Adenovirus संक्रमित सामान्य मानव कोशिकाओं से वायरल प्रतिकृति कम्पार्टमेंट समृद्ध उप-परमाणु भागों का अलगाव

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:


Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hidalgo, P., Gonzalez, R. A. Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells. J. Vis. Exp. (105), e53296, doi:10.3791/53296 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.



Adenoviruses संक्रमित कोशिका के नाभिक में replicates एक डबल असहाय डीएनए जीनोम होते हैं। वायरल डीएनए नाभिक में प्रवेश करती है, यह पीएमएल परमाणु निकायों 1 से सटे localizes। वायरल जल्दी जीन अभिव्यक्ति के बाद परमाणु वास्तुकला नाटकीय रूप से कहा जाता है, वायरल microenvironments के गठन के उत्प्रेरण, पुनर्गठित किया है वायरल प्रतिकृति डिब्बों (आरसी) 2। एडीनोवायरस (विज्ञापन) आर सी वायरल जीनोम प्रतिकृति और वायरल देर जीनों की अभिव्यक्ति जगह ले जहां साइटों रहे हैं, वे इन प्रक्रियाओं में भाग लेने कि सभी आवश्यक वायरल और सेलुलर कारकों की भर्ती के लिए एक वातावरण प्रदान करते हैं। दिलचस्प है, इस तरह के डीएनए की क्षति की प्रतिक्रिया के रूप में सेलुलर एंटीवायरल प्रतिक्रिया के लिए जिम्मेदार सेलुलर प्रोटीन की एक किस्म, सहज प्रतिरक्षा प्रतिक्रिया और ट्यूमर दमन सहयोजित इन वायरल साइटों से 2 हैं। समन्वित रूप से विनियमित करने, जबकि कुशल वायरल प्रतिकृति को बढ़ावा देने कि इसलिए, विज्ञापन आरसी माना जा सकता है विनियामक केन्द्रोंइन संरचनाओं वायरस मेजबान सेल बातचीत की समझ के लिए महत्वपूर्ण हैं यह दर्शाता है कि सेलुलर एंटीवायरल प्रतिक्रिया,। फिर भी, आर सी के गठन के आणविक तंत्र, उनकी संरचना और संबद्ध गतिविधियों खराब समझ रहे हैं।

नाभिक में दोहराने कि अन्य डीएनए वायरस से adenoviral आरसी, साथ ही आर सी साइटोप्लास्मिक आर सी 3 के विपरीत, झिल्ली के लिए नहीं जुड़े रहे हैं। इसके अलावा, इन वायरस प्रेरित संरचनाओं प्रोटीन और न्यूक्लिक एसिड की पूरी तरह से बना होने की संभावना है। आरएनए वायरस से संक्रमित कोशिकाओं में गठित आर सी अपने विस्तृत रूपात्मक, कार्यात्मक और जैव रासायनिक लक्षण वर्णन 4 में मदद की है, जो उनके साइटोप्लास्मिक स्थानीयकरण और झिल्ली बाध्य स्थिति का लाभ लेने, पृथक किया गया है (आमतौर पर वायरल कारखानों कहा जाता है)।

हमारे ज्ञान करने के लिए, परमाणु वायरल आर सी शायद कारण intranuclear मीटर की परमाणु वास्तुकला और अभाव की जटिलता के लिए, अलग-थलग नहीं किया गया हैउनके अलगाव की सुविधा होगी कि embranes। उनके अध्ययन के बजाय immunofluorescence माइक्रोस्कोपी, मछली और संचरण इलेक्ट्रॉन माइक्रोस्कोपी पर भरोसा है। हालांकि, subnuclear संरचनाओं को अलग-थलग करने के लिए निहित जटिलताओं के बावजूद इस तरह के nucleoli और Cajal निकायों के रूप में अन्य परमाणु डोमेन 5,6 से पहले अलग-थलग कर दिया गया है। Nucleoli और आर सी दोनों प्रोटीन और न्यूक्लिक एसिड से बना है, और 0.5 के बीच एक व्यास कर रहे हैं के बाद से - 5 माइक्रोन, हम आर सी भी अलगाव के लिए उत्तरदायी होना चाहिए कि धारणा। इसलिए, और अधिक ठीक आर सी के लिए जुड़े आणविक संरचना और कार्यों को चिह्नित करने के क्रम में, हम आर सी के साथ समृद्ध subnuclear अंशों को अलग-थलग करने के लिए एक उपन्यास विधि की स्थापना की। यह अंत करने के लिए, हम nucleoli 7 या अन्य परमाणु डोमेन के 6 अलग करने के लिए इस्तेमाल किया प्रक्रियाओं के समान वेग ढ़ाल और सुक्रोज तकिये का उपयोग करके उप-परमाणु अंशों तैयार किया है और आणविक संरचना के अध्ययन और संबंधित गतिविधियों की अनुमति देता है कि एक सेल मुक्त प्रणाली की स्थापनाआर सी। इस तकनीक को इसलिए वायरस मेजबान सेल बातचीत की समझ अग्रिम और भी नाभिक में दोहराने कि अन्य वायरस से आर सी का विस्तृत विश्लेषण की सुविधा और adenovirus- में गठन उन लोगों के लिए इसी तरह के आयामों की प्रतिकृति डिब्बों के गठन को प्रेरित करना चाहिए कि एक शक्तिशाली उपकरण का प्रतिनिधित्व करना चाहिए इस तरह, herpesviruses, papillomaviruses या polyomaviruses के रूप में संक्रमित कोशिकाओं,।

Subscription Required. Please recommend JoVE to your librarian.


1. HFF सेल संस्कृति और विज्ञापन-संक्रमण

  1. पहले 8 के रूप में वर्णित HFF कोशिकाओं पर फ्लोरोसेंट गठन इकाइयों (FFU) के रूप में HEK 293 कोशिकाओं और अनुमापांक के monolayers में AD5 गुम्मट वायरस प्रचार।
  2. एक humidified इनक्यूबेटर में DMEM / 10% भ्रूण गोजातीय 37 डिग्री सेल्सियस पर बाँझ संस्कृति 100 मिमी बर्तन में सीरम (FBS) और 5% सीओ 2 के 10 मिलीलीटर में मानव चमड़ी fibroblasts (HFF) आगे बढ़ें। चार 16 वर्ग सेटों में कोशिकाओं की गिनती से एक Neubauer कक्ष का उपयोग सेल संख्या निर्धारित है। मिलीलीटर प्रति सेल नंबर चार में 16 वर्ग सेटों में कोशिकाओं की औसत संख्या की गणना और 10 4 से इस संख्या से गुणा करके प्राप्त की है। 1.3 चरण में शामिल हर बार के बाद संक्रमण के लिए, 1 10 x 7 HFF कोशिकाओं का उपयोग करें।
  3. मॉक संक्रमित इकाई के गठन 30 फोकस के MOI में पकवान प्रति DMEM में AD5 के 1 मिलीलीटर का उपयोग कर 100 मिमी टिशू कल्चर बर्तन में एडीनोवायरस प्रकार 5 (AD5) जंगली प्रकार (डब्ल्यूटी) (H5pg4100 8) के साथ HFF कोशिकाओं को संक्रमित, या FFU या सेल प्रति। आह में 2 घंटे के लिए सेतेध्यान से व्यंजन हर 15 मिनट कमाल umidified 37 डिग्री सेल्सियस पर सेल संस्कृति इनक्यूबेटर और 5% सीओ 2, कोशिकाओं पर वायरस inoculum के सजातीय वितरण सुनिश्चित करने के लिए। इस समय के बाद, मध्यम हटाने और जोड़ने के 10% FBS के साथ पूरक ताजा DMEM और सीओ 2 37 डिग्री सेल्सियस पर एक humidified सेल संस्कृति इनक्यूबेटर में 16, 24 या 36 घंटे के लिए सेते और 5%। 2.1 कदम आगे बढ़ें।

Adenovirus आर सी से समृद्ध उप-परमाणु भागों की 2. तैयारी

  1. हार्वेस्ट AD5 संक्रमित या एक सेल स्क्रेपर के साथ नकली संक्रमित HFF कोशिकाओं और बाँझ अपकेंद्रित्र ट्यूब में कोशिकाओं को इकट्ठा। 1.2 चरण में के रूप में सेल संख्या निर्धारित है। 1.3 चरण में निर्दिष्ट प्रत्येक समय के बाद संक्रमण के लिए 1 10 x 7 कोशिकाओं का प्रयोग करें।
  2. 220 XG, 5 मिनट के लिए 4 डिग्री सेल्सियस पर कोशिकाओं अपकेंद्रित्र।
  3. ठंडा पीबीएस में सेल गोली Resuspend (137 मिमी NaCl, 2.7 मिमी KCl, 10 मिमी ना 2 4 HPO और 1.8 मिमी के.एच. 2 4 पीओ)। धो सेल गोलीएस धोने प्रति ठंडा पीबीएस के 5 मिलीलीटर का उपयोग कर 3 बार। इस प्रयोजन के लिए सेंट्रीफ्यूज 220 XG, 5 मिनट, छानना के लिए 4 डिग्री सेल्सियस पर कोशिकाओं और सतह पर तैरनेवाला (एस एन) त्यागें, और कोमल pipetting द्वारा सेल गोली resuspend।
  4. प्लाज्मा झिल्ली को बाधित करने के लिए, 700 में सेल गोली ठंडा hypotonic बफर के एल (10 मिमी HEPES पीएच 7.9, 10 मिमी KCl, 1.5 मिमी 2 MgCl, 0.5 मिमी डीटीटी, 20 μ जी / मिलीलीटर phenylmethylsulfonyl फ्लोराइड (PMSF) μ resuspend 10 μ जी / एमएल गोजातीय अग्नाशय trypsin अवरोध, 10 μ जी / मिलीलीटर pepstatin ए और 10 μ जी / एमएल एन -acetyl एल leucyl एल leucyl एल सहित सिस्टीन, सेरीन, threonine और aspartyl प्रोटीज अवरोधकों का एक मिश्रण -argininal) और कोशिकाओं 3 घंटे के लिए बर्फ पर प्रफुल्लित करते हैं।
  5. Lyse एक ढीले ढाले एक प्रकार Teflon मूसल के साथ एक homogenizer का उपयोग कोशिकाओं। स्ट्रोक और उज्ज्वल क्षेत्र माइक्रोस्कोपी द्वारा हर 20 स्ट्रोक सभी कोशिकाओं lysed कर दिया है कि यह सुनिश्चित करने के लिए निगरानी के नमूने Dounce 80 प्रदर्शन करना है, लेकिन नाभिक n है किक्षतिग्रस्त या उठी किया ओ.टी.।
  6. 300 XG, 5 मिनट के लिए 4 डिग्री सेल्सियस पर सेल homogenate अपकेंद्रित्र। एक अपकेंद्रित्र ट्यूब में -20 डिग्री सेल्सियस पर cytoplasmic अंश के रूप में एसएन स्टोर।
  7. समाधान 1 (एस 1) के 750 μ एल (में resuspend, नाभिक से गोली सेलुलर मलबे को हटाने के लिए 0.25 एम सुक्रोज, 10 मिमी MgCl 10 सहित 2 20 μ जी / मिलीलीटर PMSF, सिस्टीन, सेरीन का एक मिश्रण threonine और aspartyl प्रोटीज अवरोधकों μ जी / एमएल गोजातीय अग्नाशय trypsin अवरोध, 10 μ जी / मिलीलीटर pepstatin ए और 10 μ जी / एमएल एन -acetyl एल leucyl एल leucyl एल argininal) और समाधान 2 के एक बराबर मात्रा से अधिक परत (S2) (0.35 एम सुक्रोज, 0.5 मिमी 2 MgCl, 20 μ जी / मिलीलीटर PMSF, सिस्टीन, सेरीन, 10 μ जी / एमएल गोजातीय अग्नाशय trypsin अवरोध, 10 μ जी / मिलीलीटर pepstatin ए और 10 μ सहित threonine और aspartyl प्रोटीज अवरोधकों का एक मिश्रण ग्राम / मिलीलीटर एन -acetyl एल leucyl एल leucyl एल argininal)। Centr1400 XG, 5 मिनट के लिए 4 डिग्री सेल्सियस पर ifuge।
  8. एक micropipette का उपयोग एसएन त्यागें। गोली परेशान करने से बचें।
  9. एस 2 के 750 μ एल में पृथक नाभिक युक्त गोली Resuspend।
  10. एडीनोवायरस आर सी (आरसीएफ) के साथ समृद्ध subnuclear अंशों को अलग-थलग करने के लिए, दो 5 मिनट दालों का उपयोग, एक अल्ट्रासोनिक स्नान के साथ नाभिक resuspended sonicate, या उज्ज्वल क्षेत्र माइक्रोस्कोपी द्वारा मनाया के रूप में सभी नाभिक lysed रहे हैं जब तक। सी में या 4 डिग्री नीचे नमूने रखने के लिए जरूरत के रूप में अल्ट्रासोनिक स्नान में बर्फ का प्रयोग करें।
  11. समाधान 3 (S3) 3,000 XG पर (0.88 एम सुक्रोज, 0.5 मिमी 2 MgCl) और सेंट्रीफ्यूज, 10 मिनट के लिए 4 डिग्री सेल्सियस के एक बराबर मात्रा से अधिक sonicated नाभिक परत। -70 डिग्री सेल्सियस पर nucleoplasmic अंश (एनपीएल) के रूप में 1.5 मिलीलीटर सतह पर तैरनेवाला स्टोर। -70 डिग्री सेल्सियस पर आरसीएफ के रूप में एस 2 के 700 μ एल में गोली और दुकान Resuspend।

आरसीएफ का 3. वेस्टर्न ब्लाट विश्लेषण

नोट: एनपीएल और आरसीएफ अंशों एस के पश्चिमी धब्बा विश्लेषण के लिएएट तरफ 640 एनपीएल के लिए एल और कदम 2.11 में प्राप्त कुल मात्रा से आरसीएफ के लिए 300 μ एल μ।

  1. 5 मिनट के लिए 95 डिग्री सेल्सियस पर 15 μ Laemmli बफर 2x में प्रत्येक subnuclear अंश के एल (4% एसडीएस, 20% ग्लिसरॉल, 10% 2-mercaptoethanol, नीले 0.004% bromophenol, 0.125 एम Tris एचसीएल पीएच 6.8) और फोड़ा मिलाएं। एक 10% सोडियम dodecyl सल्फेट-जेल वैद्युतकणसंचलन (एसडीएस पृष्ठ) 20 milliamperes (एमए) में, 1.5 घंटे के लिए जेल और अलग प्रोटीन denaturing में नमूने लोड करें।
  2. Polyvinylidene difluoride (PVDF) झिल्ली पर 400 मा पर 1.5 घंटे के लिए electroblotting द्वारा प्रोटीन स्थानांतरण।
  3. आर टी पीबीएस में 3% नोनफेट शुष्क दूध का उपयोग करने पर 2 घंटे के लिए झिल्ली ब्लॉक।
  4. पीबीएस / 0.3% नोनफेट शुष्क दूध में 500 कमजोर पड़ने: एक 1 पर वायरल E2A डीएनए बाध्यकारी प्रोटीन (B6-8 9) के खिलाफ प्राथमिक एंटीबॉडी के साथ 4 डिग्री सेल्सियस पर हे / एन सेते हैं।
  5. 3 बार पीबीएस के साथ धो झिल्ली / 0.1% से 10 मिनट के लिए बीच 20।
  6. माउस विरोधी आईजीजी माध्यमिक एक साथ झिल्ली सेतेआरटी पर 2 घंटे के लिए पीबीएस में 10,000 कमजोर पड़ने tibody एक 1 पर घोड़ा-मूली peroxidase (एचआरपी) के लिए मिलकर।
  7. पीबीएस के साथ झिल्ली 3 बार धोएं / 0.1% के बीच 20 और 10 मिनट के लिए।
  8. बढ़ाया chemiluminescence और एक्स-रे फिल्मों का उपयोग झिल्ली का विकास करना।

आरसीएफ में 4. वायरल डीएनए जांच

नोट: दोनों एनपीएल और आरसीएफ अंशों से डीएनए अलगाव के लिए, कदम 2.11 में प्राप्त कुल मात्रा का आरसीएफ के लिए एनपीएल के लिए 210 μ एल और 100 μ एल का उपयोग करें।

  1. Proteinase कश्मीर की 1 मिलीग्राम / एमएल और 0.5% के बीच 20 के साथ 55 डिग्री सेल्सियस पर 1 घंटे के लिए उप-परमाणु अंशों सेते हैं।
  2. 95 डिग्री सेल्सियस पर 10 मिनट के लिए नमूने incubating द्वारा proteinase कश्मीर निष्क्रिय।
  3. 2 मिनट के लिए आरटी पर, 20,000 XG पर नमूने अपकेंद्रित्र।
  4. एसएन लीजिए। 4 डिग्री सेल्सियस पर 3M सोडियम एसीटेट के 1/10 मात्रा और isopropanol में से एक मात्रा, हे / एन के साथ डीएनए वेग।
  5. 10 मिनट के लिए आरटी पर, 20,000 XG पर नमूने अपकेंद्रित्र।
  6. एसएन यू त्यागेंएक micropipette गाते हैं। 20,000 XG, 5 मिनट के लिए 4 डिग्री सेल्सियस पर 70% इथेनॉल और सेंट्रीफ्यूज के साथ गोली धो लें।
  7. 10 मिमी के 10 μ एल में डीएनए Resuspend Tris एचसीएल 7.4 पीएच
  8. 260 एनएम ऑप्टिकल घनत्व (ओवर ड्राफ्ट) को मापने के द्वारा एक स्पेक्ट्रोफोटोमीटर का उपयोग डीएनए यों।
  9. वायरल डीएनए बढ़ाना न्यूक्लियोटाइड 7273 से, मेजर देर प्रतिलेखन इकाई के भीतर एक क्षेत्र का प्रवर्धन की अनुमति है कि प्राइमरों के साथ प्रतिक्रिया मात्रा का 25 μ एल में Taq डीएनए पोलीमरेज़ का उपयोग एक मानक पीसीआर प्रतिक्रिया में प्रत्येक subnuclear अंश से डीएनए के 100 एनजी का उपयोग करने के लिए न्यूक्लियोटाइड 7353 (81 बीपी) (परिवार कल्याण: GAGCGAGGTGTGGGTGAGC; आर.वी.: GGATGCGACGACACTGACTTCA)। 95 डिग्री सेल्सियस पर 3 मिनट के लिए प्रारंभिक विकृतीकरण, 20 प्रवर्धन (95 डिग्री सेल्सियस, 72 डिग्री सेल्सियस पर 30 सेकंड के लिए 62 डिग्री सेल्सियस पर 1 मिनट के लिए annealing और विस्तार पर 1 मिनट) के चक्र और के लिए एक अंतिम विस्तार कदम के बाद: निम्नलिखित चक्र शर्तों का उपयोग करें 72 डिग्री सेल्सियस पर 3 मिनट।
  10. Ethidium के साथ 90 वी दाग ​​पर, 2% agarose जैल में पीसीआर उत्पाद चला0.5 μ जी / एमएल अंतिम एकाग्रता में ब्रोमाइड और आरसीएफ में वायरल डीएनए संवर्धन की पुष्टि करने के लिए डीएनए कल्पना। इस परिसर में एक शक्तिशाली उत्परिवर्तजन के रूप में है, दस्ताने पहनने के लिए सुनिश्चित करें कि हमेशा अत्यधिक सावधानी के साथ ethidium ब्रोमाइड संभाल और। संस्थागत दिशा निर्देशों के अनुसार ethidium ब्रोमाइड फेकें।

आरसीएफ में 5. देर वायरल mRNA जांच

नोट: दोनों एनपीएल और आरसीएफ अंशों से शाही सेना अलगाव के लिए, कदम 2.11 में प्राप्त कुल मात्रा से आरसीएफ के लिए एनपीएल के लिए 640 μ एल और 300 μ एल का उपयोग करें।

  1. निर्माता के निर्देशों के अनुसार Trizol का उपयोग कर subnuclear अंशों से शाही सेना को अलग। DEPC (diethilpyrocarbonate) -treated पानी की 50 μ एल में शाही सेना Resuspend।
  2. 260 एनएम पर आयुध डिपो को मापने के लिए एक स्पेक्ट्रोफोटोमीटर का उपयोग आरएनए यों (लगभग 3 μ जी प्राप्त कर रहे हैं)। 50 एनजी में शाही सेना स्टोर / -70 डिग्री सेल्सियस पर एल aliquots μ।
  3. शुद्ध शाही सेना चेक5 कुल शाही सेना के एनजी और कदम 4.9 में वर्णित चक्र शर्तों का उपयोग, रिवर्स ट्रांसक्रिपटेस (आरटी) के अभाव में एक नियंत्रण पीसीआर प्रतिक्रिया के प्रदर्शन से डीएनए संदूषण के अभाव के लिए।
    1. डीएनए संदूषण अनुपस्थित है तो कोई amplicon उत्पादन किया जाना चाहिए। डीएनए संदूषण मौजूद है, तो, 10 यू Rnase अवरोध की 10 यू DNase मैं, 0.1 एम Tris एचसीएल पीएच 8.3, 0.5 एम KCl और 37 डिग्री सेल्सियस पर 30 मिनट के लिए 15 मिमी 2 MgCl के साथ नमूने सेते हैं। 5.1 कदम के रूप में शाही सेना को फिर से अलग करने के लिए आगे बढ़ें।
  4. आरसीएफ के लिए जुड़े वायरल mRNA का विश्लेषण करने के लिए, विभिन्न जीन परिवार (1 टेबल) से adenoviral देर mRNA का पता लगाने के लिए डिज़ाइन प्राइमरों का उपयोग आरटी पीसीआर द्वारा प्रत्येक subnuclear अंश से शाही सेना के 100 एनजी बढ़ाना।
    1. रिवर्स प्रतिलेखन (आरटी) के लिए, 42 डिग्री सेल्सियस पर 1 घंटे और 70 डिग्री सेल्सियस पर 10 मिनट के लिए प्रतिक्रिया मात्रा का 20 μ एल में एम MuLV आरटी एंजाइम का उपयोग एक मानक आरटी प्रतिक्रिया में प्रत्येक subnuclear अंश से, शाही सेना के 100 एनजी का उपयोग करें।
    2. प्रवर्धन के लिए, 1 का उपयोगकदम 4.9 में के रूप में पीसीआर प्रतिक्रियाओं में सीडीएनए μ एल। प्रवर्धन के 25 चक्रों के बाद 95 डिग्री सेल्सियस पर 3 मिनट के लिए प्रारंभिक विकृतीकरण, (95 डिग्री सेल्सियस पर 1 मिनट, annealing के 72 डिग्री सेल्सियस पर 30 सेकंड के लिए 1 टेबल और विस्तार में निर्दिष्ट तापमान पर 1 मिनट के लिए) और एक: निम्नलिखित चक्र शर्तों का उपयोग करें 72 डिग्री सेल्सियस पर 3 मिनट के लिए अंतिम विस्तार कदम है।
  5. 0.5 μ जी / एमएल अंतिम एकाग्रता में ethidium ब्रोमाइड के साथ 90 वी दाग जैल में 2% agarose जैल में आरटी पीसीआर उत्पादों, चलाने के लिए और आरसीएफ को वायरल देर mRNA संघ की पुष्टि करने के लिए कल्पना। कदम 4.10 में संकेत के रूप ethidium ब्रोमाइड संभाल लेना।

आरसीएफ के 6. इम्यूनोफ्लोरेसेंस विज़ुअलाइज़ेशन

नोट: कैरी-बाहर यह प्रक्रिया एक लामिना का प्रवाह कैबिनेट के तहत किसी भी धूल के कणों के साथ नमूने के संक्रमण से बचने के लिए, और उपयोग करने से पहले सभी समाधान फिल्टर करने के लिए।

  1. स्पॉट 5 कदम सख्त 2.10 में प्राप्त आरसीएफ अंश के एल μctly एक silane लेपित स्लाइड पर।
  2. आरटी पर के बारे में 5 मिनट के लिए जगह शुष्क करते हैं।
  3. री-हाइड्रेट धीरे धीरे और परोक्ष रूप से आरसीएफ स्थान के बगल में एक बूंद में पीबीएस के 500 μ एल pipetting और यह स्लाइड झुकने से प्रवाह की अनुमति के द्वारा। की ओर से अतिरिक्त पीबीएस बंद नाली।
  4. आरटी पर 2 घंटे के लिए पीबीएस / 5% गोजातीय सीरम albumin के 500 μ एल (बीएसए) के साथ नमूना कवर द्वारा ब्लॉक।
  5. धीरे और परोक्ष रूप से नमूना पर पीबीएस के 500 μ एल pipetting द्वारा स्लाइड 3 बार धोएं। अतिरिक्त पीबीएस बंद के निकास के लिए स्लाइड झुकाएँ।
  6. आरटी पर 2 घंटे के लिए पीबीएस में 500 कमजोर पड़ने: एक 1 पर वायरल E2A डीएनए बाध्यकारी प्रोटीन (B6-8 9) के खिलाफ प्राथमिक एंटीबॉडी के साथ नमूना सेते हैं। एंटीबॉडी समाधान के 20 μ एल के साथ देखा नमूना कवर और सुखाने से बचने के लिए एक नम कक्ष में सेते हैं।
  7. धीरे और परोक्ष रूप से नमूना पर पीबीएस के 500 μ एल pipetting द्वारा पीबीएस / 0.02% बीच 20 के साथ नमूना 3 बार धोएं। पूर्व बंद के निकास के लिए स्लाइड झुकाएँउपकर धोने समाधान।
  8. 4 डिग्री सेल्सियस पर 1 घंटे के लिए, पीबीएस में 2,000 कमजोर पड़ने: एक 1 पर 488 एनएम पर उत्साहित है कि एक fluorophore करने के लिए मिलकर माउस विरोधी आईजीजी माध्यमिक एंटीबॉडी के साथ नमूने सेते हैं। एंटीबॉडी समाधान के 20 μ एल के साथ देखा नमूना कवर और सुखाने से बचने के लिए एक नम कक्ष में सेते हैं।
  9. धीरे और परोक्ष रूप से नमूना पर पीबीएस के 500 μ एल pipetting द्वारा पीबीएस / 0.02% बीच 20 के साथ नमूना 3 बार धोएं। अतिरिक्त धोने के समाधान से दूर नाली के लिए स्लाइड झुकाएँ।
  10. बढ़ते मध्यम के रूप में 2 μ एल पीबीएस / 10% ग्लिसरॉल का उपयोग कर एक coverslip साथ स्लाइड पर देखा नमूना कवर। स्पष्ट नेल पॉलिश और दुकान अल -20 डिग्री सेल्सियस के साथ सील।
  11. एक 63x उद्देश्य और 488 एनएम के तरंग दैर्ध्य में एक 1.4 संख्यात्मक एपर्चर (एनए) के साथ एक प्रतिदीप्ति सूक्ष्मदर्शी का उपयोग कर नमूने का विश्लेषण करें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

वायरल प्रतिकृति डिब्बों (आर सी) प्रोटीन और अन्य परमाणु डोमेन के लिए समान न्यूक्लिक एसिड से बना subnuclear वायरल प्रेरित संरचनाओं हैं, वे जैव रासायनिक विशेषताओं के आधार पर वेग ढ़ाल से अलगाव के लिए उत्तरदायी साबित हुई। विभाजन प्रोटोकॉल में महत्वपूर्ण कदम नमूने विभिन्न उप सेलुलर अंशों की अखंडता को सुनिश्चित करने के लिए उज्ज्वल क्षेत्र माइक्रोस्कोपी द्वारा निगरानी की जरूरत कदम प्रत्येक पर चित्र 1 में सचित्र हैं। कोशिकाओं में सूजन जब उदाहरण के लिए, hypotonic बफर में ऊष्मायन समय नाभिक को होने वाले नुकसान से बचने के कोशिका द्रव्य प्रफुल्लित करने के क्रम में मानकीकृत किया जाना चाहिए। जालिका झिल्ली सहित साइटोप्लास्मिक तत्वों से मुक्त सेल homogenization बरकरार नाभिक, के बाद प्राप्त होने की जरूरत है। इसके अलावा, sonication समय आर सी बाधा पहुँचा के बिना सभी कोशिकाओं के परमाणु झिल्ली संबंध विच्छेद करने के क्रम में मानकीकृत किया जाना चाहिए।

उप-परमाणु अंशों प्राप्त करने के बाद, कुंजीनियंत्रण आरसीएफ में संघ और सदाशयी आर सी मार्कर के संवर्धन का निर्धारण करने के लिए शामिल किए जाने की जरूरत है। Adenoviral आर सी आमतौर पर वायरल E2A-72k प्रोटीन (DBP) के खिलाफ एंटीबॉडी का उपयोग immunofluorescence द्वारा संक्रमित कोशिकाओं में कल्पना कर रहे हैं। DBP वायरल जीनोम प्रतिकृति में सीधे भाग लेता है कि एक वायरल प्रोटीन होता है; चित्रा 1 में दिखाया गया है, इसलिए, आरसीएफ में समृद्ध कणों में DBP की उपस्थिति, पृथक कणों के साथ इस वायरल प्रोटीन का सीधा संबंध को दर्शाता है। इसके अलावा, वेस्टर्न ब्लाट द्वारा आरसीएफ में DBP का पता लगाने के अलग-थलग करने के लिए इस प्रोटीन के सहयोग से इस बात की पुष्टि आर सी। चित्रा 2 में यह आर सी के बाद संक्रमण अस्थायी उम्मीद प्रतिबिंबित अलग अलग समय पर इस प्रक्रिया के साथ प्राप्त किया प्रदर्शन है कि, देर बार के बाद संक्रमण (36 एचपीआई) द्वारा, DBP nucleoplasmic अंश (एनपीएल) की तुलना में आरसीएफ में समृद्ध है कि दिखाया गया है आर सी के लिए DBP एसोसिएशन के पैटर्न। आर सी का एक अनिवार्य वायरल घटक वायरल डीएनए itse हैवामो। 3 चित्र में दिखाया है कि जैसे प्रयोगों में हम वायरस की प्रतिकृति चक्र प्रगति के रूप में आरसीएफ के साथ वायरल डीएनए सहयोगी की बढ़ती मात्रा, DBP के लिए के रूप में, इन भागों में डीएनए प्रतिकृति के अस्थायी पैटर्न का भी अध्ययन किया जा सकता है, यह दर्शाता है कि कि प्रदर्शित करता है।

वायरल प्रोटीन और वायरल जीनोम युक्त इसके अलावा, आर सी वायरल देर जीन अभिव्यक्ति की साइटों को भी कर रहे हैं। चित्रा 4 में हम आरटी पीसीआर द्वारा वायरल देर mRNA और 36 HPI पर आरसीएफ और एनपीएल के बीच उनके अलगाव की विभिन्न प्रजातियों के स्तर को मापने के लिए बनाया प्रयोगों के प्रतिनिधि परिणाम प्रस्तुत करते हैं। वायरल देर mRNA के आर सी में संश्लेषित और उनके postranscriptional प्रसंस्करण इन साइटों में शुरू की जाती है; बाद में इन वायरल mRNA, आर सी से अलग कर देना nucleoplasm करने के लिए मुक्त हैं, और बाद में कोशिका द्रव्य को निर्यात कर रहे हैं। परिपक्व वायरल देर mRNA का कुल पूल (एमएल mRNA), त्रिपक्षीय नेता की एक एक्सॉन जंक्शन बढ़ाना कि प्राइमरों का उपयोग मापा गया था एकसभी adenoviral देर mRNA (चित्रा -4 ए) के '5 का गठन किया कि अनुक्रम। एल 2 की विशिष्ट परिपक्व टेप की mRNA में एक्सॉन जंक्शनों, L4 और L5 परिवारों को भी मापा गया। यह वायरल प्रतिकृति चक्र की देर चरण प्रगति के रूप में, वायरल देर mRNA की बढ़ती मात्रा कोशिका द्रव्य को निर्यात कर रहे हैं कि स्थापित किया गया है; हालांकि, L5 mRNA प्रजातियों की देर बार उत्पादन अन्य देर mRNA के परिवारों के साथ तुलना में आगे बढ़ जाती है। उम्मीद के रूप में चित्रा 4 में बोया प्रतिनिधि परिणामों में मिलीलीटर mRNA में एक लगभग 2.5 गुना अंतर, आरसीएफ के साथ तुलना में एनपीएल में मनाया जाता है। हम विशिष्ट परिवारों से mRNA तुलना दिलचस्प बात है जब, एल 2 और L4 mRNA दोनों दोनों subnuclear भिन्न (चित्रा 4 बी और सी, क्रमशः) के बीच समान स्तर में वितरित करने के लिए दिखाई देते हैं, जबकि इसके विपरीत, L5 mRNA के एनपीएल में एक लगभग 2 गुना वृद्धि देखी गई आरसीएफ की तुलना में। इन परिणामों के sy में एक अंतर पैटर्न का सुझाव nthesis और adenoviral आर सी से अलग वायरल देर mRNA प्रजातियों की मुक्ति (10 से पहले सुझाव दिया गया है के रूप में)। गौरतलब है कि इन परिणामों से यह भी वायरल mRNA का जीवजनन में विभिन्न चरणों की सटीक मापन इस उपन्यास की प्रक्रिया के साथ पृथक आर सी का उपयोग किया जा सकता है कि प्रदर्शित करता है।

चित्र 1
Fractionation प्रक्रिया के दौरान विभिन्न चरणों की आकृति 1. उज्ज्वल क्षेत्र माइक्रोस्कोपी। आर सी के अलगाव के दौरान नमूने उप सेलुलर अंशों की अखंडता को सुनिश्चित करने के लिए एक ऑप्टिकल माइक्रोस्कोप से नजर रखी जा करने की जरूरत है। आंकड़ा सुक्रोज तकिये के माध्यम से नाभिक की जुदाई और आरसीएफ के अलगाव के लिए, HFF कोशिकाओं की सूजन से आरसीएफ प्राप्त करने के लिए प्रक्रिया में इस्तेमाल कदम को दिखाती है। 40x micrographs: पैमाने बार 50 μ मीटर; 63x micrographs: पैमाने पर पट्टी 5 μ मीटर; DBP हरे रंग में दिखाया गया है।टीपीएस: // "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2. DBP के खिलाफ वेस्टर्न ब्लाट। नमूनों एसडीएस पृष्ठ से विश्लेषण किया और DBP, वायरल आर सी के एक सदाशयी मार्कर के खिलाफ पश्चिमी धब्बा के लिए कार्रवाई कर रहे हैं। आरसीएफ में प्रोटीन के संवर्धन का निर्धारण करने के लिए, यह अलग अलग समय के बाद संक्रमण पर आरसीएफ और एनपीएल दोनों में उपस्थिति और DBP के रिश्तेदार बहुतायत तुलना करने के लिए भी उपयोगी है। HFF कोशिकाओं में 16 HPI adenoviral प्रतिकृति चक्र के दौरान एक प्रारंभिक समय प्रतिनिधित्व करता है; 24 HPI संक्रमण वायरल डीएनए संश्लेषण शुरू होता है के रूप में की देर चरण के लिए संक्रमण के निशान; 36 HPI एक देर समय के बाद संक्रमण का प्रतिनिधित्व करता है। DBP की उम्मीद आणविक जन दिखाया गया है। CLIC करेंयह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहाँ k।

चित्र तीन
चित्रा 3. पीसीआर परख 24 और 36 HPI पर आरसीएफ और एनपीएल से शुद्ध किया गया था आरसीएफ। डीएनए में वायरल डीएनए (vDNA) का पता लगाने के लिए। वायरल डीएनए वायरल जीनोम के लिए विशिष्ट प्राइमरों का उपयोग पीसीआर से परिलक्षित किया गया था। ग्राफ 36 HPI पर आरसीएफ में वायरल डीएनए के संवर्धन से पता चलता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
।। चित्रा 4. वायरल देर mRNA शाही सेना के विश्लेषण आरसीएफ और एनपीएल से अलग और विशिष्ट वायरल देर mRNA पता लगाने के लिए आरटी पीसीआर द्वारा विश्लेषण किया गया था (ए) कुल वायरल देर mRNA (माले: प्रमुख स्वर्गीय), एल से (बी) mRNA2 परिवार; L4 परिवार से (सी) mRNA; L5 परिवार से (डी) mRNA। मूल्यों मतलब ± तीन प्रतियों के नमूनों का मानक विचलन प्रतिनिधित्व करते हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

नाम आगे प्राइमर अनुक्रम (5'-3 ') रिवर्स प्राइमर अनुक्रम (5'-3 ') Annealing तापमान

। वायरल देर mRNA प्रवर्धन एमएल mRNA के लिए प्रयुक्त तालिका 1. प्राइमर: इन प्राइमरों त्रिपक्षीय नेता के भीतर एक क्षेत्र के प्रवर्धन की अनुमति है, सभी वायरल देर mRNA के लिए आम है कि 5 'अनुक्रम; एल 2 mRNA प्राइमरों पीवी mRNA के भीतर एक विशिष्ट क्षेत्र के प्रवर्धन अनुमति देते हैं; L4 mRNA प्राइमरों 100 कश्मीर mRNA के भीतर एक विशिष्ट क्षेत्र के प्रवर्धन अनुमति देते हैं; L5 mRNA फाइबर mRNA के भीतर एक क्षेत्र का प्रवर्धन की अनुमति देता है। प्रत्येक रस्मी के लिए अनुक्रम और annealing तापमानएर दिखाए जाते हैं।

Subscription Required. Please recommend JoVE to your librarian.


Name Company Catalog Number Comments
DMEM Gibco 12100-046 Warm in 37 ºC water bath before use
Fetal Bovine Serum Gibco 12484-028
Sucrose, Ultra Pure Research Organics 0928S Prepare a 2.55 M stock solution and store at 4 ºC
Dounce homogenizer Kontess Glass Company 884900-0000
Branson 1800 Ultrasonic Bath Branson Z769533 SIGMA Turn on 15 min before use.
Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate Life Technologies A-21121 Use at a 1:2,000 dilution in PBS
Silane-Prep Slides Sigma S4651-72EA Open in a laminar flow cabinet
SuperSignal West Pico Chemiluminescent Substrate Pierce ThermoScientific 34080



  1. Doucas, V., et al. Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure. Genes & Dev. 10, 196-207 (1996).
  2. Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. DNA virus replication compartments. J. Virol. 88, 1404-1420 (2014).
  3. Boon, J. A., Diaz, A., Ahlquist, P. Cytoplasmic viral replication complexes. Cell host microbe. 8, 77-85 (2010).
  4. Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment. J. Virol. 87, 10612-10627 (2013).
  5. Busch, H., et al. Isolation of Nucleoli. Exp Cell Res. 24, Suppl 9. 150-163 (1963).
  6. Lam, Y. W., Lyon, C. E., Lamond, A. I. Large-scale isolation of Cajal bodies from HeLa cells. Mol. Biol. Cell. 13, 2461-2473 (2002).
  7. Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. The nucleolus. J Cell Sci. 118, 1335-1337 (2005).
  8. Groitl, P., Dobner, T. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol Med. 130, 29-39 (2007).
  9. Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein. Virology. 128, 480-484 (1983).
  10. Leppard, K. N. Selective effects on adenovirus late gene expression of deleting the E1b 55K protein. J Gen Virol. 74, (Pt 4), 575-582 (1993).
  11. Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts. J. Virol. 80, 964-974 (2006).
  12. Castillo-Villanueva, E., et al. The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection. ISRN Virology. 2014, 14 (2014).
  13. Morris, S. J., Scott, G. E., Leppard, K. N. Adenovirus late-phase infection is controlled by a novel L4 promoter. J. Virol. 84, 7096-7104 (2010).
  14. Wright, J., Leppard, K. N. The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53. J. Virol. 87, 11617-11625 (2013).



    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics