Sistemik Bakteriyel Enfeksiyon ve Bağışıklık Savunma FENOTİPİ içinde

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Meyve Drosophila melanogaster bağışıklık savunma fonksiyonu ve evrim eğitimi için önde gelen model organizmaların biridir sinek. Doğuştan gelen bağışıklık birçok yönleri böcekler ve memeliler arasında muhafaza edilir ve Drosophila kolayca genetik ve deneysel manipüle edilebilir, çünkü onlar bağışıklık sistemi fonksiyonunu ve hastalığın fizyolojik sonuçlarını incelemek için güçlüdür. Burada gösterilen prosedür epitel engelleri ve savunma daha pasif formları atlayarak ve sistemik enfeksiyon odağı sağlayan doğrudan vücut boşluğuna bakterilerin getirilmesi ile sineklerin enfeksiyon izin verir. Prosedür ana ölüm sistemik patojen yükü ve konakçı bağışıklık sisteminin indüksiyonunun derecesinin ölçülmesi oranları için kuralları içerir. Bu enfeksiyon prosedürü, ucuz, sağlam ve kantitatif tekrarlanabilir ve fonksiyonel genetik, evrimsel yaşam öyküsü ve fizyoloji çalışmalarında kullanılabilir.

Introduction

Meyve sineği Drosophila Melanogaster'in, deneysel manipülasyon için son derece müsait olan ve geniş geliştirdi geniş bir bilim camiası tarafından desteklenmektedir fonksiyonu ve bağışıklık savunma. Drosophila evrimini ucuz ve arka kolay çalışmak için önde gelen model organizmaların biridir araştırma araçları dizisi. Doğuştan gelen bağışıklık birçok yönü Toll benzeri reseptörler ve NF-kB transkripsiyon faktörleri ailesinin, JAK / STAT sinyalleme ve JNK yolunun yanıtları neden olduğu sinyal iletimi dahil olmak üzere, böcekler ve memeliler arasında muhafaza edilir. 1,2, bu genler ve yolların olabilir işlevi D. sorgulanabilir melanogaster mutasyonlar kullanarak veya RNAi o artış veya azalış yolu faaliyetlerini hakemin 3 -. Ayrıca 6, Drosophila evrim yaşam öyküsü teorisi bağlamında da dahil olmak üzere, enfeksiyon ve hastalığın fizyolojik sonuçlarını incelemek için kullanılabilir 7..- 9 Bütün bu çalışmalar, güvenilir tanımlanan tedavi koşullarında deneysel sinekler bulaştırmak için becerisine bağlıdır. Burada açıklanan prosedür Drosophila melanogaster sağlam ve tekrarlanabilir bakteriyel enfeksiyonların teslim ve daha sonra enfeksiyon şiddetini ölçmek ve konak immün yanıtı ölçülmesi için bir metodolojik çerçeve sunmaktadır.

Drosophila doğal ve deneysel olarak, bakteri, mantar, virüs, nematod ve parazitoidi eşekarısı de dahil olmak üzere parazit ve patojenler, geniş bir yelpazede enfekte edilebilir. Geçerli protokol sistemik bakteriyel enfeksiyon sunmaya odaklanmıştır. Birçok farklı bakteri sinekler bulaştırmak için kullanılabilir ve deneycinin tercihi soruluyor kesin bilimsel sorulara dayalı olmalıdır. Örneğin, insan klinik izolatlar bu bakteriyel hastalık oluşturma mekanizmalarının 10 incelemek üzere kullanılabilir, veya ekolojik ilgili izolatları preferre olabilirEvrimsel çalışmanın d. 11 Bazı bakteriler D. yetkili patojenlerdir melanogaster, enfeksiyon üzerine çoğalan ve ev sahibi hastalık veya ölüme neden olur. Diğer bakteriler etkili bir konak bağışıklık sistemi tarafından yönetilen ve birkaç gün içinde temizlenir. Bu gösteri, Providencia rettgeri ana mortaliteye yol açarlar ve kalan ana devam etmektedir. Escherichia coli konakçı bağışıklık sistemi tarafından temizlenir olmayan bir patojen olarak kullanılacak bir proliferatif patojen olarak kullanılacaktır.

Enfeksiyon doğrudan sineğin vücut boşluğuna bakterilerin girişi ile kurulacaktır. Bu yaklaşım ne olursa olsun bulaşma doğal mod sistemik enfeksiyon soruşturma izin epitel engelleri ve koruyucu davranışları atlar. Deneysel olarak, sistemik enfeksiyon oluşturulması için iki temel yöntemden yararlanılmaktadır. İlk olarak, bir nanoinjector ve çekilmiş cam kılcal iğneleri bir tam sayısını enjekte etmek için kullanılırsinek içine bakteriler. Bu yöntem, enfeksiyon doz geniş bir dinamik aralık sağlayan ve kantitatif son derece tekrarlanabilir olma avantajları vardır. İkinci yaklaşım, bir septik Pinpirick enfeksiyonu sunmaktır. Bu yaklaşım, hızlı olmak ve hiçbir özel ekipman gerektiren avantajları vardır. Enfeksiyonlar kurulmuş sonra, sistemik patojen yükü, ev sahibi mortalite ve uyarılabilir bağışıklık sistemi aktivitesini ölçmek mümkün olur. Tabii ki, daha fazla fenotip herhangi bir sayıda makul enfekte D'de ölçülebilir enfeksiyon sonrası verimi 12, öğrenme yeteneği 13, metabolik durumu 14 veya hayal edilebilir neredeyse başka bir özellik de dahil olmak üzere melanogaster.

Protocol

1. toplayın ve Sinekler hazırlayın

  1. Arka D. İstenilen deneysel koşullarda melanogaster. Yetiştirme sırasında sinekler kalabalıklaştıracağı ve larva aşamasında çevresel koşullar derinden yetişkin aşamasında bağışıklık fenotipleri etkileyebilir çünkü larva yoğunluğu, tedavi boyunca tutarlı olduğundan emin olmak için özen gösterin. 15
  2. Pupa davadan eclosion sonra 3 gün ve taze ortama aktarmak - Deneysel sinekler 0 toplayın.
  3. Sonrası eclosion 7 gün - bunlar 5 arası kadar Ev istenilen bir sıcaklıkta toplanmıştır sinekler (22 ° C ve 28 ° C arasındaki sıcaklıklarda, genel olarak uygundur).
    NOT: Bu olgun yetişkin metamorfoz tamamlamak ve olmak sinekler için yeterli zaman verir, ancak yaşlanma başlamadan iyidir.
  4. Yine aşırı kalabalık önlemek için özen, enfeksiyon öncesinde ayrı bir şişenin içine sinek istenilen sayıda sıralayın.
    NOT: Sadece males bu gösteriye enfekte ancak açıklanan yordamı kullanarak kadın bulaştırmak eşit mümkün olur.

2. Kültür ve Bakteriler hazırlayın

  1. Enfeksiyona en az 2 gün önce seçilen bakterilerin ana kalıp hazırlayın. Şerit -80 ° C'de süresiz saklanan bir% 15 gliserol stokundan bir bakteridir. 2 haftaya kadar 4 ° C'de ana plaka saklayın. Dondurulmuş gliserol stokundan ana plakaları doğrudan Daima çizgi. Kültür tekrar geçit bakteri zayıflatılmış hastalık oluşturma etkisi gelişmeye neden olabilir, bir plakadan diğerine tamamen bakterilerin seri pasaj kaçının.
    Not: Bu örnek, Providencia rettgeri ve Escherichia coli kullanır.
  2. Enjeksiyon için bakteriyel süspansiyon hazırlamak için aşağıdaki yordamı kullanın.
    1. Ana plakadan izole tek bir koloni ile, steril bir ortam aşılayarak bir bakteri 2 mi kültür büyütün. Durağan faza bakteri büyütün (örn NOT: Her iki P. hafifçe çalkalanarak 37 ° C - rettgeri ve E. coli, 20 arasındaki sıcaklıklarda Luria Broth şekilde gelişmektedir.
    2. Kültür durağan fazı ulaştığı zaman, hafifçe yaklaşık hücreleri pelet. Bir masaüstü santrifüj (5000 xg'de 3 dk) kültürün 600 ul, supernatant atmak ve yaklaşık bakteri tekrar süspansiyon. Steril fosfat tamponlu tuzlu su içinde 1.000 ul (PBS; 137 mM NaCI, 2.7 mM KCI, 10 mM Na-2 PO 4, 1,8 mM KH 2 PO 4, pH = 7.4).
    3. 600 nm'de absorpsiyon olarak bir spektrofotometre ile ölçülmüştür kullanılan bakteri için uygun bir optik yoğunluk (OD) elde etmek için, steril PBS içinde yeniden süspansiyon haline getirilmiş hücreler seyreltilir. Sinekler bulaştırmak için bu süspansiyonu kullanın.
      NOT: 600 = 0.1 ya da 1.0 yaklaşık 10 8 ve 10 9 Providencia rettgeri veya E. sırasıyla karşılık ml başına E. coli. Her iki canlı Çünkünd ölü bakteri optik yoğunluk, bakteri cesetleri birikir önce erken durağan faz kültürleri hasat ve optik yoğunluk ve enfeksiyon esnasında katılan canlı bakteri sayısı arasındaki ilişki deforme etmek için önemlidir katkıda bulunur.

3. Sinekler bulaştırmak

NOT: Drosophila bağışıklık sirkadiyen ritim etkilendiği gibi, deneysel çoğaltır boyunca günün benzer bir anda enfeksiyonları gerçekleştirmek için önemlidir 16.

3.1), bir Nanoinjector kullanılması

  1. Enfeksiyon için cam iğneler hazırlayın.
    1. Bir mikropipet çektirmenin kullanarak borosilikat cam kapiller çekerek cam iğne hazırlayın.
    2. Yaklaşık 50 mikron çapında bir açıklık oluşturmak için iğne ucu kesiyorum, forseps kullanarak sıvının fırlamasını izin vermek.
  2. Enjektörü birleştirin.
    1. Sızdırmazlık O-ring ve ardından beyaz sp yerleştirinAcer, metal pistonu üzerine (büyük gamze dışa bakacak şekilde).
    2. 30 G iğne ile bir şırınga kullanarak mineral yağ ile cam iğne doldurun.
    3. İğnenin künt ucundan yaklaşık 1mm, tabanı etrafında geniş O-ring yerleştirin sonra halkasının içinden dolu cam iğne koyun ve.
    4. Metal piston üzerine iğne kaydırın ve güvenli dek halkasında vida yavaşça.
    5. Enjektörden mineral yağı en çıkarma, ama yine de enjektör ve bakteri süspansiyonu arasında bir bariyer olarak hareket etmek iğne yağ küçük bir hacim olduğundan emin olun. Hava mineral yağ veya bakteriyel süspansiyon içinde kabarcıklar, ya da iki sıvı arasında olduğundan emin olun.
    6. (9 nl 50 nl arasında) enjeksiyon için istenen hacme enjektörü ayarlayın.
  3. Kontrolleri yaralama oluşturun.
    1. Dikkatle medya ve PRESSI bir tüp içinde kılcal iğne ucu takarak steril PBS ile enjektör iğnesi doldurunenjektör üzerindeki "doldurmak" düğmesine ng.
      Not: Deney büyüme ortamı içinde süspansiyon haline getirilmiş bakteriler enjekte gerektiriyorsa steril bakteriyel büyüme ortamı da yaralama kontrol kullanılabilir. Bakteriyel büyüme ortamı bağışıklık sistemini uyarmak ya da ana bilgisayar üzerindeki diğer etkilere sahip maddeler içermektedir Ancak, örneğin PBS gibi bir atıl bir taşıyıcı tercih edilmektedir.
    2. CO 2 hafif akışı altında sinek istenilen sayıda Anesteziyoloji.
    3. Steril PBS ile ventrolateral yüzeyde ön karın sinekler enjekte edilir.
      Bu tür toraks sternopleural levha gibi diğer bölgelerde de sinekler enjekte edilmesi de mümkündür, ancak her bir deney içinde tutarlı enjeksiyon yerinde tutmak önemlidir 17: NOT.
    4. Tüm sinek kadar kendi taraflarında şişeleri döşeme, yeni ortam ile taze şişelere enjekte sinekler yerleştirin gıda yapışmış olmaktan uçar önlemek için anestezi kurtarıldı. <br /> Not: Aynı iğne her iki tedavi için de kullanılabilir, böylece deneysel sinekler bakteri enjekte etmeden önce PBS kontrol sinekler enjekte tavsiye edilir. Her zaman tüm deney için aynı iğne kullanmak mümkün olmayacaktır. Bu durumda, bu uçan hangi kullanılmıştır ve istatistiksel analiz deneysel bir faktör olarak, iğne kimliği dahil etmek için hangi iğne kaydetmek için arzu edilebilir.
  4. Bakteriyel patojen enjekte edilir.
    1. Enjektör kalan steril ortamı çıkarmak ve bakteri süspansiyonu ile aynı iğne doldurun.
    2. Şimdi prosedür 2.2 hazırlanan bakteri süspansiyonu ile sinekler enjekte yukarıdaki prosedürü (3.1.3), tekrarlayın.

3.2) Septik iğne batması ile

  1. Iğneleyici için iğne hazırlayın.
    1. 200 ul mikropipet ucu sonu eritin ve erimiş plastiğin içine 0,15 mm böcek minutien pimini takın. Plastik Herhangi yüzeylerin katılaşmaya izin verpin plastik uzanan piminin yaklaşık 0.5 cm ile yerinde tutulur CH.
  2. Kontrolleri yaralama oluşturun.
    1. CO 2 hafif akışı altında sinek istenilen sayıda Anesteziyoloji.
    2. Kanatlar ve bacaklar bağlanma siteleri kaçınarak, iğne ile toraks sternopleural plaka sinek Prick. Gerekirse hafifçe yumuşak forseps kullanılarak minutien pin sinekler çıkarın.
      NOT:. Karın manikür batıcı Böyle ventrolateral yüzeyinde ön karın gibi diğer bölgelerde de sinekler prick da mümkündür, ancak her bir deney içinde tutarlı enjeksiyon yerinde tutmak için önemlidir 17 daha olma eğilimindedir toraks batıcı ve bu nedenle daha az yaygındır daha zor.
    3. Tüm sinek kadar yan şişe döşeme, yeni sinek orta ile taze bir şişenin içine pricked sinekler yer olması gelen sinekler önlemek için anestezi kurtarıldıGıda yapışmış Geliyor.
  3. Bakteriyel enfeksiyon tanıtılması.
    1. CO 2 hafif akışı altında sinek istenilen sayıda Anesteziyoloji.
    2. Her sineği iğneleyici önce prosedür 2.2 hazırlanan bakteri süspansiyonu içine pimin ucu daldırma, her medya kontrolleri aynı yerde sinek Prick.
    3. Sinek tüm gıda yapışmış olmaktan uçar önlemek için anestezi kurtarıldı kadar yan şişe döşeme, yeni sinek orta ile taze bir şişenin içine pricked sinekler yerleştirin.

3.3) Bulaşıcı Doz Teslim değerlendirin

  1. Her bir buz üzerinde bir mikrosantrifüj tüpü içine sinek yerleştirin yerine sadece anestezi kurtarmak için gıda şişeye sinekler dönen, her iki yöntemle de 3.1 ya da 3.2, yukarıda tarif edildiği gibi sineklerin bir dizi Infect.
  2. Her tüpe PBS ul 250 ekleyin ve bir havan veya bir boncuk çırpıcı kullanarak sinek ya homojenize. </ Li>
  3. LB agar plaka üzerine Homojenat Plate, ya da spiral plater veya bir seri seyreltme kullanılmıştır.
    1. Seri seyreltme ile kaplamak için, bir 96 yuvalı plakanın birinci sırasındaki her bir uçucu Homojenat aktarın.
    2. PBS içinde 90 ul geri kalan her satır dolgunun.
    3. Bir çok kanallı pipet kullanarak, Homojenat sinek ve ikinci satıra dağıtmak içeren ilk satırdan 10 ul alır.
    4. Pipet yukarı ve aşağı en az 10 kez iyice karıştırın ve sonra 10 ul almak ve üçüncü sıra transfer. Kalan satırlar kullanarak bu işlemi tekrarlayın.
    5. Alt satırda (çoğu bakteri süspansiyonu sulandırmak) başlayarak, örnekler birbirini dokunmayın ayrı noktalar olarak dağıtılır özen LB plaka üzerinde her iyi ve mevduat 10 ul almak çok kanallı pipet kullanın. Tüm kuyular LB plaka üzerinde seyreltme azalan onları dağıtma, her satır örnekleme alınmıştır kadar tekrarlayın. Noktalar tamamen LB plakasına batırılmış kadar oda sıcaklığında plaka bırakın.
      NOT: Kullanmadan önce oda sıcaklığında bir kaç gün için LB plaka kurutma örnek noktalar arasındaki kazara temas şansını en aza indirmek, sıvı kolayca emilir sağlamak için tavsiye edilir.
  4. Koloniler küçük ve ayrık kalır böylece plakaları sarmak için özen, O / N inkübe edin.
    NOT: Kullanılan bakteri büyüme ortamı ve inkübasyon sıcaklığına bağlı olarak, sineğin endojen gut Mikrobiyota türetilen koloniler sonunda plaka üzerinde görünebilir. Bununla birlikte, patojen enfeksiyonu için kullanılan en bakteriler, 37 ° C'de LB agar bağırsak Mikrobiyota çok daha hızlı büyür.
  5. Deneysel bakteriler görünür koloniler büyüdü zaman inkübatör plakaları çıkarın (genellikle 8-12 saat), fakat Drosophila gut Mikrobiyota koloniler (yaklaşık 36 saat) görünmeden önce. Yavaş büyüyen deney bakteri için selektif bir kullanımıLB agar antibiyotik gut Mikrobiyota herhangi koloniler çıkarmak için.
  6. Her homojenatın için kolonilerin sayısını.
    1. Spiral plakalar, plaka üzerinde kolonilerin sayısı ve pozisyonuna göre homojenatın ml başına bakteri yükünü tahmin edebilirsiniz otomatik bir koloni sayacı kullanarak büyümeye kolonileri saymayın.
      Not: bakteri konsantrasyonu, ml başına 5 x 10 2 4 10 x 5, bakterilerin aralığında olduğunda spiral sayımları en doğru bulunmaktadır.
    2. Spot plakalar, manuel seyreltme 30 içeren hangisi her sinek için kolonileri saymayın - 300 koloni ve orijinal homojenatın ml başına bakteri sayısını hesaplamak.

Enfeksiyon 4. karakterize Kurtulanların

  1. Deney ölüm sonrası enjeksiyon.
    1. Bir 12:12 lig (25 ° C, taze şişelerde enfekte sinekler ve yaralı kontrolleri yerleştirin ve istenilen bir sıcaklıkta bir kuluçka makinesi içinde muhafazaht: karanlık döngüsü tavsiye edilir). 15'ten fazla yaşayan sinekler saymak zor olur gibi tek bir şişenin içine 15'den fazla sinek koymayın.
    2. Her gün canlı ve ölü sinekler sayısını, ya da daha sık uygunsa.
    3. Gıda kalitesini korumak düzenli aralıklarla yeni gıda sinekler çevirmek için.
      1. Flakon sadece erkekleri içeriyorsa, her üç günde bir, taze şişeleri aktarabilirsiniz. Flakon kadın içeriyorsa larva döl gıda sıvılaştırılması, çünkü yetişkin sinekler sıkışmış ve enfeksiyon nedeniyle ölüm abartılmıştır oranları sonuçlanan alabilirsiniz riskini artıran, her iki günde taze şişelere transfer.
  2. İstatistiksel verileri analiz.
    1. Bir birey, bir Log-Rank T kullanan çift-bilge karşılaştırmalar, geçmeyin sağkalım eğrileri için 18. Ölçülen zaman noktası sonrası enjeksiyon hayatta gerçekleştirmek olasılığını belirten Kaplan-Meier eğrisi gibi Plot sağkalım(ayrıca Mantel Cox Testi denir) ya da çeşitli faktörleri ve bunların etkileşimlerini dahil edebilirsiniz Cox Orantılı Tehlikeler Modeli kullanarak daha karmaşık analizler gerçekleştirmek est. Çapraz sağkalım eğrileri için, bir Cox analizi gerçekleştirmek. 17

5. Deney Bakteriyel Post-enfeksiyon yükleyin

  1. Bakteri yükünü ölçün.
    1. Bir reçete zaman enjeksiyon sonrası anda, enfeksiyon boyunca bakteri yükü belirlemek için bulaşıcı doz değerlendirmek için kullanılan prosedürü tekrarlayın (protokolü 3.3).
      Not: Spiral plater kullanılıyorsa bakteriyel süspansiyon, 1000 aralığında düşer, böylece, homojenatları seyreltik - 100,000 bakteri başına ml.
  2. Verileri analiz edin.
    1. Bakteriyel yük olmayan normal ise, daha iyi bir normal dağılım yaklaştığı veya non-parametrik istatistiksel analiz (örn Mann-Whitney U testi) kullanılarak verileri analiz etmek için verileri dönüştürmek ya. F Bir Box-Cox analizi kullanınOptimal dönüşümü ind; Doğal log veya üssün -10 günlük dönüşümler genellikle etkilidir. 19
    2. Veri yeterince normal dağılım ve tezat olan sadece iki tedaviler vardır varsa, iki farklı tedavi ortalama bakteri yükü neden olup olmadığını belirlemek için t-testi gerçekleştirin. Birden fazla deneysel değişkenler veya diğer potansiyel prediktif faktörler varsa, Varyans Analizi (ANOVA) bakteri yükünün önemli belirleyicileri olan faktörlerin belirlenmesi için kullanabilirsiniz. 19

Bağışıklık Sistemi Genler 6. Deney Transkripsiyonel Aktivasyon

  1. Kaba, daha önce tarif edildiği gibi, bir antimikrobiyal peptit geninden bir promotörün kontrolü altında, yeşil floresan proteini (GFP) ifade eden transjenik sinekler enfekte bir enfeksiyondan sonraki bağışıklık aktivasyonu görselleştirmek için. 18
  2. Bir floresan özellikli bir mikroskop altında enfekte sinekler görüntüle; GFP indüksiyon visib haline gelmelidirenfeksiyon sonrası 10 saat - ilk 6 içinde yağ vücutta le.
  3. Immün aktivasyon daha hassas ölçümü için, antimikrobiyal peptit gen transkriptlerinin bolluğu ölçmek için cDNA şablonu (qRT-PCR) ile ilgili kantitatif PCR kullanılır.
    Not: immün genlerin ekspresyonu (ya da daha önce) enfeksiyondan sonra herhangi bir zamanda ölçülebilir. Genel olarak, bir bağışıklık gen ekspresyonunun indüksiyonu, önümüzdeki 24 saat boyunca enjeksiyon ve artar sonra yaklaşık 4 saat başlar.
    1. CO 2 kullanarak sinek anestezisi.
    2. Her bir RNA ekstraksiyonu için bir mikrofüj tüpüne 15 sinekler yerleştirin.
      NOT: Her bir tedavi durumu için, en az üç kopya örnekleri toplamak için tavsiye edilir.
    3. Sinekler RNA ekstrakte ve standart prosedürler ve ticari kitler, bir dizi herhangi biri kullanılarak birinci sarmal cDNA üretir. -80 ° C'de saklayın RNA. Birkaç haftalık dönemler için -20 ° C de, uzun süreli depolama için -80 ° C'de saklayın cDNA. RNA ekstraksiyon öncesinde, mağaza f-80 ° C 'de yer almaktadır.
    4. Bir şablon olarak cDNA kullanılarak ilgilenilen hedef genlerin kantitatif PCR (qPCR) gerçekleştirin. Antibakteriyel peptid genlerinin diptericin A, dromomycin, defensin, Attacin A ve Metchnikowin yanı sıra (ayrıca rpL32 olarak da bilinir) oda temizliği kontrol geni rp49 yükseltmek için primer diziler için Tablo 1 'e bakın.
      NOT: antimikrobiyal peptidler diptericin A ve dromomycin kodlayan genler D. çok iyi readouts sağlamak sırasıyla, IMD ve Toll yollar aracılığıyla ağırlıklı olarak uyarılan bağışıklık aktivitesini melanogaster. Örnek-örnek RNA verimle varyasyon ve ters transkripsiyonun randımanını kontrol etmek amacıyla, ekspresyonu gibi rp49 (ayrıca RPL olarak bilinen enfeksiyon ile değiştirilebilir beklenmemektedir referans ev bakıcısı geni karşı, hedef genlerin ekspresyonunu kaydedilen standart 32).
    5. Verileri analiz edin. <ol>
    6. Ifade farklılıkları kaba yaklaşım için, deney geninden elde edilen başlangıç ​​miktarı (SQ) değerin oranını hesaplamak (örneğin, diptericin A) referans gen elde edilen SQ değerine göre (örneğin, rp49) Her numune için (olarak hesaplanmıştır SQ - DPTA / SQ - rp49). Böyle bir bulaşmamış kullanım kontrolü gibi temel bir kontrol tedavisine bu oranları Ölçeğe. Keyfi 1.0'a eşit kontrol ifadesi düzeyini ayarlamak ve göreli kat değişiklikleri gibi deneysel tedaviler görselleştirmek. Bilinen-miktar cDNA'nın bir seyreltme serisi oluşturulan standart bir eğriye karşı her bir gen için SQ değeri tahmin ediyoruz.
      NOT: oranların istatistiksel analizi karmaşık olabilir, bu nedenle bu yaklaşım titiz analiz için daha hızlı yakınlaştırılması için daha hayırlıdır. PCR verimliliği düşükse, eğer mümkünse PCR kinetik geliştirmek için yeni primerler dizayn. Mükemmele yakın verim (reklam ile QPCR reaksiyonlar içinPCR ürünü, her çevrimi) oubling eşik döngüsü (CT) SQ değeri için ikame edilebilir.
    7. En iyi şekilde verimli yükseltme basit deneyler için, veriler ΔΔC T yöntem kullanılarak analiz edilebilir. 19, her bir örnek için, Test geninin C T (örn., Diptericin referans geninin CT değeri (örneğin, rp49) çıkarma A) ΔC T elde edilir. Daha sonra her bir örnek için ΔΔC t değeri elde etmek için her deney numunesi için ΔC T bazal kontrolü ΔC T çıkarma; Bu ΔΔC T 2 (-ΔΔCT) ifade kat değişimi yaklaşık olarak tedaviler arasında gen ekspresyonu seviyelerinde göreli farklar göstermektedir.
      NOT: hedef genin ifadesinde bu analiz misestimate kötü olabilir kat değiştirme sınama gen ya da referans ya PCRGen düşük verimliliğe sahiptir.
    8. En titiz analiz için, yanıt değişkeni olarak deney geninin (örn diptericin A) tahmini ifade ve açıklayıcı değişken olarak kontrol geni (örn rp49) ve diğer deneysel faktörler tahmini ifadesini kullanarak varyans (ANOVA) analizi yapmak.
      NOT: Bu yaklaşım PCR amplifikasyonu verimsizlik nispeten sağlam ve daha karmaşık deneysel tasarımlar analiz sağlar.

Representative Results

Bu bölüm 1 enfeksiyonu doz enjeksiyonu için kullanılan bakteriyel süspansiyonun optik yoğunluğu ile değişir göstermektedir. Drosophila melanogaster bakteriyel enfeksiyon sonrası elde edilebilir sonuçları göstermektedir ve güvenilir bir şekilde Homojenizasyon ve kaplamanın tahmin edilebilir verilen doz enjekte edilmesinden hemen sonra uçar . Şekil 2'de gösterildiği gibi, farklı patojenlerin doza bağlı (Şekil 2B) olabilir ana ölüm (Şekil 2A) ve ana ölüm farklı seviyelerde neden olabilir. Daha da önemlisi, bu protokol enfeksiyonlar farklı elde edilmesi sağlar: Providencia rettgeri 20 gün veya daha uzun (Şekil 3A) için devam kronik alt öldürücü enfeksiyona neden olabilir. Ancak, Escerichia coli gibi diğer bakteriler çoğunlukla altı saat sonrası enfeksiyon (Şekil 3B) içinde konak sinek tarafından silinecektir. Bağışıklık sys indüksiyonuTEM antibakteriyel peptit transkript (Şekil 4A ve B) ve RNA izolasyonu ve daha sonra QRT-PCR ile tahmin edilebilir. Benzer şekilde, ancak daha az kantitatif antimikrobiyal peptit gen promoteri kontrolü altında GFP eksprese eden bağışıklık sistemi (Şekil 4C) uyarılmasını görselleştirmek için kullanılabilmektedir sinekler.

Şekil 1
. Şekil 1: Enfeksiyon Doz belirleme Sinekler optik yoğunluklar (0,0001-0,05) içindeki bir kapsayan bakteriyel süspansiyonlar 50 nl enjekte edilmiştir. Sinekler hemen homojenize edildi ve enjeksiyon tarafından tanıtıldı bakteriyel sayısını belirlemek için kaplama. İlk bakteriyel yük kuvvetle ilk OD enjekte ile ilişkilidir (r 2 = 0.96)

Şekil 2,
(A) doğal tip sinekler, üç farklı türden biri yaklaşık 5000 bakteri enjekte edilmiştir. ev sahibi mortalite oranı enfeksiyonu için kullanılan bakteri türlerinin büyük ölçüde bağlıdır. 50, 500 ve sinek başına 5000 bakteri - (B) Vahşi tip sinekler Enterococcous faecalis, üç farklı dozda enjekte edilmiştir. Bir bağışıklık sistemi mutant ve yabani tip izojenik kontrol çizgisi yaklaşık 500 Burkholderia cepacia enjekte edildi yüksek bulaşıcı doz (C) ile enfekte olduğunda Sinekler daha hızlı ölür. Bir ikili Log-Rank karşılaştırma yabani tip sinek mutantından önemli ölçüde daha iyi enfeksiyonu (χ 2 = 59.02, df = 1, p <0.0001) hayatta olduğunu göstermektedir.


Şekil 3:. Enjeksiyon Sinekler sonra Bakteriyel Yük yaklaşık (A) 5000 P. enjekte edildi rettgeri (B) 3.400 E. E. coli. Bakteriyel yük, enjeksiyondan hemen sonra ve çeşitli sonraki zaman noktalarında belirlendi. Her bir veri noktası tek bir sinek bakteri yükünü temsil eder. E. coli hızla P. ise meydan konakçılardan temizlenir rettgeri ev sahibinin hayatının geri kalanı için devam ,.

Şekil 4,
Şekil 4: Enjeksiyon sonrası bağışıklık geninin ifadesinin indüksiyonu. (A), sinekler, P. 50 nl enjekte edilmiştir karın veya göğüs ya rettgeri veya steril PBS, ya da CO kenara unmanipulated kalmıştı bir gen QRT-PCR kullanılarak belirlenmiştir diptericin RNA izolasyonu ve ekspresyonu için toplanmıştır. (A) bir ifade seviyesi diptericin oranı olarak rp49 transkriptine bir transkript grafik haline ve n, (CO2 kontrol çubukları her bir durum ile ilgili oranların ortalamasını ve standart sapmasını temsil eder: 1. bir ifade seviyesine sahip olarak tanımlandığını gibi ölçekli = 4). (B) İfade seviyeleri standart indüklenmemiş koşulu olarak kullanılan CO2 aesthesia kontrol sinek ortalama C T değeri 2 ΔΔCT olarak grafikle. çubukları her bir durum ile ilgili ΔΔC T ortalama ve standart hatayı temsil eder (n = 4). Nedeniyle enjeksiyon sitesine transkript indüksiyon herhangi bir fark olsa da, paneller A ve B karşılaştırmalı ΔΔC T yöntemi potansiyel indüksiyonu seviyeleri olduğundan fazla olabilir gösterir. (Cı) Bir promoter P. 50 nl enjekte edilmiştir diptericin kontrolü altında GFP ifade Sinekler rettgeri (OD = 0.1) ve daha sonra 7 gün sonra görüntülenmiştir. GFP paneli diptericin aktivasyonunu bir bakteriyel enfekte sinekler promotör ancak medya-enjekte denetimleri gösteren, enfekte sineklerin abdominal yağ vücutta GFP ifadesini gösterir.

Gen Ileri Ters
rp49 (ayrıca rpL32 olarak da adlandırılır) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin A 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Dromomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin A 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

Tablo 1: Mah-PCR için astar boyalar.

Discussion

Burada açıklanan prosedür Drosophila melanogaster titiz ve kaliteli enfeksiyonu verir. resimli örnekler öncelikle Providencia rettgeri ve E ile enfeksiyon üzerinde duruldu E. coli, ancak protokol adapte edilebilir ve ana yetiştirme ve bakım koşulları aralığında, çeşitli bakterilerle enfeksiyon uygulanabilir.

optimal deney yaklaşımının detayları enfeksiyonu için kullanılan bakteri, ev sahibi genotip, ve genel olarak deneysel koşullara bağlı olacaktır. Kuvvetle yeni deney koşulları daha iddialı projeler başlatmadan önce pilot uygulaması tavsiye edilir. İyi bir başlangıç ​​noktası, bir 100-kat aralığında üç enfeksiyon dozlarda test etmektir. Sinek başına 100 bakteri hücreleri - Son derece öldürücü patojenler genellikle en iyi 10 mertebesinde, çok düşük bulaşıcı dozlarda tanıtıldı. Daha ılımlı patojenler fl başına yaklaşık 1000 bakteri yüksek dozlarda enjekte edilebiliry ve olmayan patojenler sinek başına 10,000 bakteri gibi yüksek dozlarda enjekte edilebilir. Bu uzunlamasına zaman serisi üzerinde patojen yükü, ev sahibi mortalite ve bağışıklık sistemi aktivitesini takip ederek yeni enfeksiyonların kinetik tanımlamak için genellikle öğreticidir. Patojen yükü ve bir ev sahibi gen ifadesinin ölçümü tahrip edici deneyler olduğundan, ölçülecek her bir zaman noktası için, deneyin başlangıcında ayrı sinekler enfekte gereklidir.

Iğne veya microcapillary tabanlı enjeksiyon kullanmaya karar verirken, bu avantajları ve sınırlamaları her yaklaşımın var dikkat etmek önemlidir. Kılcal püskürtme hem de sınırlı bir turgor basıncını arttırır ve bunların tuzları ya da süspanse edilmiş veya taşıyıcı madde içinde çözülmüş olan diğer molekülleri sunar sinek içine bir sıvı hacmi getirmektedir. Kılcal enjeksiyonu da gerekli ekipmanların bir enjeksiyon tesisi veya satın alma erişim gerektirir. Septik iğne hiçbir özel ekipman ve tanıtır gerektirirönemsiz sinek içine medya ve tipik sinek çok sayıda bulaştırdıkları daha verimlidir. Ancak, iğne enfeksiyonlar kılcal enjeksiyonu ile elde edilebilir enfeksiyon dozu üzerinde hassas kontrol izin vermez. Mevcut protokol mekanik enjeksiyon hacmi düzenleyen bir enjeksiyon cihazının üzerinde duruldu, ancak basınçlı hava ayrık bakliyat dayalı enjeksiyon sistemleri de vardır. 20,21 Bunlar genellikle cihaz burada özellikli daha pahalı ve her hava darbesinin kalibrasyon gerektiren sırayla iğne tutarlı enjeksiyon hacimleri sağlamak.

Sinekler vahşi bakteri sistemik enfekte nasıl önemli bir tartışma ama çok az veri bulunmaktadır. Bazı araştırmacılar, Drosophila patojenik bakterileri sindirdiğimizde Doğal enfeksiyon çoğunluğu meydana gelen ve bakteriler, daha sonra, sistemik enfeksiyona neden gut kaçış mümkün olduğunu varsaymak. Bununla birlikte, fe ait vardırBilinen w bakteriler D. gut geçmeye muktedir melanogaster ve bu yeteneği var o sinekler 22,23 son derece ölümcül olan. Alternatif bir teori başarısız avlanma girişimleri veya ektoparazitik akarları saldırısından kaçış yoluyla cuticular yaralanmaları sürdürmek düzenli uçar olmasıdır. Bu hipotez, vahşi D. sık koleksiyon tarafından desteklenmektedir iyileşmiş yaralar (yayınlanmamış gözlemler) göstergesidir melanizm noktalar taşıyan melanogaster. Akarlar Drosophila 24 bakteriyel enfeksiyonları iletmek gösterilmiştir ve akarları bıraktığı yaralar ikincil bal arılarının 25 bakteriler tarafından enfekte olabilir. Bununla birlikte, D. tahrik akarlara ya da başka fırsatçı enfeksiyon doğada frekansı manikür ihlalleri ile melanogaster bilinmemektedir. Burada açıklanan protokol doğrudan herhangi bir epitel engelleri ya da davranışsal immu atlar nicel enjeksiyon yoluyla hemolimf içine bakterilerin girişini izin verirdilmekte. D. patojenik bakterilerin beslenmesi için yöntemler melanogaster Vodovar ve ark., 22 ve nehme ve ark., 23 tarif edilmiştir.

Birçok Entomopatojenik bakteri araştırmacı rahatça onlarla çalışmak için izin, az veya hiç insan sağlığı risk oluşturmaktadır. Ayrıca, çok az bakteri deneysel müdahalesi olmadan temas Drosophila bulaştırmak kapasitesine, böylece kirlenmiş yüzeyler aracılığıyla bir laboratuvar ile bakteriyel enfeksiyon "salgın" yayılma riskini ya da genel olarak çok düşüktür sinekler kaçtı. Bununla birlikte, yeterli muhafaza önlemler kaçmasını enfekte sinekler önlemek için ve herhangi bir sinekler kaçan recapturing için olduğundan emin olmak için tavsiye edilir. Laboratuvar kullanılan patojenlerin bununla orantılı bir biyolojik güvenlik seviyesinde donanımlı olmalıdır ve mikrobiyoloji standart en iyi uygulamaların istihdam edilmelidir.

Deneysel infectiBurada tarif edilen yöntem ile ilgili herhangi bir keyfi bakterinin bir dozu ile Drosophila melanogaster enfeksiyonları sağlar. Enfeksiyon bir kez kurulduktan sonra, bu bakteriyel proliferasyonu veya açıklık kinetiklerini ölçmek için ana ölüm izlemek için ve konakçı bağışıklık sisteminin indüksiyonunun tahlil edilmesi basittir. Enfekte sineklerin kolayca şekil ya da enfeksiyonu ile şekillendirilecek fizyolojik fonksiyon testleri de dahil olmak üzere diğer fenotipik tahlillerine tâbi tutulabilir. anlatılan prosedürler, ucuzdur nispeten az özel ekipman gerektirir ve kolayca araştırma ve eğitim laboratuarları bir genişliği boyunca çeşitli projelerde kullanılmak üzere onları mükellef hale öğrenilir.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics