Representante de células que expressam a SNAP-Notch-mCherry construir em várias concentrações MQD. MQDS passivadas com PEG12 colocalize com mCherry indicando rotulagem específica. Menores densidades de rotulagem (<0,5 nM) são geralmente preferíveis para rastreamento única partícula. Barra de escala é de 10 m. Clique aqui para ver uma versão maior desta figura.

Discussion

A modularidade do design de MQD permite um maior grau de flexibilidade experimental. Por exemplo, uma variedade de MQDS podem ser rapidamente preparadas de cores únicas que permitem a gravação simultânea de múltiplos alvos. A seqüência de alvos ssDNA pode direcionar MQDS às proteínas, açúcares, lipídios e 12 superfícies 13. Um número de marcas enzimáticas estão disponíveis com reacções ortogonais, permitindo que múltiplos alvos a ser trabalhada em simultâneo com MQDS diferencialmente direcionados. Além de visar com a tag SNAP, rotulagem de proteínas-alvo com MQDS usando a tag CLIP, a tag HALO, e proteínas bioestanhados também foi bem sucedida. Este protocolo demonstra a marcação específica de um receptor de superfície de células vivas com estes MQDS, mas o protocolo pode ser facilmente adaptado a um certo número de diferentes contextos.

A visão metodológica significativa na produção MQDS com valência definido que é ~ 50-fosforotioato ligadoas bases são necessárias para envolver os QDs (e, assim, evitar que duas moléculas de ligação ao mesmo tempo). A poli-A seqüência S 50 reprodutível e estavelmente ligado 605 nm QDs da Life Technologies. Embora este produto foi descontinuado, a estratégia de exclusão espacial é generalizável a produtos similares de outros fornecedores com diferentes tamanhos, formas, propriedades espectrais.

A eficiência ea estabilidade dos QDs ptDNA-embrulhadas depende criticamente da química de superfície e estrutura dos QDs. Por conseguinte, o sucesso de um protocolo dependerá da estrutura química e fonte comercial de QDs. Para efeitos do presente protocolo, três grandes pontos de diferença existe entre as várias fontes comerciais de QDs: uma diferença de condições necessárias para a transferência de fase; uma diferença na força inicial de PEG-tiol-ligando de ligação, possivelmente impedir o deslocamento pelo ptDNA; e uma diferença na quantidade de núcleo exposto CdSe, que pode leanúncio para a extinção do QD pelo MPEG condições de transferência de fase tiol.

Como de publicação, QDs com a melhor estrutura para a produção de MQDS são 4-10 nm QDs CdSe / ZnS núcleo / invólucro adquiridos de Life Technologies, com espectros de emissão a 545, 585, 605 e 625 nm (Figura 2A). QDs baseados na formulação 'Viva "(545, 605, etc) extinguir por adição de mPEG tiol e não são adequados para esta aplicação. QDs de Aldrich e Oceano Nanotech funcionam bem, mas requerem etapas de transferência de mais de fase e pré-tratamento com óxido trioctilfosfina. Este protocolo foi otimizado para QDs de Life Technologies.

A sequência poli-A fosforotioato usado para embrulhar os QDs é encerrado com um rabo de DNA 20-mer nativa contendo a seqüência de (ACTG) 5 para que um fio de segmentação pode hibridizar. Esta sequência é conveniente, uma vez que tem pouca ou nenhuma estrutura secundária, e permanecerá hybridized, a 37 ° C em PBS. Se não há acesso a um sintetizador de DNA, o ptDNA pode ser sintetizado e, em seguida, purificado por meio de cromatografia líquida de alta eficiência de fase inversa (HPLC) utilizando uma coluna C 8. O ptDNA irá eluir mais tarde no HPLC de oligonucleótidos equivalentes com uma espinha dorsal nativa. Nós normalmente deixam o 5 'grupo protector DMT nos nossos oligonucleótidos fosforotioato após purificação.

Passivação das QDs ptDNA-embrulhados é geralmente necessária a fim de melhorar a estabilidade coloidal das QDs e reduzir a ligação de fundo para a maioria das aplicações experimentais. O protocolo utiliza um PEG-camada para passivar os QDs. Carboxi PEG tiol alcano com unidades de PEG adicional ((CO 2 H) CH 2 O (CH 2 CH 2 O) 12 C 11 H 23 SH, carboxi-PEG12 alcano tiol) fornece significativamente reduzida fundo, embora os mais longos PEGs são tanto maiores, e geralmente mais caros. MQDS revestidos com PEG carboxi Alkaligandos tiol ne são altamente estáveis ​​em tampões fisiológicos tais como fosfato tamponado salinas e meios de cultura. Armazenamento de longo prazo (> 8 meses) de MQDS a 4 ° C não mostrou agregação significativa ou ptDNA destacamento 11. Dependendo da experiência, a passivação de PEG QDs sozinho nem sempre suficientemente reduzir a ligação não específica das MQDS. A incubação de células e os dois MQDS em tampão fosfato salino (PBS) contendo 3% de BSA durante 20 min antes da utilização reduz substancialmente a ligação não específica de células, embora ele faz aumentar o raio hidrodinâmico aparente dos MQDS por ~ 50%. A passivação com 0,5% de caseína reduz a ligação não específica do mesmo, mas ainda aumenta o tamanho aparente de uma extensão maior do que o de BSA.

A extremidade 5 'de uma cadeia de ADN complementar às MQDS pode ser modificado para permitir a segmentação de uma série de diferentes biomoléculas. Há uma série de técnicas disponíveis estabelecidas para modificar covalentemente proteínas, lIPIDs e açúcares com ADN de cadeia simples (ssDNA). Enquanto o ADNcs é apresentada extracelularmente, é acessível a MQDS solúveis. MQDS com as sequências anteriores, irá hibridizar rapidamente com a sua cadeia de ADN complementar, em condições de cultura de células. Um 10-20x poli (CT) entre o espaçador ptDNA e a sequência de direccionamento pode ser necessária para a eficiente alvo, de modo a elevar a sequência de ligação acima do glicocálice espessura e de carga negativa da célula. Para este protocolo optou-se por produzir um DNA BG com uma sequência complementar de (CAGT) 5 que tanto hibridizada aos MQDS e covalente ligação-se a uma proteína SNAP-tag para marcação rápida e específica. Um protocolo semelhante também funções para acoplar outros ésteres NHS de oligonucleótidos modificados com amino.

Para uma única molécula de imagem, uma baixa densidade de rotulagem é normalmente necessária para resolver moléculas individuais. A concentração final da MQD ~ 0,5 nM em PBS com agente passivadoré um bom alvo. No entanto, essas diluições elevadas, por vezes, resultando em sub-marcação das células. Se isto ocorrer, MQD adicional pode ser adicionado até uma densidade óptima de rotulagem é observada. No caso de SNAP-etiquetado Notch1 humana, concentrações de> 10 nM MQD produzido células rotulagem densas enquanto 0,5 nM MQD resultou na ligação de ~ 20 MQDS na superfície basal da célula alvo (ver Figura 4B). Rotulagem celular com MQDS era altamente dependente da confluência das células plaqueadas. Excessivamente células confluentes não rotular, cujas superfícies basais.

Em resumo, um método simples para gerar monovalente e QDs modulares foi descrito. Estes MQDS encontrar utilidade na vasta gama de aplicações de imagem de células vivas, como demonstrado pela imagem do receptor Notch em células U2OS vivos. Aplicabilidade do MQDS não se limita a este caso particular, mas pode ser potencialmente prolongado por outros alvos celulares, tais como outras proteínas, ácidos nucleicos, e enzimas.

Acknowledgements

Financiamento concedido pelo DOD W81XWH-1023/10/01 (ZJG), concessão P50 GM081879 partir do Centro de UCSF de Sistemas e Biologia Sintética (ZJG), NIH 5R21EB015088-02 (YJ) e NIH 1R21EB018044 (ZJG & YJ). DS foi apoiado pelo Programa Fronteira Humana cruzada pós-doutorado disciplinar bolsa de pesquisa.

Materials

Name Company Catalog Number Comments
mQD Production
Phosphorothioate DNA:
(A*)x50-(ACTG)x5 IDT Most DNA Synthesis companies
Quantum Dots:
QDots 525, 585, 605 & 625 Invitrogen Q21791MP (545), Q21711MP (585), Q21701MP (605) Custom QD synthesis for QD625.
QD610 Ocean Nanotech QSP-610-10 
QD 610 lamda Aldrich 731854
Chloroform, 99.8% ACROS 67-66-3
Tetrabutylammonium bromide, 98.0% Sigma-Aldrich 426288
mPEG thiol [2,5,8,11,14,17,20-Heptaoxadocosane-22-thiol], MW 354.5, 95% Polypure 11156-0695
HSC11EG6CO2H  [HS-(CH2)11-(OCH2CH2)6-OCH2CO2H] ProChimia TH 003-m11.n6-0.1
Boric Acid, 99.5% Sigma-Aldrich B0394
Sodium Hydroxide, 99.0% ACROS S/4845
Sodium Chloride, 98% Sigma-Aldrich 310166
Agarose LE U.S. Biotech Sources G02PD-125
Ethanol Sigma-Aldrich 459828
BG-DNA Production
Amine DNA:
(CAGT)5-NH2 IDT N/A Most DNA Synthesis companies
(CAGT)5(T)40-NH2 IDT N/A Most DNA Synthesis companies
NHS-GLA-Benzylguanine New England Biosciences S9151
DMSO Sigma-Aldrich D8428
HEPES Buffer Sigma-Aldrich 83264
NAP5 Column GE Healthcare 17-0853-01
C18 Column
Acetonitrile
Mammalian Cell Culture & Imaging
Cell line expressing SNAP-tagged protein New England Biosciences E9100S
McCoys 5A UCSF Cell Culture Facility Specific to U2OS culture
Fetal Bovine Serum UCSF Cell Culture Facility Specific to U2OS culture
PBS UCSF Cell Culture Facility
Nunc Lab-tek II Chambered Coverglass Thermo-Fischer Scientific 155409
Matriplate 96-well plate Brooks Life Science Systems MGB096-1-2-LG-L
BSA
5% Alkali-soluble Casein EMD Millipore 70955 Not all caseins are the same
(Optional) DNA Synthesis Reagents
5’ Amine modifier C6 Glen Research Oct-06
dA-Thiophosphoramidite Glen Research 10-700
Analysis Software
FIJI http://valelab.ucsf.edu/~schindelin/
RyTrack.pro http://sun.iwu.edu/~gspaldin/rytrack.html
Tracker http://www.gartnerlab.ucsf.edu/more/software

DOWNLOAD MATERIALS LIST

References

  1. Sako, Y., Minoghchi, S., Yanagida, T. Single-molecule imaging of EGFR signaling on the surface of living cells. Nature Cell Biology. 2, (3), 168-172 (2000).
  2. Luo, W., He, K., Xia, T., Fang, X. Single-molecule monitoring in living cells by use of fluorescence microscopy. Analytical and Bioanalytical Chemistry. 405, (1), 43-49 (2013).
  3. Chung, I., et al. Spatial control of EGF receptor activation by reversible dimerization on living cells. Nature. 464, (7289), 783-787 (2010).
  4. Fernández-Suárez, M., Ting, A. Fluorescent probes for super-resolution imaging in living cells. Nature Reviews Molecular Cell Biology. 9, (12), 929-943 (2008).
  5. Sark, W. G. J. H. M., Frederix, P. L. T. M., Vanden Heuvel, D. J., Gerritsen, H. C. Photooxidation and photobleaching of single CdSe/ZnS quantum dots probed by room-temperature time-resolved spectroscopy. The Journal of Physical Chemistry B. 105, (35), 8281-8284 (2001).
  6. Pinaud, F., Clarke, S., Sittner, A., Dahan, M. Probing cellular events, one quantum dot at a time. Nature Methods. 7, (4), 275-285 (2010).
  7. Michalet, X., et al. Quantum dots for live cells, in vivo imaging, and diagnostics. Science. 307, (5709), 538-544 (2005).
  8. Howarth, M., et al. Monovalent, reduced-size quantum dots for imaging receptors on living cells. Nature Methods. 5, (5), 397-399 (2008).
  9. Iyer, G., et al. Aromatic aldehyde and hydrazine activated peptide coated quantum dots for easy bioconjugation and live cell imaging. Bioconjugate Chemistry. 22, (6), 1006-1011 (2011).
  10. Tikhomirov, G., et al. DNA-based programming of quantum dot valency, self-assembly and luminescence. Nature Nanotechnology. 6, (8), 485-490 (2011).
  11. Farlow, J., Seo, D., Broaders, K. E., Taylor, M. J., Gartner, Z. J., Jun, Y. W. Formation of targeted monovalent quantum dots by steric exclusion. Nature Methods. 10, (12), 1203-1205 (2013).
  12. Gartner, Z. J., Bertozzi, C. R. Programmed assembly of 3-dimensional microtissues with defined cellular connectivity. Proceeding of the National Academy of Sciences USA. 106, (12), 4606-4610 (2009).
  13. Selden, N. S., et al. Chemically programmed cell adhesion with membrane-anchored oligonucleotides. Journal of the American Chemical Society. 134, (2), 765-768 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats