RNAi-vermittelten Kontrolle der Aflatoxine in Peanut: Methode, um Mykotoxinproduktion und Transgenexpression in der Erdnuss-Analyse /

Environment
 

Summary

Wir zeigen, ein Verfahren zur Analyse von Aflatoxinen und die Transgen-Expression in Erdnusskerne, die die RNA-Interferenz-Signale zum Dämpfen Aflatoxin-Synthesegene in dem Pilz Aspergillus flavus enthalten. RNAi-vermittelte Kontrolle von Mykotoxinen in Pflanzen ist bisher nicht berichtet worden.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Arias, R. S., Dang, P. M., Sobolev, V. S. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem. J. Vis. Exp. (106), e53398, doi:10.3791/53398 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die Ernährungs- und Landwirtschaftsorganisation der Vereinten Nationen schätzen, dass 25% der Nahrungsmittelgetreide in der Welt sind mit Aflatoxinen kontaminiert. Das entspricht 100 Millionen Tonnen Lebensmittel vernichtet oder nicht-menschlichen Verzehr pro Jahr umgeleitet. Aflatoxine sind leistungsfähige Karzinogene normalerweise durch die Pilze Aspergillus flavus und A. parasiticus Getreide, Nüsse, Hackfrüchte und andere landwirtschaftliche Erzeugnisse angesammelt. Silencing von fünf Aflatoxin-Synthesegene durch RNA-Interferenz (RNAi) in Erdnusspflanzen wurde verwendet, um Aflatoxin Kumulkontrolle nach der Inokulation mit A. flavus. Bisher gab es keine Methode, um die Wirksamkeit der RNAi in einzelnen Erdnuss transgenen Ereignisse zu analysieren, da diese in der Regel produzieren paar Samen und traditionellen Methoden der großen Feldversuchen unter Aflatoxin-förderlichen Bedingungen wurden keine Option. In diesem Bereich, ist die Wahrscheinlichkeit, natürlich kontaminierten Samen oft 1/100 bis 1/1,000. Zusätzlich wird Aflatoxinverteilung nicht gleichmäßig verteilt. Unsere Methode verwendet paar Samen pro transgenes Event, mit kleinen Stücken für Echtzeit-PCR (RT-PCR) verarbeitet oder kleine RNA-Sequenzierung und für die Analyse von Aflatoxin Akkumulation durch ultra-Performance Liquid Chromatography (UPLC). RNAi-exprimierenden Erdnusslinien 288-72 und 288-74, zeigten bis zu 100% Reduktion (p ≤ 0,01) in Aflatoxin B 1 und B 2 im Vergleich zur Kontrolle, die bis zu 14.000 ng angesammelt. G -1 von Aflatoxin B 1, wenn mit aflatoxigenic A. impft flavus. Als Referenz, die insgesamt maximal zulässige Aflatoxine für den menschlichen Verzehr in den Vereinigten Staaten ist 20 ng. G -1. Dieses Protokoll beschreibt die Anwendung von RNAi-vermittelten Kontrolle von Aflatoxinen in transgenen Erdnusssamen und Verfahren zu ihrer Auswertung. Wir glauben, dass ihre Anwendung in der Zucht von Erdnuss und andere Feldfrüchte werden rasche Fortschritte in diesem wichtigen Bereich der Wissenschaft zu bringen, Der Medizin und der menschlichen Ernährung und wird wesentlich zur internationalen Bemühungen, Aflatoxine und möglicherweise anderen Mykotoxinen in wichtigen Nahrungspflanzen zu kontrollieren beizutragen.

Introduction

Etwa 4,5 Milliarden Menschen sind chronisch zu Aflatoxinen 1, der stärksten Karzinogene in der Natur 2 bekannte ausgesetzt. Diese Mykotoxine kontaminiert 25% der Nahrungsmittelgetreide in der Welt 3, einschließlich Mais, Maniok, Reis, Nüsse, Getreide und Gewürze. 4. Aflatoxine Ursache Wachstumsstörungen bei Kindern 5, beeinträchtigt das Immunsystem 6, sind in 58% der Leberzellkarzinome-Gegenwart in der menschlichen Biopsien 7,8, und töten Hunderte von Menschen während der periodischen Ausbrüche von Aflatoxikose 9,10. Aflatoxine sind Polyketid-abgeleiteten Mykotoxine in der Regel durch Aspergillus flavus und A. hergestellt parasiticus; Aflatoxin B 1 und B 2 werden durch A. hergestellten flavus, während A. parasiticus produziert auch G 1 und G 2. Die chemische Struktur dieser Verbindungen und ein Chromatogramm, das die Trennung von UPLC sind in Abbildung 1 dargestellt.

Abbildung 1
Abbildung 1. Aflatoxine und RNAi einfügen Top:. Chemische Struktur (links) und Beispiel-Chromatogramm (rechts) der vier häufigsten Polyketid-abgeleiteten Aflatoxine: B 1, B 2, G 1 und G 2, die von Aspergillus parasiticus, A hergestellt . flavus produziert B 1 und B 2 unten: Schematische Darstellung der Genfragmente in der RNAi-Konstrukt p5XCAPD Erdnuss Transformation verwendeten Zahlen unter Pfeile sind Gen-Fragment-Zugangsnummern in der Aspergillus flavus Genoms;. PIV2: Kartoffel Intron; bp: Basenpaare; RT_5X_1 und RT_5X_2:. Real-Time-PCR-Primer-Sites Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Die volkswirtschaftlichen Schäden bei den Exporten aufgrund von Aflatoxinen in Erdnüssen allein überschreiten $ 450 Millionen US-Dollar, wenn auf der Grundlage des 4 ng. G -1 Limit von Aflatoxin für den menschlichen Verzehr in der Europäischen Union 11 erlaubt. Aflatoxine sind seit 60 Jahren 12 bekannt; aber wenn viele landwirtschaftliche Methoden wurden entwickelt, um ihre Wirkung, einschließlich der Anwendung von anderen Pilzstämme 13,14 mildern, keine einheitliche Methode der Steuerung vorhanden ist, und resistente Pflanzensorten nicht verfügbar sind. Testing Pflanzenkeimplasma für die Resistenz gegen Aflatoxine ist besonders schwierig, weil auch unter förderlichen Bedingungen für Erreger Invasion ist Mykotoxin Akkumulation unberechenbar und nicht einer Normalverteilung folgen. So Versuche erfordern in der Regel große Pflanzflächen, Hunderte von Samen und mehrere Proben von 100-1,700 g, um die Variabilität der Daten 15,16 reduzieren.

RNA-Interferenz warentdeckte im Jahr 1998 17; und die Vorteile der "Silencing" werden derzeit in einer Reihe von neuen Anwendungen, beispielsweise erforscht., in der menschlichen Therapien gegen metastasierendem Brustkrebs 18, Leberkrebs 19, myeloische Leukämie 20 und im Pflanzenschutz gegen Insekten und Nematoden 22 21. In Pflanzen können RNA-Interferenz-Signale von Zelle zu Zelle zu reisen, mit small interfering RNA (siRNA) und hohe Gewichts RNA Molekular wobei für die systemische posttranskriptioneller Gen-Silencing 23,24, auch im Inneren Pilzerreger, die in engem Kontakt mit der Wirtspflanze 25 verantwortlich sind. Die Wirksamkeit der RNAi für Pflanzen-vermittelte Silencing pilzlicher-Pathogen-Genen wurde in wenigen Pflanzen Pathosystemen beschrieben wurde, für diese, visuelle Untersuchung der Symptome in der oberirdischen Teile der Pflanzen (Blätter) erlaubt Krankheit Quantifizierung, dh, Oomyceten Bremia in Kopfsalat 26 Puccinia in Weizen Fusarium in Bananen 28. Viel schwieriger ist es, RNAi Wirksamkeit zu Mykotoxinen in Pflanzen, insbesondere Aflatoxinen in Erdnüssen steuern zu bewerten, wie die Blätter zeigen keine Symptome der Infektion, sind die Organe eingedrungen (Samen) unter mehreren Zoll Erde, ist das Auftreten von Infektionen unberechenbar und nur chemische Analyse kann das Vorhandensein von Aflatoxinen zu bestimmen. Darüber hinaus erhält jedes transgene Ereignis in Erdnuss produziert normalerweise wenige Samen (4-6 pro Pflanze); daher traditionellen Tests für eine no-Aflatoxin Akkumulation Merkmal in großen Feldparzellen, dauerhafte gesamte Anbau Jahreszeiten und mit Hunderten von Samen ist nicht machbar. Hier wird ein Verfahren beschrieben, um in weniger als einer Woche analysiert RNAi Erdnusskerne zum Vorhandensein Transgen und für eine nicht-Aflatoxin Akkumulation Merkmal, mit nur wenig Samen.

Protocol

1. Molekülkonstrukt und Erdnuss-Transformation

  1. Kombinieren DNA-Fragmente von fünf A. flavus Gene AFL2G_07223 (AFLs oder aflJ), AFL2G_07224 (AFLR), AFL2G_07228 (AFLC / pksA / pksL1), AFL2G_07731 (PES1) und AFL2G_05027 (Aflatoxin Effluxpumpe, aflep). Verwenden Sie hierzu die folgenden Primer und ultramers: DIR-1, Kurz Dir1-R, DIR-2-invertiert, Kurz Dir2-R, DirAll-Nco-Rv und DirAll-Bameco-Fw, Tabelle 1.
    1. Machen DIR-1-Doppelstrang durch die 5 PCR-Zyklen (25 & mgr; l Reaktion, 95 ° C 2 min, gefolgt von 5 Zyklen bei 94 ° C 45 sec, 55 ° C 30 sec, 68 ° C 15 s) unter Verwendung von DNA-Polymerase nach Hersteller Anweisungen und Primer Kurz Dir1-R, um einen 3'-Überhang CCCGT zu verlassen. Wiederholen Sie diese Schritte, um DIR-2-invertierten Doppelstrang bilden unter Verwendung von Primer Kurz Dir2-R, um einen 3'-Überhang ACGGG komplementär zu DIR-1 zu verlassen.
    2. Ligieren der beiden 199 bp Fragments mit T4 DNA Ligase nach Herstellerangaben. PCR-Amplifikation des resultierenden 393 bp-Fragment, wie in 1.1.1 unter Verwendung von Primern DirAll-CACC-Fw und DirAll-Nco-Rv (Tabelle 1) angegeben ist, und zu klonen, um ein Produkt mit Standardtechniken in pENTR1A Plasmid p2 + 4ENTR zu machen.
    3. Rekombinieren p2 + 4ENTR in pCAPD 29 (NCBI Zugangs: KC176455.1) mit LR Clonase II Enzymmischung gemäß den Anweisungen des Herstellers, um das Plasmid p5XCAPD zu machen, und verwandeln es in Escherichia coli DH5a Verwendung von Standardtechniken, gefolgt von partieller Sequenzierung. Hinweis: Der komplette RNAi Einsatz ist in Tabelle 1 gezeigt.
  2. Transform Agrobacterium-Stamm C58C1 30 mit Plasmid p5XCAPD wie bereits berichtet 30, und verwenden Sie die resultierende Bakterium Erdnuss-Pflanzen zu transformieren, wie folgt:
    1. Wachsen bei 30 ° C das Agrobacterium p5XCAPD verwenden dafür, 50 ml LB-Brühe, ergänzt mit 500& mgr; g ml -1 Streptomycin, 25 & mgr; g ml -1 Gentamicin, 10 & mgr; g ml -1 Kanamycin, und schütteln Sie die Kultur bei 250 Upm bis zur 1 OD 260.
    2. Ernten Sie die Agrobacterium Zellen durch Zentrifugation (6000 × g) für 10 Minuten, Resuspendieren in 50 ml AB-Minimalmedium 31 mit 100 uM Acetosyringon 1 h, und in der Bakteriensuspension die Explantate von 10 bis 14 Tage alte Keimlinge Exp27-1516, Läufer -Typ Erdnusszuchtlinie. Trocken tupfen die Explantate auf 3MM Löschpapier nach 30 Minuten, und legen sie auf shoot-Induktionsmedium (SIM) [MS-Salz 32, 3% Saccharose, 20 uM Benzylaminopurin (BAP), 10 & mgr; M Thidiazuron (TDZ), pH 5,8, 0,3 % Gellangummi] ohne Antibiotika im Dunkeln drei Tage.
    3. Haben Gewebeauswahl und die Regeneration nach wie vor 33 gemeldet. Bewegen Sie Gewebe für Triebbildung für 2 Monate SIM (500 & mgr; M Cefotaxim und 100 & mgr; M Kanamycin), mit zweiwöchentlichen Transfers. Dann legenAusbau Triebe auf Schießen Dehnung Medium (SEM) [5 uM BAP, 1 uM Gibberellinsäure (GA 3)], alle zwei Wochen für mehrere Monate.
    4. Zeigen einzelne Triebe, 2 cm in der Größe, in Wurzelinduktionsmedium (RIM) [1/2 MS, 1,5% Saccharose, 5 & mgr; M α-Naphthalin-Essigsäure (NAA), 2,5 um Indol-Buttersäure (IBA)], dann akklimatisieren die Sämlinge und sie auf dem Gewächshaus.

2. Identifizierung der Erdnuss Pflanzen beherbergen RNAi to Silence Aflatoxin Synthesegene

  1. Verwenden Werk Mini-Kit in einem Roboter-Arbeitsstation mit 200 ul Elutionspuffer gemäß den Anweisungen des Herstellers, um DNA aus jungen Blättern von Erdnusspflanzen, die dem Prozess der Transformation waren extrahieren (wie zuvor beschrieben) mit RNAi-Konstrukt p5XCAPD (Abbildung 1), die als Grundgerüst Plasmid pCAPD 29 für Gen-Silencing.
  2. Bildschirm des DNA-Proben von Einrohr-nested PCR (STN-PCR), wie beschrieben Previlaufend 34, um den selektierbaren Marker NPTII erkennen und die RNAi-Insert aus p5XCAPD. Klonal fortpflanzen von Kürzungen (3-4 Knoten) PCR-positive Pflanzen, genügend Saatgut für Tests in dieser ersten Generation herzustellen.
    1. Verwenden vier 2-fache Verdünnungen von DNA (50-100 ng ul -1 vor der Verdünnung) in allen STN-PCR-Reaktionen. Für NPTII, externe Primer PCAPD 5714F: 5'-AGGCTATTCGGCTATGACTG-3 'und PCAPD 6446R: 5'-CGTCAAGAAGGCGATAGAAG-3', und interne Primer PCAPD 5730F: 5'-ACTGGGCACAACAGACAATC-3 'und PCAPD 6249R: 5'-ATATTCGGCAAGCAGGCATC- 3'.
    2. Für den Nachweis von RNAi stecke in STN-PCR-Reaktionen externe Primer 35S-PDSFw: 5'-CCTAACAGAACTCGCCGTAA-3 'und DirAll-Nco-Rv: 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3', und interne Primer Probe_5027_Fw: 5'-gtatttgtgaccatgtttctg-3 'und Probe_7228_Rv: 5'-GGACGGATAGTAAACTGCGG-3'.
  3. Ernte-Erdnusshülsen von STN-PCR positiven Pflanzen und der con trol Pflanzen unter den gleichen Bedingungen gezüchtet. Entscheidender Schritt: Stellen Sie sicher, dass die Kontrollpflanzen sind in den gleichen Bedingungen und der gleichen Jahreszeit wie die RNAi-Pflanzen angebaut. Wasserböe die Schoten mit einem Hochdruckreiniger bei geringer Intensität oder kratzen mit der Hand, um Exokarp indem die Hülsen auf einer Laufplatte und separater Schoten in Gruppen (gelb, orange, braun und schwarz) 35 (Bild entfernen, bestimmen die Farbe des Mesokarp 2).

Figur 2
Abbildung 2. Herstellung von Erdnusshülsen für die Analyse. Links: Verschiedene Erdnuss Größen bei der Ernte fand wie Erdnuss ist eine unbestimmte Wachstum Pflanze; Center: Platzieren Erdnüsse in Metallkorb für die Wasserdruck Entfernung von Exokarp; Rechts: Reifegruppen Mesokarp Farbe auf einer Erdnuss Profilplatte (gelb, orange, braun und schwarz).98fig2large.jpg "target =" _ blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

3. Versuchsaufbau

  1. Entfernen Sie die Rümpfe, Prozess gelben und braunen Samen getrennt. Berechnen Sie die Anzahl der Samen in dem Experiment gemäß Tabelle 2 zu verwenden. Beachten Sie, dass mindestens drei Samenstücke (1 Saatgut Stück = Halbkeimblatt) pro Erdnusslinie und Probenahmedatum ist erforderlich, um statistische Analysen durch und den Standardfehler zu reduzieren.
Name Sequenz
DIR-1 5'-
GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTCGTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAATCCCCTGCATCTACGCGCACGCATC
ACTTGGGGTACCCGT-3 '
Kurz Dir1-R 5'-Phos-TACCCCAAGTGATGCGTGCGCG-3 '
DIR-2-invertierten 5'GGTTATTGGGTGCAGAATGGTAAACCACCCAACAGTACGCGAAATG
TCAATTCCAGAGTCCCAAACCTCCCTACCGTGGCCTGGACGGATAG
TAAACTGCGGAGCTTGGGAACAAAATCCGCTGTCTGATCGCCGAAG
AGAAAGAGTTGCCTTGATTGAGCCGCATCGAGGACAGGTTGTGTTG
CTGTTGATAGACGGG-3 '
Kurz Dir2-R 5'-Phos-CTATCAACAGCAACACAACC-3 '
DirAll-CACC-Fw 5'-CACCGCCAGCTCAAAAGTGCGATGC-3 '
DirAll-Nco-Rv 5'-ATGCCATGGGGTTATTGGGTGCAGAATGG-3 '
DirAll-Bameco-Fw 5'-ATGGGATCCGAATTCGCCAGCTCAAAAGTGCGATGC-3 '
Komplette RNAi Einsatz 5'GCCAGCTCAAAAGTGCGATGCACCAAGGAGAAACCGGCCTGTGCT
CGGTGTATCGAACGTGGTCTTGCCTGTCAATACATGGTC / GTATTTG
TGACCATGTTTCTGGTGGCATTGGACCGTCTTGTCATCTCTACAGCC
ATTCCCCAGATCACGGACGAAT / CCCCTGCATCTACGCGCACGCAT
CACTTGGGGTACCCGTCTATCAACAGCAACACAACCTGTCCTCGAT
GCG / GCTCAATCAAGGCAACTCTTTCTCTTCGGCGATCAGACAGCG
GATTTTGTTCCCAAGCTCCGCAGTTTACTATCCGTCCA / GGCCACGG
TAGGGAGGTTTGGGACTCTGGAATTGACATTTCGCGTACTGTTGGG
TGGTTTACCATTCTGCACCCAATAACC-3 '

. Tabelle 1 Oligonukleotide und ultramers verwendet, um die RNAi-Konstrukt p5XCAPD Phos bauen: phosphoryliert 5'-Ende; "/" Trennt verwendet die fünf Genfragmente; Komplette RNAi Einsatz: 2-Sequenz als inverted repeats zur p5XCAPD bilden.

  1. Platzieren gesamte Erdnuss Samen in einer einzelnen Schicht, so dass sie den Boden einer sterilen Becher zu bedecken. Hinzufügen 75% Ethanol / Wasser (v / v) Lösung, um die Samen zu bedecken und dann das gleiche Volumen der gleichen Lösung. Inkubieren bei Raumtemperatur für 30 Sekunden und dann mit sterilem, deionisiertem Wasser (SDW) zu spülen.
  2. Mit 2% Natriumhypochlorit in das Becherglas, welches den Ethanol behandelten Samen wie folgt: Add genug 2% Natriumhypochloritlösung, um die Samen zu bedecken, dann das gleiche Volumen der gleichen Lösung und Inkubation für 5 min. Entscheidender Schritt: mit einem Volumen von SDW entspricht Gründlich dreimal 5-fache des Volumens des Hypochlorit verwendet (Abbildung 3).

Figur 3
Abbildung 3. Versuchsaufbau. Top: Oberflächensterilisation von Erdnusskernen vor und nach Hypochlorit, Entfernung der Samenschale (Testa); Mitte: Entfernung von Embryo und nahe Ansicht der Embryo, dann schneiden Keimblatt in der Mitte; unten: halbe Keimblätter in sterilem destilliertem Wasser, Lösch auf sterile saugfähigen Papier, Druckstellen auf Wasser-Agar, und Platzieren von Halbkeimblätter (Schnittseite nach oben) auf der Agar-Oberfläche. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

  1. Lassen Sie die Oberflächen-sterilisierten Samen in SDW für 2 Stunden unter Wasser aufsaugen. Legen Sie die Samen auf eine sterile Petrischale, entfernen Sie die Samenschalen mit einer Pinzette, trennen Sie die Keimblättern und mit einem Skalpell entfernen Sie die Embryonen. Hinweis:Embryonen können verworfen oder verwendet werden, um neue Pflanzen zu regenerieren.
  2. Schneiden Sie die einzelnen Keimblatt in der Mitte mit einem Skalpell. Um Austrocknung zu vermeiden, halten Sie die Schnittsamenstücke in sterilem Wasser, bis alle Samen verarbeitet werden.
  3. Haben vorbereitet Petrischalen mit sterilem Wasser-Agar (1,5% Agar / Wasser; w / v), eine für jeweils drei Samenstücke. Machen Sie kleine Dellen im Agar mit einer Pinzette, kurz tupfen Sie das überschüssige Wasser von Saatgut Stücke auf sterile Papierhandtücher, und legen Sie dann die Samenstücken (Schnittfläche nach oben) auf den Wasser / Agar-Platten.
  4. Aus einer frischen Kultur von Aspergillus flavus aflatoxigenic NRRL 3357 in Czapeks Agarmedium bei 25 ° C für 10 Tage gezüchtet, Eine Suspension von 50.000 Sporen pro ul SDW mit einem Hämocytometer gezählt.
  5. Legen Sie 2 ul der Sporensuspension auf den Schnittflächen jedes Halbkeimblattstück vermeiden Abfluss an den Seiten, um sicherzustellen, dass die Sporen gehen auf das Samengewebe, die RNAi (Abbildung 4) birgt ausgesetzt.

    Figur 4
    Abbildung 4. Inokulation und Inkubation für Aflatoxin-Analyse. Top: Halbkeimblatt, Inokulation mit Sporensuspension und Aspergillus flavus Mycelwachstum Halb cotyledon nach 24-stündiger Inkubation Unten: links:. Inkubation von 48 h auf 1,5% Agar; Zentrum: Inkubation für 72 Stunden auf 1,5% Agar; rechts:. Beispiel falsche Versuchsaufbau, Inkubation für 72 Stunden auf 0,5% Agar Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    1. Die Petrischalen geimpft, und nicht-inokulierte Halb Kotyledonen Inkubieren bei 30 ° C im Dunkeln bis zur Probenahme.

    4. Probenahme für die Analyse auf Aflatoxine und Genexpression

    1. Proben werden indreifach an den 24, 48 und 72 Stunden (optional 96 hr) Inkubation, sowohl für die RT-PCR und Analysen auf Aflatoxine, jede Wiederholung als ein Stück (Hälfte Keimblatt). Wählen Sie Stichproben aus verschiedenen Platten an jedem Probenahmetermin. Verwendung eines Gewebes, Agar und überschüssige Pilzsporen leise, bevor Samenstücke in Fläschchen oder Röhrchen entfernen.
    2. Für die Analyse auf Aflatoxine, platzieren Sie jede Wiederholung (ein Stück) in einer 4-ml-Glas Schraubverschluss Fläschchen und bei -80 ° C. Hinweis: Aufgrund der chemischen Stabilität von Aflatoxinen, Proben können in diesem Zustand für mehrere Monate (in den aktuellen Experimenten in der Regel 1-2 Monate) gelagert werden.
    3. Für RT-PCR Ort jedes Replikat (ein Stück) in bereits vorbereitete 2 ml Schleif Röhrchen mit zwei Edelstahlkügelchen (2,5 mm Durchmesser) und drei Zirkoniumkügelchen (2 mm Durchmesser).
    4. Sofort einzufrieren (vorzugsweise in flüssigem Stickstoff) aller Proben und halten sie bei -80 ° C bis zur Verarbeitung.

    5. Aflatoxin Analyse einzelner Halb Cotyledon Stück

    1. Verwenden Sie die A. flavus beimpften Proben für diese Analyse. Bringen Proben auf Raumtemperatur für etwa 30 Minuten, fügen Sie vier Bänden (in der Regel 2-3 ml; w / v) Methanol (halten Eintrag zur späteren Berechnungen), schließen Sie die Kappen, und Inkubation O / N (~ 16 Stunden) in der dunkel ohne Rühren.
    2. Legen Sie eine Fritte in einen passenden 1,5 ml Propylenminisäule, 200 mg Grund Al 2 O 3 und die Kappe mit einem anderen Fritte wie zuvor 36 beschrieben; Dann setzen Sie ein Ultra-High Performance Liquid Chomatographer (UPLC) Autosamplergefäß unter der Spalte nahe genug, um mögliche Verdampfung des Eluats zu vermeiden.
    3. In einer Einwegglasteströhrchen (keine Kunststoff), legen Sie 0,5 ml der in Schritt 4.1 erhaltene Methanolextrakt, 0,5 ml Acetonitril, mischen mit einer Pipette und gelten 0,5 ml der Mischung in die in Schritt 4.2 vorbereitet Spalte. Erlauben Elution in die Autosamplergefäß durch die Schwerkraft (nicht Druck ausüben). Elution dauert in der Regel 2-4 min, in der Nähe the Ampulle sofort mit einem UPLC kompatibel Kappe mit Septum. Die Durchstechflaschen bei Raumtemperatur und noch am selben Tag zu analysieren auf einer UPLC.
    4. Zur Trennung von Aflatoxinen, Ort, Autosampler-Fläschchen, die Probe Eluate und Autosampler-Fläschchen mit Aflatoxin-Standards (B 1 und B 2 bei Verwendung von A. flavus) in einem UPLC Instrument mit einem passenden UPLC Quartär Solvent Manager, UPLC Probenmanager, UPLC Fluorescent-Detektor ausgestattet, und ein C 18 2,1 mm x 50 mm, 1,7 & mgr; m-Säule.
      1. Verwenden einer isokratischen mobilen Phase aus Wasser / MeOH / CH 3 CN (64:23:13, v / v / v) Mischung besteht, bei einer Fließrate von 0,30 ml min -1. Erhalten Chromatogramme Sicherstellung einer stabilisierten Basislinientrennung für die genaue Berechnung der Aflatoxin-Konzentration nach Herstellerangaben 37.
      2. Bestätigen die Identität von Aflatoxin durch den Erhalt ihrer massenspektralen Daten und deren Vergleich mit den veröffentlichten Daten 38. Verwenden Sie ein iam Fallenmassenspektrometer mit einer ESI-Schnittstelle und entsprechender Software entsprechend den Anweisungen des Herstellers ausgestattet.
    5. Bestimmen Sie Konzentrationen von Aflatoxinen durch Bezugnahme auf Eichkurven durch die Injektion von verschiedenen Mengen von entsprechenden kommerziellen Standards der Aflatoxine B 1, B 2 erhalten, G 1 und G 2 wie von der UPLC Hersteller vorgeschlagenen und von der Software 37 bestimmt.
    6. Platz Samenstücke bereits mit Methanol für O / N (~ 16 Stunden) Gefriertrocknung gewonnen, in Einzelglasfläschchen, um ihre Trockengewicht zu bestimmen. Dann berechnen Aflatoxin-Konzentration in ng. G -1 Trockengewicht von Saatgut Stück.
    7. Für die Analyse der Daten, wandeln Aflatoxin Ergebnisse zur Anmeldung (ng. G -1 +1), gefolgt von Tukey-Test für Mittel Vergleiche.

    6. Gene Expression, RT-PCR-Verarbeitung von Proben

    1. Nehmen Sie die 2 ml Schleif Röhrchen enthaltening Proben aus dem -80 ° C Gefrierschrank und unmittelbar (ohne Auftauen) schleifen sie in einer Perlmühle Homogenisator bei 3.100 Upm für 40 sec, dann auf die RNA-Extraktion mit Trizol verfahren nach den Anweisungen des Herstellers.
    2. Vorbereitung cDNA aus jeder Probe unter Verwendung von 1 ug RNA und gleiche Mengen von Oligo dT und zufälligen Hexameren, stellen eine 1: 8-Verdünnung der cDNA und verwenden 2 ul pro Reaktion in RT-PCR (wie zuvor beschrieben, 39).
      1. Zum Nachweis der Expression von RNAi INSERT Primer: RT_5X_1_105F: 5'GGTGGCATTGGACCGTCTTG-3 ', RT_5X_1_232R: 5'-CGCATCGAGGACAGGTTGTG-3'; und RT_5X_2_95F: 5'-CCATGTTTCTGGTGGCATTG-3 ', RT_5X_2_229R: 5'-ATCGAGGACAGGTTGTGTTG-3'.
      2. Zum Nachweis der Expression des auswählbaren Marker NPTII, die Verwendung von Primern: RT_NPTII_1_6871F: 5'-CTCGCTCGATGCGATGTTTC-3 ', RT_NPTII_1_7004R: 5'-GCAGGATCTCCTGTCATCTC-3'. Verwenden Sie das Housekeeping-Gen Actin zur Standardisierung und Primer: Actin-Fw: CACATGCCATCCTTCGATTG; Actin-Rv: CCAAGGCAACATATGCAAGCT 40.
    3. Analysieren Sie die Ergebnisse nach Delta-Delta-C-T-Verfahren 41 für Actin Expression standardisiert. Repräsentieren die Ergebnisse als Zunahme verglichen mit der Kontrolle.

Representative Results

Plasmid p5XCAPD wurde als ein Derivat von pCAPD 29 gemacht, und benutzte es, um Erdnuss-Pflanzen zu transformieren; Dieser Vektor trägt inverted repeats von fünf kleine Fragmente, die jeweils 70-80 bp, von Aflatoxin-Synthesegene von A. flavus durch ein Intron (Figur 1) getrennt. Fragmente AFL2G_07224 (AFLR) AFL2G_07223 (AFLs oder aflJ) AFL2G_05027 (Aflatoxin Effluxpumpe aflep) AFL2G_07228 (AFLC / pksA / pksL1) und AFL2G_07731 (PES1) wurden für das Konstrukt Zahlen auf Figur 1 entsprechen A, . flavus Genomannotation in Broad Institute, Cambridge, MA, und der Literatur 42. Eine Gesamtzahl von 99 Erdnuss-Linien wurden, nachdem sie durch den Transformationsprozess regeneriert, 50 waren PCR positiv für NPTII von STN-PCR nachgewiesen, und 33 Linien waren PCR-positiv und produziert Samen. Nur sieben PCR-positiven Linien wurden klonal vermehrt und durch die Präsentation getestett Verfahren für Aflatoxin Akkumulation, alle sieben zeigte zwischen 60% und 100% weniger Aflatoxin Akkumulation als die Kontrolle. Hier zeigen wir Ergebnisse von zwei dieser sieben Zeilen. So individuell transgenen Events zu produzieren in der Regel wenige Samen, wurde eine Methode entwickelt, um eine minimale Anzahl von Samen, während noch in der Lage, parametrischen statistischen Analyse zu tun zu verwenden. Ein Flussdiagramm der Probenvorbereitung und Versuchsaufbau ist in Figur 5 und Tabelle 1 gezeigt. Obwohl die erste Generation der transgenen Samen typischerweise hemizygot, es erwartet wird, dass die Zelle zu Zelle und systemischen Bewegung small interfering RNA (siRNA) erzeugten durch RNA-Interferenz sollte Aflatoxin-Synthese Silencing verleihen der gesamten Anlage.

Figur 5
Abbildung 5. Schematische Ablaufdiagramm des Verfahrens zur Wirksamkeit der RNAi in Schweigen zu analysieren Aspergillus Aflatoxin-Synthesegene in Erdnusskerne. Grafische Darstellung der Arbeitsabläufe bei der Verarbeitung von Erdnuss Proben für die Genexpression oder Aflatoxin-Analyse. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

RNAi Erdnusslinien 288-72 und 288-74 zeigte Präsenz des NPTII wählbaren maker, wenn sie von STN-PCR getestet, sind Gel-Abschnitte in Abbildung 6 (oben) gezeigt, original Bilder sind von den Autoren auf Anfrage. Plasmid pCAPD wurde nicht zur Kontrolle der Umwandlung verwendet, da es inverted repeats von zwei Genen Cmr (Chloramphenicol-Resistenz) und CcdB (Toxin) unbekannter Wirkung auf Pflanzen kodiert. PCR-negativ Erdnussleitung 288-9 und andere, die durch den Regenerationsprozess ging und wurde in den gleichen Bedingungen wie RNAi Linien gewachsen, wurden als negative con verwendettrol.

Figur 6
. Abbildung 6. Nachweis von Transgenen und Echtzeit-Expression von RNAi Einsatz Top: Single-Tube, Nested PCR-Nachweis von transgenen Linien Erdnuss RNAi-288-72 und RNAi-288-74, positive Pflanzen. Kontrollen: W (Wasser), PP (positive Pflanze), MM (Master-Mix), p (Plasmid p5XCAPD); Fraktionen 2.1 4.1 8.1 16.1 stellen 2-fachen Verdünnungen von DNA Unten:. Real-Time-PCR-Nachweis der Expression des RNAi einfügen (Primer-Sets: RT_5X_1, RT_5X_2, wie in Abbildung 1, auf unreifen ( gelb) und reifen (braun) Keimblätter der transgenen Linien 24 und 48hr Inkubation; graue Linie: C T = 1. Histogramme repräsentieren die Mittelwerte und Standardfehlerbalken (T) von drei biologischen Probenmit drei technische Replikate. Die relative Quantifizierung der RNAi Einsatz normalisiert in Bezug auf das Housekeeping-Gen Actin als interne Kontrolle und Vergleichs fache Expression des Transgens, berechnet als in 5.2.2 und 5.3 beschrieben. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Um die Wirksamkeit von Pflanzenwirts RNAi-vermittelte Potentialsteuerung von Aflatoxin Akkumulation zu testen, wurden frisch geernteten Conidien von Aspergillus flavus NRRL 3357 an der Schnittfläche des Halb Cotyledonen aus dem die Embryonen und Samenschale entfernt worden waren aufgebracht (Figuren 3, 4). A. flavus NRRL 3357, für die das Genom sequenziert wurde und war die Grundlage für die Gestaltung p5XCAPD, wurde freundlicherweise von Dr. Horn an USDA-ARS-NPRL vorgesehen. Die sich ergebende Pilz Invasion Halb cotyledon nach 24, 48 und 72 h bei 30 ° C zeigen, n in Fig. 4 Beispiele für das beimpfte Halb Kotyledonen wurden bei 24 gesammelt, 48, 72, 96 h Inkubation und durch LC-MS für die vier Haupt Aflatoxin B 1, B 2, G 1 und G 2 mit UPLC analysiert und bestätigt ; Ergebnisse sind in 6 gezeigt. Aflatoxin-Konzentrationen wurden unter Verwendung eines veröffentlichten Verfahrens mit Modifikationen 36 bestimmt. Bei 96-stündiger Inkubation, Keimblätter beginnen, durch die Pilzinfektion zerfallen. RNAi Linie 288-72 eine deutlich geringere Aflatoxine als die Kontrolle zu allen Stichprobendaten in unreifen Keimblätter und höchstens Probenahmetermine in den reifen Einsen. RNAi Linie 288-74 zeigten signifikant niedrigere Aflatoxinen höchstens Probenahmetermine. Signifikanzniveaus von Tukey-Tests sind mit einem Stern in der Grafik der 7 angegeben ist.

g7.jpg "/>
. Abbildung 7. Aflatoxine B 1 und B 2 in Halberdnusskeimblätter nach der Inkubation (24, 48, 72 und 96 h) mit Aspergillus flavus Steuerung: Samen 288-9 nicht-transgenen Linie; RNAi: Samen von RNAi-288-72 und RNAi-288-74, transgen für RNAi p5XCAPD zu fünf Aflatoxin-Synthesegene zum Schweigen zu bringen. (A) Aflatoxin B 1 in reifen Samen (braun); (B) Aflatoxin B 2 reifen Samen; (C) Aflatoxin B 1 in unreifen Samen (gelb) und (D) Aflatoxin B 2 in unreifen Samen. Durchschnittswerte mit den entsprechenden Standardfehlerbalken (T) von doppelten biologischen Proben dargestellt. Statistisch signifikante Unterschiede Tukey-Test *: p ≤ 0,05, **: p ≤ 0,01, ***: p ≤ 0,001.s: //www.jove.com/files/ftp_upload/53398/53398fig7large.jpg "target =" _ blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Insgesamt RNAi-288-72 zeigte während des gesamten Experiments (24 bis 96-stündiger Inkubation), eine 94% bis 100% Reduktion der Aflatoxin B 2 und 90% bis 100% Reduktion der Aflatoxin B 1 im Vergleich zu der Kontrolle. RNAi-288-74 zeigte eine 63% -100% Reduzierung der Aflatoxin B 2 und 60% -100% Reduzierung der Aflatoxin B 1, Abbildung 7.

Primer für die Real-Time PCR-Nachweis der Expression des RNAi Einsatz verwendet werden, in Abbildung 1 dargestellt. Die Erdnuss-Saatgut Keimblätter wurden ohne Embryonen untersucht, um ihre natürlichen Abwehrkräfte zu entfernen, und in der Lage, die potenziellen Auswirkungen von RNAi auf der die meisten exponierten Bereich erfassen Pilz-Invasion, die Keimblätter. Die Expression des RNAi Einsatz in unreifen Keimblätter (gelb) der Linie 288 bis 74 von Primersatz RT_5X_1 erkannt war das Vierfache über dem C T nachgewiesen (1, 6). Die Expression von RNAi-Insert wurde nicht in reifen Keimblätter bei 24 Stunden oder auf reife oder unreife Keimblätter bei 48-stündiger Inkubation, 6 (unten) festgestellt.

Peanut-Linie Zeitpunkt der Probenahme Proben für die RT-PCR Die Proben für die Analyse auf Aflatoxine (beimpft) NUmbra von Saatgut
(nicht geimpften)
Rep 1 Rep 2 Rep 3 Rep 1 Rep 2 Rep 3
RNAi (gelb) 24-Stunden- 1 1 1 1 1 1 4.5
48 Stunden 1 1 1 1 1
72 Stunden 1 1 1 1 1 1
Steuern 24-Stunden- 1 1 1 1 1 1 4.5
(gelb) 48 Stunden 1 1 1 1 1 1
72 Stunden 1 1 1 1 1 1

Tabelle 2. Beispiel für kleine Stichproben-Setup, um die Genexpression und Aflatoxin Akkumulation in RNAi Erdnusskerne zu analysieren. Vollständige Analyse des Ausdrucks und Aflatoxine für eine Laufzeitgruppe (dh., Gelb), mit drei Abtastzeiten (24, 48 und 72 h) in dreifacher Ausfertigung würde 4,5 Samen erforderlich, jeweils die Nummer eins in der Tabelle die Hälfte Keimblatt.

Discussion

Pflanzenwirts RNAi-vermittelte Silencing von Genen in Pilzerreger wurde gezeigt, 27,43, jedoch gibt es keine Veröffentlichungen, die die Durchführbarkeit von RNAi-vermittelte Kontrolle Mykotoxin Anhäufung in Pflanzen. Ein begrenzender Faktor für diese Studien in Erdnuss war der Mangel an einer Methode, um eine nicht-Aflatoxin Akkumulation Phänotyp in einzelnen Anlagen zu bewerten, wie Blätter zeigen keine Symptome auf Pilzinfektion der U-Bahn-Schoten. Darüber hinaus wurden die nicht-normal verteilten Ansammlung von Aflatoxinen, und der Bedarf an großen Proben für die chemische Analyse 15,16 die Quantifizierung von möglichen RNAi Wirkung auf einer einzigen Anlage behindert. Die hier vorgestellte Methode besteht aus 72 Stunden Experimente mit fünf Samen zu drei 24-Stunden-Intervall Abtastungen in dreifacher Ausfertigung (Tabelle 1, Abbildung 7) durchzuführen. Vergleich zu den typischen Aflatoxinanalyse, die nicht weniger als 100 g Samen erfordert Unsere Methode ist besonders geeignet für individual transgenen Events Erdnusspflanzen, die anfangs produzieren nicht mehr als zwei oder drei Schoten.

RNA-vermittelte Silencing von Aflatoxin-Synthese wurde von genetischen Transformation von Aspergillus flavus und A. nachgewiesen parasiticus. Seit AFLR ist ein Hauptregulator von Aflatoxin-Produktion in A. flavus und A. parasiticus 44,45, wird es ein interessantes Ziel für die RNA-vermittelte Silencing in Pflanzen. Allerdings haben genetische Variationen in AFLR unter Aspergillus-Arten 46 gezeigt, und diese genetischen Varianten konnten entkommen Schweigen, wenn es keine perfekte Sequenz pass mit der in der Wirtspflanze produziert RNAi-Signal. So war AFLR eines der Ziele für Silencing in vector p5XCAPD, war aber nicht die einzige. Invertierten Wiederholungen des AFLR Gens in A. eingeführt flavus und A. parasiticus durch Transformation führte zu Schweigen und minimale oder keine ProduktIonen von Aflatoxinen 47 (McDonald et al., 2005b). Außerdem verhindert Silencing ufld Gen Aflatoxin Produktion um bis zu 98% in A. flavus und A. parasiticus in direkte Transformation 48. Um die Erfolgswahrscheinlichkeit in unserem System zu erhöhen, wurde Erdnuss mit inverted repeat Fragmente von fünf Gene in Aflatoxin-Produktion in A. beteiligt transformiert flavus. Hier wird gezeigt, dass die Verwendung von p5XCAPD, die für mehrere Gene Silencing in der Aflatoxin-Synthese abzielt, 90% -100% geringere Gehalte an Aflatoxin B 1 und B 2 in Zeile 288 bis 72 erreicht, und 60-100% niedrigeren Ebenen im kumulierten Linie 288 bis 74 im Vergleich zur Kontrolle, wenn die Hälfte Keimblätter wurden mit A. impft flavus, die Figuren 4, 7. Am wichtigsten ist, detektiert dieses Verfahren statistisch signifikanten Unterschiede in Aflatoxin Akkumulation durch Leitungen 288-72, 288-74 gegenüber der Kontrolle während des gesamten Experiments durch Anlegen para STATISTMTics, 7. Angesichts der geringen Stichprobengröße, ist es wichtig, die Notwendigkeit für die Verwendung eines leistungsfähige Methode, um Aflatoxine wurden diese Experimente von UPLC, die eine hohe Auflösung, fünffach höhere Leistung und drei Mal höhere Empfindlichkeit als hat analysiert erkennen markieren HPLC 49.

Die Expression des RNAi Einsatz in 288-74 wurde erst im unreifen Keimblätter (gelb) bei 24-stündiger Inkubation nachgewiesen. Die RNAi Einsatz wurde durch RT-PCR auf reifen Keimblätter von 288 bis 74 bei 24 Stunden festgestellt wird, oder auf einem Laufzeit-Gruppe an 48 Stunden, 6. Das gleiche Phänomen wurde in anderen RNAi transgenen Erdnusslinien beobachtet (Arias, RS 2015 unveröffentlicht), wo in der Regel RNAi-Transkripte wurden nur von unreifen Keimblätter bei 24 Stunden nachgewiesen. RNA-Proben wurden mit DNAse vor der cDNA-Synthese behandelt wurden Daten, normiert auf die Ebene der Actin-Expression und keine Hinweise auf eine DNA-Kontamination wurde beobachtet. Sollten DNA in den Proben vorhanden ist, sollte eswurden in den 48 Stunden Proben nachgewiesen wurden als gut, aber konsequent das war nicht der Fall. Expression unter der Kontrolle des 35S-Promotors nicht immer gleichmäßig ist; sie kann durch Umgebungsbedingungen 50, Art des Gewebes und des Entwicklungsstadiums 51,52 betroffen sein. Zur gleichen Zeit, in der Bahn der RNA-Interferenz, die Rate der mRNA-Zerfall und die Rate der siRNA Zerfall deutlich 53 variieren. Es ist möglich, dass der rasche Abbau der mRNA durch den Mechanismus der RNA-Interferenz kann mRNA-Detektion bei 48-stündiger Inkubation verhindert. Ob Abwesenheit der Expression in 48 Stunden wegen der niedrigen 35S-Promotor angetrieben Transkription war, oder um schnelle Verschlechterung der dsRNA durch Dicer bleibt zu beantworten. So Erkennung von kleinen RNAs durch Hochdurchsatz-Sequenzierung einen besseren Einblick auf die Prozesse durch RNAi 54 stattfinden würde in diesen Experimenten. Da RNA silencing breitet systemisch, insbesondere über das Phloem von photosynthasse Quellen sinkt Saccharose (in diesem Fall Erdnusssamen) 55, das Silencing von Aflatoxin-Synthese kann in Saatgut ohne lokale Expression des RNAi Einsatz kommen. Viel Forschung bleibt noch zu tun, um den Schwellenwert von small interfering RNAs (siRNAs) notwendig, Aflatoxin Ansammlung im Samen zu verhindern, zu ermitteln. Es ist wichtig, die Tatsache, dass sowohl die mRNA-Expression der RNAi-Konstrukt (Abbildung 6) zu unterstreichen, und die Ansammlung von Aflatoxin B 1 und B 2 (Figur 7) zeigten unterschiedliche Ergebnisse für unreife (gelb) vs. reife (braun) Keimblätter. Peanut Pflanzen haben unbestimmte Wachstum, das heißt, bei der Ernte eine Reihe von Reife Schoten, 2 präsentieren sie. Darüber hinaus Körner verschiedener Reifegruppen unterscheiden sich in ihrer chemischen Zusammensetzung, z. B. 2,4% Saccharose in unreifen Samen, und 1,9% reifen Samen unter dem gleichen Feldbedingungen 56,57. Um somit den tatsächlichen efficienc versteheny der RNA-vermittelten Kontrolle von Aflatoxin Akkumulation, ist es wichtig, bis zur Endfälligkeit zu Gruppen getrennt zu analysieren.

Eine natürliche Abwehr von Erdnusskernen ist die Herstellung von Phytoalexine, die in der Vielfalt der Verbindungen hergestellt und ihre relativen Mengen je nach Laufzeit der Samen und Umweltbedingungen 58-61 variiert, und es ist in Embryonen besonders höher im Vergleich zu 62 Keimblätter. Embryos haben auch deutlich höhere Konzentrationen von Nukleinsäuren, sowohl DNA als auch RNA, als die Keimblätter (Arias RS, nicht veröffentlicht). Wie Erdnuss Samen reifen, Veränderungen in ihrer Physiologie und chemische Zusammensetzung auftreten 63. Phenolischen Antioxidantien in Erdnuss testa Form kondensierte Tannine mit fungistatische Aktivität 64; Dies zeigt sich auch in der Mesokarp Farbe, die Reifestadien, gelb bis schwarz 35 reflektiert, wie der Gehalt an Tanninen und phenolische Verbindungen mit einer Laufzeit 65 erhöht. Somit Gegenwart tESTA und Embryonen im Versuch aufgrund ihrer antimikrobiellen Eigenschaften konnten Pilzwachstum begrenzt sind und daher überschätzt die Wirkung von RNAi silencing daher wurden sie entfernt. Auch die Entfernung der Samenschale und Embryonen hilft den Quellen der Variation in der Analyse zu begrenzen, als die Hälfte Keimblatt, die der Embryo mehr Phytoalexine und RNA-Gehalt haben, trägt.

Zusätzlich zu der Analyse durch Reife Gruppen und die Entfernung der Samenschale und Embryo in diesen Experimenten ist es wichtig, darauf hinzuweisen, einige Bemerkungen: a) wenn Ergebnisse sind bis zu 96 h Inkubation zeigt, ist es ratsam, nicht mehr als 72 verwenden, hr, um konsistente Ergebnisse zu erhalten, wie Samen bekommen von 96 Stunden abgebaut; und b) der Erwägung, dass die Hälfte Keimblätter aus dem gleichen Samen, wenn auch zufällig abgetastet werden, nicht vollkommen unabhängige Stichproben darstellen, RT-PCR und Aflatoxin Akkumulation im transgenen Ereignisse zeigten minimale Unterschiede zwischen den Samen. Auch eine genaue Pilzsporen zählen, Inokulum Volumens von 2 & mgr; l, und die Anwendung von Sporen an der Schnittfläche der Cotyledonen Vermeidung tropft auf den Seiten sind wichtig, um sicherzustellen, dass die gekeimten Sporen werden dem Pflanzengewebe freigelegt. Das Wasser / Agar auf den Platten sollte in 1.5% (w / v), bewirkt weichere Agar Abfluss von Sporen wie im letzten Bild von Figur 4 (unten) gezeigt ist. , Sollte die Verfügbarkeit von einem bestimmten Ereignis transgene Saatgut beschränkt ist, kann die Probenahme in doppelter Ausführung statt dreifacher Ausfertigung zu erhalten ähnliche Ergebnisse (dh 7) durchgeführt werden jedoch wird dreifachen Proben helfen, den Standardfehler zu reduzieren. Die einzige Einschränkung dieses Verfahrens ist, dass es ein hochempfindliches System (UPLC) Aflatoxin Erkennung / Quantifizierung erfordert, aber gleichzeitig verringert dies die Wahrscheinlichkeit einer Überschätzung der Wirkung von RNAi sollte Aflatoxine nicht weniger empfindlichen Verfahren nachgewiesen werden.

Abschließend bietet diese Methode zum ersten Mal einen zuverlässigen Ansatz für die UntersuchungWirkung von RNAi bei der Kontrolle von Aflatoxinen. Reduzierung der Zeit für ein Experiment von einer gesamten Anbausaison um weniger als eine Woche, wird diese Methode enorm beschleunigen die Forschung über RNAi-Erdnuss / Aspergillus Pathosystem in Richtung der Abschwächung und / oder Beseitigung von Aflatoxinen.

Materials

Name Company Catalog Number Comments
Primers, oligonucleotides DNA Technologies, Coralville, IA, USA n/a
Dneasy Plant Mini Kit Qiagen, Valencia, CA 69106
Czapek Dox agar medium Oxoid, by Thermo Fisher Scientific, Waltham, MA CM0095
Agar Thermo Fisher Scientific, Waltham, MA BP 1423
Freezer -80 °C n/a n/a
Aluminum Oxide, Al2O3 Fisher Scientific A941
SPE Reservoirs 1.5 ml Grace Davison Discovery Scientific 210011
Frits for 1.5 ml SPE reservoir Grace Davison Discovery Scientific 211401
Autosampler vials Waters Corporation, Milford, MA 186005221
Waters Acquity Ultra-Performance Liquid-Chromatography (UPLC) instrument; UPLC-H-Class Quaternary Solvent Manager; UPLC Sample Manager; UPLC Fluorescent detector (FLR); UPLC BEH C18 2.1 mm x 50 mm, 1.7 mm column Waters Corporation, Milford, MA
Finnigan LCQ Advantage MAX ion trap mass spectrometer, with Xcalibur version 1.4 software Thermo Electron Corp., San Jose, CA
Aflatoxin standards, B1, B2, G1 and G2 Sigma-Aldrich, St. Louis, MO A6636; A9887; A0138; A0263
Systat Software 12.2 SYSTAT Software Inc., Point Richmond, CA
Trizol reagent Invitrogen, CA 15596-018
SuperScript III First Strand Synthesis Super Mix Invitrogen, CA 11752-050
ABI 7500 Real-Time PCR Lifetechnologies, Grand Island, NY 4406984
Luria Broth-Miller Fisher Scientific R453642
pENTR1A Invitrogen, CA A10462
LR Clonase II enzyme mix Invitrogen, CA 11791-020
T4 DNA Ligase NEB Biolabs M0202L
Gelrite Sigma-Aldrich, St. Louis, MO G1919
Acetosyringone Sigma-Aldrich, St. Louis, MO D134406
QIAcube robot workstation Qiagen, Valencia, CA 9001292
Antibiotics: kanamycin, cefotaxime, gentamicin; streptomycin Goldbio, St. Louis, MO cef.: C-104-25; kan: K-120-5; gent.: G-400-1; strep.: S-150-50
Platinum Taq DNA Polymerase High Fidelity Invitrogen, CA 11304-029

DOWNLOAD MATERIALS LIST

References

  1. Williams, J. H., et al. Human aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences, and interventions. The American Journal of Clinical Nutrition. 80, 1106-1122 (2004).
  2. American Association for Cancer Research: AACR. An evaluation of chemicals and industrial processes associated with cancer in humans based on human and animal data: IARC Monographs Volumes 1 to 20. Cancer Research. 40, 1-12 (1980).
  3. Turner, P. C. The molecular epidemiology of chronic aflatoxin driven impaired child growth. Scientifica. (2013).
  4. Rasooly, R., Hernlem, B., He, X., Friedman, M. Non-linear relationships between aflatoxin B1 levels and the biological response of monkey kidney vero cells. Toxins (Basel). 5, 1447-1461 (2013).
  5. Gong, Y. Y., et al. Determinants of aflatoxin exposure in young children from Benin and Togo, West Africa: the critical role of weaning. International Journal of Epidemiology. 32, 556-562 (2003).
  6. Eaton, D. L., Groopman, J. D. The toxicology of aflatoxins: human health, veterinary, and agricultural significance. Academic Press. (1994).
  7. Murugavel, K. G., et al. Prevalence of aflatoxin B1 in liver biopsies of proven hepatocellular carcinoma in India determined by an in-house immunoperoxidase test. Journal of Medical Microbiology. 56, 1455-1459 (2007).
  8. Wang, J. S., et al. Hepatocellular carcinoma and aflatoxin exposure in Zhuqing Village, Fusui County, People's Republic of China. Cancer Epidemiology, Biomarkers & Prevention. 10, American Association for Cancer Research. 143-146 (2001).
  9. Azziz-Baumgartner, E., et al. Case-control study of an acute aflatoxicosis outbreak, Kenya, 2004. Environmental Health Perspectives. 113, 1779-1783 (2005).
  10. Lye, M. S., Ghazali, A. A., Mohan, J., Alwin, N., Nair, R. C. An outbreak of acute hepatic encephalopathy due to severe aflatoxicosis in Malaysia. American Journal of Tropical Medicine and Hygiene. 53, 68-72 (1995).
  11. Villers, P. Aflatoxins and safe storage. Frontiers in Microbiology. 5, 158 (2014).
  12. Kensler, T. W., Roebuck, B. D., Wogan, G. N., Groopman, J. D. Aflatoxin: A 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences. 120, S28-S48 (2011).
  13. Dorner, J. W., Cole, R. J., Wicklow, D. T. Aflatoxin reduction in corn through field application of competitive fungi. Journal of Food Protection. 62, 650-656 (1999).
  14. Cotty, P. J., Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic-pathway enzymes. Applied and Environmental Microbiology. 60, 2248-2251 (1994).
  15. Whitaker, T. B. Standardisation of mycotoxin sampling procedures: an urgent necessity. Food Control. 14, 233-237 (2003).
  16. Whitaker, T. B., Dorner, J. W., Giesbrecht, F. G., Slate, A. B. Variability among aflatoxin test results on runner peanuts harvested from small field plots. Peanut Science. 31, 59-63 (2004).
  17. Fire, A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  18. Rafael, D., et al. EMT blockage strategies: Targeting Akt dependent mechanisms for breast cancer metastatic behaviour modulation. Current Gene Therapy. (2015).
  19. Li, G., Chang, H., Zhai, Y. P., Xu, W. Targeted silencing of inhibitors of apoptosis proteins with siRNAs: a potential anti-cancer strategy for hepatocellular carcinoma. Asian Pacific. Journal of Cancer Prevention: APJCP. 14, 4943-4952 (2013).
  20. Koldehoff, M. Targeting bcr-abl transcripts with siRNAs in an imatinib-resistant chronic myeloid leukemia patient: challenges and future directions. Methods in Molecular Biology. 1218, 277-292 (2015).
  21. Zhang, J., et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. 347, 991-994 (2015).
  22. Ajjappala, H., Chung, H. Y., Sim, J. S., Choi, I., Hahn, B. S. Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. 241, 773-787 (2015).
  23. Jose, A. M., Hunter, C. P. Transport of sequence-specific RNA interference information between cells. Annual Review of Genetics. 41, 305-330 (2007).
  24. Vazquez, F., Hohn, T. Biogenesis and biological activity of secondary siRNAs in plants. Scientifica. Hindawi Publishing Corporation. (2013).
  25. Tinoco, M. L. P., Dias, B. B. A., Dall'Astta, R. C., Pamphile, J. A., Aragao, F. J. L. In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA. BMC Biology. 8, (2010).
  26. Govindarajulu, M., Epstein, L., Wroblewski, T., Michelmore, R. W. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce. Plant Biotechnology Journal. (2014).
  27. Yin, C., Jurgenson, J. E., Hulbert, S. H. Development of a host-induced RNAi system in the wheat stripe rust fungus Puccinia striiformis f. sp. tritici. Molecular Plant-Microbe Interactions. 24, 554-561 (2011).
  28. Ghag, S. B., Shekhawat, U. K., Ganapathi, T. R. Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium. wilt in banana. Plant Biotechnology Journal. 12, 541-553 (2014).
  29. Filichkin, S. A., et al. Efficiency of gene silencing repeats vs. transitive RNAi in Arabidopsis: direct inverted vectors. Plant Biotechnology Journal. 5, 615-626 (2007).
  30. Sciaky, D., Montoya, A. L., Chilton, M. D. Fingerprints of Agrobacterium Ti Plasmids. Plasmid. 1, 238-253 (1978).
  31. Clark, D. J., Maaloe, O. DNA Replication and Division Cycle in Escherichia coli. Journal of Molecular Biology. 23, 99-112 (1967).
  32. Murashige, T., Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plantarum. 15, 473-497 (1962).
  33. Srinivasan, T., Kumar, K. R. R., Kirti, P. B. Establishment of efficient and rapid regeneration system for some diploid wild species of Arachis. Plant Cell Tissue and Organ Culture. 101, 303-309 (2010).
  34. Gomes, A. L. V., et al. Single-tube nested PCR using immobilized internal primers for the identification of dengue virus serotypes. Journal of Virology Methods. 145, 76-79 (2007).
  35. Williams, E. J., Drexler, J. S. A non-destructive method for determining peanut pod maturity. Peanut Science. 8, 134-141 (1981).
  36. Sobolev, V. S., Dorner, J. W. Cleanup procedure for determination of aflatoxins in major agricultural commodities by liquid chromatography. Journal of AOAC International. 85, 642-645 (2002).
  37. Empower Software, Getting Started Guide. Waters Corporation. Milford, MA. Available from: http://sites.chem.colostate.edu/diverdi/C431/experiments/high%20pressure%20liquid%20chromatography/references/Empower%20getting%20started%2071500031203rA.pdf (2002).
  38. Biselli, S., Hartig, L., Wegner, H., Hummert, C. Analysis of Fusarium. toxins using LC-MS-MS: Application to various food and feed matrices. LC GC North America. 23, 404-413 (2005).
  39. Arias, R. S., Sobolev, V. S., Orner, V. A., Dang, P. M., Lamb, M. C. Potential involvement of Aspergillus flavus laccases in peanut invasion at low water potential. Plant Pathology. 63, 353-363 (2014).
  40. Dang, P. M., Chen, C. Y., Holbrook, C. C. Evaluation of five peanut (Arachis hypogaea) genotypes to identify drought responsive mechanisms utilising candidate-gene approach. Functional Plant Biology. 40, 1323-1333 (2013).
  41. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative C-T method. Nature Protocols. 3, 1101-1108 (2008).
  42. Amaike, S., Keller, N. P. Aspergillus flavus. Annual Review of Phytopathology. 49, 107-133 (2011).
  43. Nowara, D., et al. HIGS: Host-induced gene silencing in the obligate biotrophic fungal pathogen Blumeria graminis. Plant Cell. 22, 3130-3141 (2010).
  44. Woloshuk, C. P., et al. Molecular characterization of aflR, a regulatory locus for aflatoxin biosynthesis. Applied and Environmental Microbiology. 60, 2408-2414 (1994).
  45. Price, M. S., et al. The aflatoxin pathway regulator AflR induces gene transcription inside and outside of the aflatoxin biosynthetic cluster. FEMS Microbiology Letters. 255, 275-279 (2006).
  46. Ehrlich, K. C., Montalbano, B. G., Cotty, P. J. Sequence comparison of aflR from different Aspergillus. species provides evidence for variability in regulation of aflatoxin production. Fungal Genetics and Biology. 38, 63-74 (2003).
  47. McDonald, T., Brown, D., Keller, N. P., Hammond, T. M. RNA silencing of mycotoxin production in Aspergillus and Fusarium species. Molecular Plant Microbe Interactions. 18, 539-545 (2005).
  48. Abdel-Hadi, A. M., Caley, D. P., Carter, D. R., Magan, N. Control of aflatoxin production of Aspergillus flavus. and Aspergillus parasiticus. using RNA silencing technology by targeting aflD. (nor-1) gene. Toxins (Basel). 3, 647-659 (2011).
  49. Swartz, M. E. Ultra performance liquid chromatography (UPLC): An introduction: Separation Science Redefined. LCGC North America. Suppl ement 8. 8-14 (2005).
  50. Maghuly, F., Khan, M. A., Fernandez, E. B., Druart, P., Watillon, B., Laimer, M. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa x serrula. Journal of Biotechnology. 135, 105-116 (2008).
  51. de Mesa, M. C., Santiago-Doménech, N., Pliego-Alfaro, F., Quesada, M. A., Mercado, J. A. The CaMV 35S promoter is highly active on floral organs and pollen of transgenic strawberry plants. Plant Cell Reports. 23, 32-38 (2004).
  52. Sunilkumar, G., Mohr, L., Lopata-Finch, E., Emani, C., Rathore, K. S. Developmental and tissue-specific expression of CaMV 35S promoter in cotton as revealed by GFP. Plant Molecular Biology. 50, 463-474 (2002).
  53. Groenenboom, M. A. C., Maree, A. F. M., Hogeweg, P. The RNA silencing pathway: The bits and pieces that matter. PLoS Computational Biology. 1, 155-165 (2005).
  54. Zhao, D., Song, G. Q. High-throughput sequencing as an effective approach in profiling small RNAs derived from a hairpin RNA expression vector in woody plants. Plant Science: an International Journal of Experimental Plant Biology. 228, 39-47 (2014).
  55. Kamthan, A., Chauduri, A., Kamthan, M., Datta, A. Small RNAs in plants: recent development and application for crop improvement. Frontiers in Plant Science. 6, 208 (2015).
  56. Manda, A., Bodapati, P. N., Rachaputi, N. C., Wright, G., Fukai, S. Aflatoxins and their relationship with sugars in peanut (Arachis hypogaea L). 4th International Crop Science Congress, 2004, Available from: http://www.cropscience.org.au/icsc2004/poster/5/1/3/625_manda.htm (2004).
  57. Uppala, S. S. Factors affecting pre-harvest aflatoxin contamination of peanut (Arachis hypogaea L). Auburn University. (2011).
  58. Sobolev, V. S. Localized production of phytoalexins by peanut (Arachis hypogaea) kernels in response to invasion by Aspergillus species. Journal of Agricultural and Food Chemistry. 56, 1949-1954 (2008).
  59. Sobolev, V. S., Guo, B. Z., Holbrook, C. C., Lynch, R. E. Interrelationship of phytoalexin production and disease resistance in selected peanut genotypes. Journal of Agricultural and Food Chemistry. 55, 2195-2200 (2007).
  60. Sobolev, V. S., Neff, S. A., Gloer, J. B. New stilbenoids from peanut (Arachis hypogaea) seeds challenged by an Aspergillus caelatus strain. Journal of Agricultural and Food Chemistry. 57, 62-68 (2009).
  61. Dorner, J. W., Cole, R. J., Sanders, T. H., Blankenship, P. D. Interrelationship of kernel water activity, soil temperature, maturity, and phytoalexin production in preharvest aflatoxin contamination of drought-stressed peanuts. Mycopathologia. 105, 117-128 (1989).
  62. Sobolev, V. S. Production of phytoalexins in peanut (Arachis hypogaea) seed elicited by selected microorganisms. Journal of Agricultural and Food Chemistry. 61, 1850-1858 (2013).
  63. Basha, S. M. M., Cherry, J. P., Young, C. T. Changes in free amino acids, carbohydrates, and proteins of maturing seeds from various peanut (Arachis hypogaea L.) cultivars. Cereal Chemistry. 53, 586-596 (1976).
  64. Lansden, J. A. Aflatoxin inhibition and fungistasis by peanut tannins. Peanut Science. 9, 17-20 (1982).
  65. Yen, G. C., Duh, P. D., Tsai, C. L. Relationships between antioxidant activity and maturity of peanut hulls. Journal of Agricultural and Food Chemistry. 41, 67-70 (1993).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics