الكشف عن وظيفية غير الترميز المتغيرات الوراثية عن طريق الكهربي التنقل التحول الفحص (EMSA) والحمض النووي تقارب الهطول الفحص (ضبا)

* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Miller, D. E., Patel, Z. H., Lu, X., Lynch, A. T., Weirauch, M. T., Kottyan, L. C. Screening for Functional Non-coding Genetic Variants Using Electrophoretic Mobility Shift Assay (EMSA) and DNA-affinity Precipitation Assay (DAPA). J. Vis. Exp. (114), e54093, doi:10.3791/54093 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

التسلسل والدراسات التنميط الجيني أساس، بما في ذلك دراسات الجينوم على نطاق الرابطة (GWAS)، دراسات المرشح مكان، وأعماق التسلسل الدراسات، وقد حددت العديد من المتغيرات الجينية التي ترتبط إحصائيا مع المرض، وسمة، أو النمط الظاهري. وخلافا للتوقعات في وقت مبكر، وتقع معظم هذه المتغيرات (85-93٪) في مناطق غير الترميز ولا تغيير تسلسل الأحماض الأمينية للبروتينات 1،2. تفسير وظيفة من هذه المتغيرات غير الترميز وتحديد الآليات البيولوجية وربطها لمرض المرتبطة بها، وقد ثبت سمة، أو النمط الظاهري تحديا 3-6. لقد قمنا بتطوير استراتيجية عامة لتحديد الآليات الجزيئية التي تصل المتغيرات إلى النمط الظاهري وسيط مهم - التعبير الجيني. تم تصميم هذا الخط على وجه التحديد لتحديد التشكيل من فريق العمل ملزم المتغيرات الجينية. هذه الاستراتيجية يجمع بين النهج الحسابية وتقنيات البيولوجيا الجزيئية التي تهدف إلى التنبؤالآثار البيولوجية من المتغيرات مرشح في سيليكون، وتحقق هذه التنبؤات تجريبيا (الشكل 1).

شكل 1
الشكل 1: النهج الاستراتيجي لتحليل خطوات غير ترميز المتغيرات الجينية التي لم يتم تضمينها في بروتوكول مفصلة المرتبطة مظللة باللون الرمادي هذا المخطوط الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

في كثير من الحالات، من المهم أن تبدأ من خلال توسيع قائمة المتغيرات بحيث يشمل جميع من في ارتفاع الربط-اختلال التوازن (LD) مع كل متغير يرتبط إحصائيا. LD هو مقياس لجمعية غير عشوائية من أليل على موقعين الكروموسومات المختلفة، والتي يمكن أن تقاس ص 2 الإحصائية 7. ص 2 هو مقياس للينكاجي اختلال التوازن بين الخيارين، مع ص 2 = 1 تدل على الربط المثالي بين الخيارين. تم العثور على الأليلات في LD عالية للمشاركة في فصل على كروموسوم عبر السكان الأسلاف. لا تشمل صفائف التنميط الجيني الحالية كافة المتغيرات المعروفة في الجينوم البشري. بدلا من ذلك، فإنها تستغل LD داخل الجينوم البشري وتشمل مجموعة فرعية من المتغيرات المعروفة التي تعمل كوكلاء للالمتغيرات الأخرى داخل منطقة معينة من LD 8. وهكذا، وهو البديل من دون أي نتيجة البيولوجية قد تترافق مع مرض معين لأنه في LD مع السببية البديل، البديل مع التأثير البيولوجي ذات مغزى. من الناحية الإجرائية، فمن المستحسن لتحويل الإصدار الأخير من 1000 الجينوم المشروع 9 ملفات دعوة البديل (VCF) في الملفات الثنائية متوافقة مع طقطقة 10،11، أداة مفتوحة المصدر للتحليل جمعية الجينوم بأكمله. وفي وقت لاحق، كل المتغيرات الجينية الأخرى مع LD ص 2> 0.8 مع كل فا الجيني المدخلاتويمكن تحديد RIANT كمرشحين. ومن المهم استخدام السكان إشارة المناسب لهذا خطوة- على سبيل المثال، إذا تم تحديد البديل في المواد من أصول أوروبية، وينبغي استخدام البيانات من موضوعات من أصل مماثل للتوسع دينار.

التوسع LD غالبا ما يؤدي إلى العشرات من المتغيرات مرشح، وأنه من المرجح أن جزءا صغيرا فقط من هذه تسهم في آلية المرض. في كثير من الأحيان، أصبح في حكم المستحيل لدراسة التجربة كل من هذه المتغيرات بشكل فردي. ولذا فمن المفيد الاستفادة من آلاف من مجموعات البيانات الجينومية الوظيفية المتاحة علنا ​​كمرشح لتحديد أولويات المتغيرات. على سبيل المثال، اتحاد ترميز 12 قد أنجز الآلاف من تجارب رقاقة وما يليها واصفا ربط TFS والعوامل المشتركة، وعلامات هيستون في مجموعة واسعة من السياقات، جنبا إلى جنب مع البيانات لونين الوصول من التقنيات مثل الدناز تسلسل 13، أي تي أي سي -seq 14، وFAIRE وما يليها 15. DatabASES وخوادم الويب مثل متصفح UCSC الجينوم 16، خارطة الطريق Epigenomics 17، مخطط Epigenome 18، Cistrome 19، وإعادة رسم خريطة 20 توفر حرية الوصول إلى البيانات التي تنتجها هذه وتقنيات تجريبية أخرى عبر مجموعة واسعة من أنواع الخلايا والشروط. عندما يكون هناك الكثير من المتغيرات لدراسة التجربة، وهذه البيانات يمكن استخدامها لتحديد أولويات تلك التي تقع داخل المناطق التنظيمية المحتملة في أنواع الخلايا والأنسجة ذات الصلة. وعلاوة على ذلك، في الحالات التي يكون فيها البديل هو في ذروته في الشذرة وما يليها لبروتين معين، ويمكن لهذه البيانات توفير يؤدي المحتملة فيما يتعلق TF معين (ق) أو العوامل المشتركة التي الملزم قد تؤثر.

بعد ذلك، يتم فحص المتغيرات الناتجة الأولوية تجريبيا للتحقق من صحة توقع البروتين تعتمد على التركيب الوراثي ملزمة باستخدام EMSA 21،22. EMSA يقيس التغير في هجرة بنسبة ضئيلة على غير الحد هلام TBE. وحضنت بنسبة ضئيلة fluorescently المسمى معالمحللة النووي، وربط العوامل النووية في اعاقة حركة جزئية على هلام. في هذه الطريقة، بنسبة ضئيلة أن تربط بين العوامل النووية المزيد من سيقدم على أنه إشارة الفلورسنت أقوى على المسح الضوئي. والجدير بالذكر، EMSA لا تتطلب التنبؤات حول بروتينات معينة التي ستتأثر ملزم.

وبمجرد تحديد المتغيرات التي تقع داخل المناطق التنظيمية توقع وتكون قادرة على العوامل النووية ملزمة بشكل مختلف، واستخدام طرق الحسابية للتنبؤ TF معين (ق) الذي ملزمة لأنها قد تؤثر. ونحن نفضل استخدام CIS-BP 23،24، RegulomeDB 25، UniProbe 26، وJASPAR 27. وبمجرد تحديد مرشح TFS، هذه التنبؤات يمكن اختبار على وجه التحديد باستخدام أجسام مضادة ضد هذه TFS (EMSA-supershifts وضبا-الغرب). ينطوي على EMSA-supershift إضافة الضد-TF محددة لالمحللة النووي وبنسبة ضئيلة. ونتيجة إيجابية في EMSA-supershift هي represented تحولا آخر في الفرقة EMSA، أو خسارة من الفرقة (إعادة النظر في المرجع 28). في ضبا التكميلي، يتم تحضين على الوجهين بنسبة ضئيلة من 5'المعقدة البيروكسيديز تحتوي على البديل و 20 قاعدة الزوج المرافقة النيوكليوتيدات مع المحللة النووي من نوع من الخلايا ذات الصلة (ق) لالتقاط أي عوامل النووية ملزمة على وجه التحديد oligos. ويجمد بنسبة ضئيلة على الوجهين النووي مجمع عامل من قبل streptavidin ميكروبيدات في عمود المغناطيسي. يتم جمع العوامل النووية ملزمة مباشرة من خلال شطف 29،48. ويمكن بعد ذلك التنبؤات ملزم يتم تقييمها بواسطة لطخة غربية باستخدام الأجسام المضادة المحددة للبروتين. في الحالات التي لا توجد توقعات واضحة، أو الكثير من التوقعات، وelutions من البديل سحب هبوطا من التجارب ضبا يمكن إرسالها إلى نواة البروتينات لتحديد TFS مرشح باستخدام مطياف الكتلة، والتي يمكن بعد ذلك يمكن التحقق من صحة استخدام هذه الموصوفة سابقا أساليب.

في ما تبقى من الاعتده، يتم توفير بروتوكول مفصلة عن EMSA وضبا تحليل المتغيرات الجينية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. إعداد حلول والكواشف

  1. عرف النظام تحقيقات الحمض النووي النوكليوتيد للاستخدام في EMSA وضبا.
    1. للحد من البروتين غير محددة ملزمة، تصميم oligos قصيرة (بين 35-45 أزواج قاعدة (بي بي) في الطول) 30، ووضع البديل من مصلحة مباشرة في وسط يحيط بها 17 سنة مضت تسلسل الجيني الذاتية لها. لoligos EMSA، إضافة "fluorophore 5. لoligos ضبا، إضافة علامة 5 "البيوتين.
    2. طلب كل من حبلا الشعور وحبلا لتكملة العكسي. بدلا من ذلك، أمر الطباعة على الوجهين (قبل صلب) oligos. عند تسمية oligos، قاعدة التسمية على الجينوم مرجعية راسخة.
      ملاحظة: "المخاطر" و "غير خطر" تسمية يمكن أن يكون المرض ومشروع معين، في حين أن "المرجعية" و "غير مرجعية" هي أكثر أهمية عالميا.
    3. فور وصول oligos، وتدور لفترة وجيزة إلى أسفل محتويات وresuspend في nuclease خالية من المياه إلى تركيز النهائي من 100 μ. M. متجر معلق السهم عند -20 درجة مئوية. حماية oligos الكلمات الدلالية مع fluorophore من الضوء من خلال التفاف بورق الألمنيوم.
اسم تسلسل
rs76562819_REF_FOR GTAATGCCTTAATGAGAGAG وGTTAGTCATCTTCTCACTTC
rs76562819_REF_REV GAAGTGAGAAGATGACTAAC تي CTCTCTCATTAAGGCATTAC
rs76562819_NONREF_FOR GTAATGCCTTAATGAGAGAG G GTTAGTCATCTTCTCACTTC
rs76562819_NONREF_REV GAAGTGAGAAGATGACTAAC C CTCTCTCATTAAGGCATTAC

الجدول 1: مثال EMSA / ضبا تصميم النوكليوتيد لاختبار SNP بن لالتفاضليدينغ. "المرجع" لتقف على أليل إشارة، في حين أن "NONREF" لتقف على أليل غير مرجعية. "FOR" لتقف على حبلا إلى الأمام، في حين أن "REV" يشير مكملا لها. وينظر الحزب الوطني الاسكتلندي باللون الأحمر.

  1. إعداد استخراج حشوية (CE) عازلة مع تركيز النهائي من 10 ملي HEPES (الرقم الهيدروجيني 7.9)، و 10 ملي بوكل، و 0.1 ملي EDTA في الماء منزوع الأيونات.
  2. إعداد استخراج النووي (NE) العازلة مع تركيز النهائي من 20 ملي HEPES (درجة الحموضة 7.9) و 0.4 M كلوريد الصوديوم، و 1 ملي EDTA في الماء منزوع الأيونات.
  3. إعداد عازلة الصلب مع تركيز النهائي من 10 ملي تريس (درجة الحموضة 7،5-8،0)، 50 مم كلوريد الصوديوم، و 1 ملي EDTA في الماء منزوع الأيونات.

2. إعداد المحللة النووية من الخلايا المستزرعة

ملاحظة: تم تحسين هذا البروتوكول التجريبي باستخدام خطوط الخلايا-B lymphoblastoid، ولكن تم اختبارها في عدة خطوط الخلايا تمسكا / التعليق أخرى غير ذات صلة ويعمل عالميا.

  1. Cultuإعادة الخلايا B lymphoblastoid في معهد روزويل بارك التذكاري (RPMI) 1640 مع 2 مم L-الجلوتامين، و 10٪ الجنين المصل البقري، و1X المضادات الحيوية مضاد فطري تحتوي على 100 وحدة / مل من البنسلين، 100 ميكروغرام / مل من الستربتومايسين، و 250 نانوغرام / مل من أمفوتيريسين B.
    1. البذور على مجموعة من 200،000-500،000 قابلة للحياة خلية / مل واحتضان قوارير عند 37 درجة مئوية مع ثاني أكسيد الكربون بنسبة 5٪ في وضع مستقيم مع قبعات تنفيس أو فضفاضة.
      ملاحظة: نمو الخلايا-B lymphoblastoid يبطئ عندما تصل إلى أكثر من 1،000،000 خلية / مل. تفريق تفجيرات خلية pipetting صعودا وهبوطا عدة مرات والعودة الخلايا 200،000-500،000 خلية / مل للحفاظ على المعدل السريع للنمو.
  2. غسل الخلايا المستزرعة مرتين مع 10 مل كريم الفوسفات الباردة مخزنة المالحة (PBS)، وتدور باستمرار في 4 درجات مئوية، 300 x ج لمدة 5 دقائق وإزالة برنامج تلفزيوني عبر الطموح.
  3. عد الخلايا باستخدام عدادة الكريات و resuspend بيليه ك 1 مل الجليد الباردة برنامج تلفزيوني في 10 7 خلايا.
    ملاحظة: على سبيل المثال، إذا الناشر 2 × 10 7 </ sup> في الخلايا، resuspend في 2 مل برنامج تلفزيوني.
  4. قسامة 1 مل إلى 1.5 مل أنابيب microcentrifuge بحيث يحتوي كل أنبوب 10 7 الخلايا في برنامج تلفزيوني. أجهزة الطرد المركزي في 3300 x ج لمدة 2 دقيقة 4 درجات مئوية، ونضح من برنامج تلفزيوني.
  5. قبل استخدامها، إضافة 1 ملم dithiothreitol (DTT)، 1X الفوسفاتيز المانع، والمانع 1X البروتيني لمخزون العمل من العازلة م. بيليه resuspend الخلايا مع 400 ميكرولتر من العازلة م، واحتضان على الجليد لمدة 15 دقيقة.
  6. إضافة 25 ميكرولتر من 10٪ Nonidet P-40 ومزيج من قبل pipetting. أجهزة الطرد المركزي في 4 درجات مئوية، أقصى سرعة لمدة 3 دقائق. صب وتجاهل طاف.
  7. قبل استخدامها، إضافة 1 ملم DTT، 1X الفوسفاتيز المانع، و1X مثبط البروتياز لمخزون العمل من العازلة NE. بيليه resuspend الخلايا مع 30 ميكرولتر من العازلة NE ومزيج من قبل vortexing.
  8. احتضان عند 4 درجات مئوية في الدوار أنبوب أو على الجليد لمدة 10 دقيقة. أجهزة الطرد المركزي 3300 x ج لمدة 2 دقيقة 4 درجات مئوية.
  9. جمع طاف واضح (المحللة النووي) وقسامة قبل تخزينها في -806؛ C لتجنب متعددة تجميد أذاب دورات التي قد تؤدي إلى تدهور البروتين. ترك قسامة 10 ميكرولتر لقياس تركيز البروتين باستخدام فحص الحمض bichoninic (BCA) 31.

3. الكهربي التنقل التحول الفحص (EMSA)

  1. إعداد جزئية المالية العاملة وEMSA جل.
    1. إذا أمرت oligos في الوجهين، ذوبان الجليد في الأوراق المالية 100 ميكرومتر وتمييع 1: 2000 في المخزن الصلب لتحقيق مخزون العمل 50 نانومتر.
    2. إذا أمرت oligos احد الذين تقطعت بهم السبل، ذوبان الجليد 100 ميكرومتر الأسهم وتمييع 01:10 في المخزن الصلب لتحقيق 100 سهم تعمل نانومتر. الجمع بين 100 ميكرولتر من 100 نانومتر حل تكملة حبلا مع بعضها البعض في أنبوب microcentrifuge.
      1. ضع في كتلة الحرارة على 95 درجة مئوية لمدة 5 دقائق. إيقاف كتلة الحرارة والسماح للoligos لتبرد ببطء إلى درجة حرارة الغرفة لمدة ساعة واحدة على الأقل قبل استخدامها.
    3. قبل تشغيل جل EMSA.
      1. إزالة الشريحة من قبل الصب 6٪ TBE جل وشطف تحت الماء منزوع الأيونات عدة مرات لإزالة أي العازلة من الآبار. إعداد 1 لتر من العازلة 0.5X TBE بإضافة 50 مل من 10X TBE إلى 950 مل من الماء منزوع الأيونات.
      2. تجميع الجهاز الكهربائي للهلام وتحقق من وجود تسرب عن طريق ملء الغرفة الداخلية مع العازلة 0.5X TBE. إذا لم يكن هناك عازلة تسرب الى داخل القاعة الخارجية، وملء الغرفة الخارجي تقريبا ثلثي الطريق.
      3. قبل تشغيل هلام في 100 فولت لمدة 60 دقيقة.
      4. طرد كل بئر مع 200 ميكرولتر من العازلة 0.5X TBE.
  2. إعداد الاحتياطي ملزم ميكس ماجستير.
    1. إعداد 10X العازلة ملزمة مع تركيز النهائي من 100 ملي تريس، 500 ملي بوكل، 10 ملي DTT. 7.5 درجة الحموضة في الماء منزوع الأيونات.
    2. في أنبوب microcentrifuge، وخلق مزيج رئيسية تتكون من الكواشف مشتركة لجميع ردود الفعل (10 ميكرولتر 10X العازلة ملزمة، 10 ميكرولتر DTT / بوليسوربات، 5 ميكرولتر بولي د (IC)، و 2.5 ميكرولتر السلمون الحمض النووي الحيوانات المنوية، الجدول 2). إعداد إضافية 10٪لحساب فقدان وحدة التخزين بسبب pipetting ل.
كاشف اضرب النهائي. Rxn # 1 Rxn # 2 Rxn # 3 Rxn # 4
عالى النقاء المياه إلى 20 ميكرولتر المجلد. 13.5 ميكرولتر 11.98 ميكرولتر 13.5μl 11.98 ميكرولتر
10X الاحتياطي ملزم 1X 2 ميكرولتر 2 ميكرولتر 2 ميكرولتر 2 ميكرولتر
DTT / TW-20 1X 2 ميكرولتر 2 ميكرولتر 2 ميكرولتر 2 ميكرولتر
سمك السلمون الحمض النووي الحيوانات المنوية 500 نانوغرام / ميكرولتر 0.5 ميكرولتر 0.5 ميكرولتر 0.5 ميكرولتر 0.5 ميكرولتر
1μg / ميكرولتر بولي د (IC) 1 ميكروغرام 1 ميكرولتر 1 ميكرولتر 1 ميكرولتر 1 ميكرولتر
استخراج النووي (5.26 ميكروغرام / ميكرولتر) 8 ميكروغرام - 1.52 ميكرولتر - 1.52 ميكرولتر
NE العازلة 1.52 ميكرولتر - 1.52 ميكرولتر -
إشارة أليل بنسبة ضئيلة 50 fmol 1 ميكرولتر 1 ميكرولتر - -
غير المرجعي-أليل بنسبة ضئيلة 50 fmol - - 1 ميكرولتر 1 ميكرولتر

الجدول 2: مثال EMSA رد فعل سيتوص يوضح الجدول مثال EMSA لاختبار الفرضية القائلة بأن هناك ربط TFS إلى SNP محددة تعتمد على التركيب الوراثي.

  1. إضافة nuclease خالية من المياه إلى كل أنبوب microcentrifuge مثل هذا الحجم النهائي بعد إضافة كل الكواشف سيكون 20 ميكرولتر.
  2. إضافة كمية مناسبة (5.5 ميكرولتر) من مزيج الرئيسي إلى كل أنبوب microcentrifuge.
  3. إضافة 8 ميكروغرام من المحللة النووي لأنابيب microcentrifuge المناسبة. تشمل الأنابيب التي تحتوي على جزئية دون استخراج النووي والضوابط السلبية (مثل الجدول 2، Rxn # 1 و Rxn # 3).
    ملاحظة: يجب أن يتم تحديد مبلغ الأمثل للالمحللة في رد الفعل تجريبيا عن طريق المعايرة. عموما، المعايرة مجموعة من 2-10 ميكروغرام من المحللة غير كافية.
  4. إضافة 50 fmol من جزئية إلى أنابيب microcentrifuge المناسبة. نفض الغبار إلى المزيج لفترة وجيزة تدور محتويات إلى أسفل الأنبوب. احتضان لمدة 20 دقيقة في درجة حرارة الغرفة.
    ملاحظة: إذا attemptiنانوغرام في supershift، واحتضان الخليط المحللة مع الأجسام المضادة لمدة 20 دقيقة في درجة حرارة الغرفة قبل إضافة oligos. فمن المستحسن استخدام 1 ميكروغرام من الأجسام المضادة رقاقة الصف حصول على أفضل النتائج.
  5. إضافة 2 ميكرولتر من 10X أورانج تحميل صبغ إلى كل أنبوب microcentrifuge. ماصة صعودا وهبوطا إلى المزيج.
  6. تحميل العينات في مرحلة ما قبل التشغيل 6٪ هلام TBE pipetting صعودا وهبوطا إلى المزيج ثم طرد كل عينة في بئر منفصل. تشغيل هلام في 80 V حتى هاجر الصبغة البرتقال 2/3 إلى 3/4 من الطريق هلام. وهذا ينبغي أن يستغرق حوالي 60-75 دقيقة.
  7. إزالة جل من كاسيت البلاستيك عن طريق التحديق مفتوحة بسكين جل ووضع الجل في وعاء مع العازلة TBE 0.5٪ لمنعها من الجفاف.
  8. وضع الجل على سطح نظام التصوير بالأشعة تحت الحمراء والتوهج، ويجري التأكد من القضاء على أي فقاعات أو الملوثات التي من شأنها عرقلة الصورة.
  9. باستخدام برنامج نظام المسح الضوئي، انقر فوق "اكتساب" علامة التبويبثم حدد "رسم جديد" لرسم مربع في جميع أنحاء المنطقة المقابلة لحيث يقع الجل على سطح الماسح الضوئي.
  10. في قسم "القنوات" من علامة التبويب "اكتساب"، حدد القناة الموافق الطول الموجي للعلامة fluorophore على جزئية. في قسم "الماسح الضوئي"، انقر "معاينة" للحصول على مسح معاينة منخفضة الجودة. ضبط منطقة المسح الضوئي عن طريق سحب المربع الأزرق المحيطة صورة المعاينة المكتسبة وصولا الى جزء من هلام للتصوير.
    ملاحظة: على سبيل المثال، إذا كان استخدام oligos المسمى مع نانومتر fluorophore 700، تأكد من تحديد قناة "700 نانومتر" قبل المسح.
  11. في قسم "الضوابط مسح"، حدد "84 ميكرومتر" خيار القرار و"متوسطة" خيار الجودة. تعيين التركيز لتعويض نصف سمك هلام. ملاحظة: على سبيل المثال، فإن جل 1 مم استخدام تركيز 0.5 ملم الإزاحة.
  12. في قسم "الماسح الضوئي"، انقر "ابدأ" إلى begin الفحص.
    ملاحظة: أثناء الفحص، يمكن في كثير من الأحيان يتم تعديل مخطط السطوع والتباين، واللون يدويا اعتمادا على الشركة المصنعة للنظام المسح الضوئي.
  13. بعد الانتهاء من المسح الضوئي، حدد "صورة" علامة التبويب وانقر على "تدوير أو فليب" في قسم "إنشاء" لتصحيح الاتجاه. حفظ ملف الصورة بالنقر على "تصدير" في القائمة الرئيسية، ثم حدد "واحد صورة عرض."

4. DNA الانجذاب تنقية الفحص (ضبا)

  1. إعداد 5 ميكرومتر الأسهم جزئية العامل.
    1. إذا أمرت oligos في الوجهين، ذوبان الجليد في الأوراق المالية 100 ميكرومتر وتمييع 01:20 في المخزن الصلب لتحقيق مخزون العمل 5 ميكرومتر.
    2. إذا أمرت oligos احد الذين تقطعت بهم السبل، ذوبان الجليد 100 ميكرومتر الأسهم وتمييع 01:10 في المخزن الصلب لتحقيق 10 ميكرومتر الأسهم العمل. الجمع بين 10 ميكرولتر من 10 ميكرومتر فروع متكاملة مع بعضها البعض. ضع في كتلة الحرارة على 95 درجة مئوية لمدة5 دقائق. إيقاف كتلة الحرارة والسماح للoligos لتبرد ببطء إلى درجة حرارة الغرفة قبل استخدامها.
  2. قبل البدء، تدفئة العازلة ملزمة، وانخفاض غسل العازلة صرامة، غسل العازلة عالية الصرامة، وشطف العازلة إلى درجة حرارة الغرفة.
    ملاحظة: تركيز النهائي من 50 نانوغرام / مل بولي د (IC) يمكن أن تضاف إلى المخزن المؤقت ملزم، وانخفاض غسل العازلة صرامة، وغسل العازلة عالية صرامة للحد من إمكانية غير محددة وملزمة من البروتينات إلى oligos.
  3. تحضير مخاليط ملزمة لكل متغير.
    1. مزيج 1 حجم المحللة النووي مع 2 مجلدات من العازلة ملزمة.
      ملاحظة: يجب تحديد المبلغ المطلوب من المحللة تجريبيا نظرا لاختلاف وفرة من TFS. باستخدام بين 100-250 ميكروغرام من المحللة النووية في عمود غير كافية في معظم الحالات.
    2. إضافة 1X المانع الفوسفاتيز، 1X مثبط البروتياز، ومحسن 1X ملزمة (اختياري) ومزيج عبها الأنبوب عدة مرات.
      ملاحظة: 100X ملزمةيتكون محسن من 750 ملي MgCl 2 و 300MM ZnCl 2. إضافة محسن ملزم إذا كان ملزما لفريق العمل على الحمض النووي يعتمد على العوامل المساعدة أو الاختزال. إذا لم يعرف هذه المعلومات، إضافة محسن ملزمة.
    3. إضافة 10 ميكرولتر من 5 ميكرومتر المعقدة البيروكسيديز الحمض النووي القبض على (50 بمول) لكل خليط ملزم منها. احتضان لمدة 20 دقيقة في درجة حرارة الغرفة.
      ملاحظة: فترة حضانة ودرجة الحرارة قد تختلف تبعا لفريق العمل. تحتاج إلى أن تحدد تجريبيا القيم المثلى.
  4. إضافة 100 ميكرولتر من ميكروبيدات streptavidin. احتضان لمدة 10 دقيقة في درجة حرارة الغرفة.
  5. لكل التحقيق جزئية يجري اختبارها، ضع عمود ملزمة في فاصل المغناطيسي. وضع أنبوب microcentrifuge مباشرة تحت كل عمود ملزمة وتطبيق 100 ميكرولتر من العازلة ملزمة لشطف العمود.
  6. ماصة محتويات كل خليط ملزمة في أعمدة منفصلة، ​​والسماح للسائل بالتدفق تماما من خلال عمود في microcentrifuge لأنبوب قبل المتابعة. تأكد من تسمية الأعمدة مع جزئية البديل الذي تم استخدامه في خليط ملزم. تسمية عينات التدفق من خلال استبدال أنابيب microcentrifuge جديدة لجمع يغسل-صرامة منخفضة.
  7. تطبيق 100 ميكرولتر من غسل العازلة-صرامة منخفضة إلى العمود. انتظر حتى الخزان عمود فارغ. تكرار غسل 4X. تسمية عينات غسيل صرامة المنخفضة واستبدال أنابيب microcentrifuge جديدة لجمع يغسل عالية صرامة.
  8. تطبيق 100 ميكرولتر من غسل العازلة عالية صرامة لالعمود. انتظر حتى الخزان عمود فارغ. تكرار غسل 4X. تسمية عينات غسل عالية صرامة واستبدال أنابيب microcentrifuge جديدة لجمع ما قبل شطف.
  9. إضافة 30 ميكرولتر من شطف العازلة الأصلي إلى العمود واسمحوا الوقوف لمدة 5 دقائق. تسمية عينات ما قبل شطف واستبدال أنابيب microcentrifuge جديدة لجمع شطف.
    ملاحظة: هذا لا أزل بروتين ملزمة. فإنه يغسل ما تبقى عالية الصرامة،العازلة للخروج من عمود ويستبدلها مع شطف العازلة لتحقيق أقصى قدر من الكفاءة من شطف.
  10. إضافة 50 ميكرولتر عازلة إضافية شطف الأصلي إلى أزل TFS ملزمة. لتحقيق عائد أعلى ولكن شطافة أقل تركيزا، إضافة 50 ميكرولتر إضافية من شطف العازلة الأصلي وجمع من خلال تدفق.
    ملاحظة: تحليل عينات شطف من خلال قياس الطيف الكتلي لتحديد هوية TFS ملزمة 32. بعد ذلك، تحقق من النتائج البروتين من خلال دوديسيل الصوديوم كبريتيت هلام بولي أكريلاميد الكهربائي (SDS-PAGE)، يليه لطخة غربية 33. إذا قياس الطيف الكتلي ليست متاحة، تشغيل وصمة عار الفضة باستخدام تقنية القياسية بدلا من لطخة غربية لتحديد حجم البروتين (الصورة) تظهر تعتمد على التركيب الوراثي ملزمة. استخدام هذه المعلومات لتضييق قائمة TFS توقع من النهج الحسابية بالتفصيل في المقدمة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

في هذا القسم، وتقدم نتائج ممثل عن ما يمكن توقعه عند إجراء EMSA أو ضبا، وتباين فيما يتعلق تتميز نوعية المحللة. على سبيل المثال، فقد قيل أن تجميد وعينات البروتين ذوبان عدة مرات قد يؤدي إلى تمسخ. من أجل استكشاف إمكانية استنساخ تحليل EMSA في سياق هذه الدورات "تجميد ذوبان الجليد"، وحضنت اثنين 35 oligos بي بي اختلاف في البديل وراثي واحد مع دفعة واحدة من المحللة النووية التي تم إذابة وإعادة المجمدة لالمبلغ المشار إليه . المرات الشكل 2 يوضح أن تجميد والذوبان هذا المستخلص النووي معينة B-اللمفاوية تصل إلى 5 مرات ديه على ما يبدو أي تأثير على سلامة البروتينات. ومع ذلك، واستقرار البروتين النووي يختلف حسب العينات وبالتالي ينبغي اختبارها على كل خط الخلية الفردية المستخدمة. ومن الممكن أيضا أن يكون الاختلاف من مختلف prepar دفعةبالجمع من لست] النووية. إذا كان هذا الاختلاف هو نتيجة لمرحلة من مراحل دورة الخلية قبل تحلل، عدد الخلايا مرور، أو عوامل أخرى، من المهم تكرار النتائج EMSA باستخدام دفعات مختلفة من المحللة لضمان نتائج حقيقية.

بالإضافة إلى ذلك، فمن المهم لتحسين نسبة الإشارة إلى الضوضاء لEMSA. متغير مهم في هذا هو تركيز بنسبة ضئيلة. ومعاير كمية ضئيلة (5-300 fmol) لتقييم مدى كميات مختلفة من oligos تؤثر على إشارة (الشكل 3). وقد لوحظ زيادة في شدة الفرقة تصل إلى 100 fmol من جزئية. بعد هذه النقطة، والهضاب إشارة تشير إلى 100 fmol هو المبلغ بنسبة ضئيلة الأمثل لهذا التفاعل EMSA.

وأخيرا، يقدم شخصية ممثل من واحدة من الدراسات التي نشرت لدينا باستخدام جزء من الاستراتيجية المبينة في هذه المخطوطة (الشكل 4). في الهو دراسة 34، أظهرنا أن المرتبط الذئبة أليل ويزداد خطر rs6590330 ربط STAT1، وهو عامل النسخ التي تشارك في كل من تفعيل التآزر وتثبيط التعبير الجيني المصب من النوع 1 IFN مستقبلات مركب 35. في هذا المثال، تم STAT1 الأولى التي حددها ضبا تليها تحليل البروتين باستخدام عالية الأداء اللوني السائل بالإضافة إلى التحليل الطيفي جنبا إلى جنب كتلة (ضبا-MS). تم استخدام وصمة عار-ضبا الغربي لتأكيد TF التي تم تحديدها من تحليل البروتين (STAT1) وتأكد من أن شكل فسفرته من STAT1 ملزم لغير مرجعية (للخطر الذئبة) بنسبة ضئيلة. يوضح هذا الرقم كيف فحوصات مختلفة في هذه الاستراتيجية يمكن أن تستخدم لتحديد التفاضلية ملزم للعامل النسخ إلى متغير غير الترميز.

الشكل 2
الشكل 2: تحليل استنساخوالعواقب المترتبة على دورات تجميد ذوبان الجليد على النتائج EMSA. واستخدمت Oligos التي تحتوي على إشارة (R) أو غير مرجعية (NR) أليل لنسخة وراثية للتحقيق في نفس إعداد المحللة بعد دورات متعددة من تجميد والذوبان. (ليز: المحللة). يحتوي كل حارة التحقيق الحر في الجزء السفلي من هلام (السهم الأزرق). ملزمة للTFS إلى جزئية يمكن أن ينظر إليه باعتباره الفرقة في النصف العلوي من هلام (السهم الأحمر). العصابات الواردة في النصف السفلي من هلام (انظر قوس) هي غير محددة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
استخدمت تقييم تأثير تركيزات بنسبة ضئيلة تركيزات مختلفة مختلفة من oligos للتحقيق وإعداد واحد من المحللة النووي: الرقم 3. Fإشارة luorescent يزيد مع زيادة الكميات بنسبة ضئيلة، مشيرا إلى أن جزئية هو كاشف الحد. الهضاب إشارة في الممرات fmol 100-300، حيث كمية البروتين يصبح كاشف الحد. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (4)
الرقم 4: أليل خطر الذئبة من rs6590330 يزيد STAT1 ملزمة، وفقا لتقييم ضبا-MS STAT1 وpSTAT1 معرض ملزمة أعلى لoligos تحتوي على أليل خطر rs6590330 مقارنة مع أليل غير المخاطر. حضنت oligos المسمى البيوتين مع ابشتاين بار استخراج النووية تحول فيروس B-الخلية. تم القبض على البروتينات منضمة إلى جزئية باستخدام ضبا. ثم فصل البروتينات بواسطة SDS-إس دي إس بايج والكشف عن استخدام الألغام المضادة للpSTAT1(A) أو مكافحة STAT1 (B). M: علامة. NR: جزئية تحتوي على أليل غير خطر من rs6590330. R: جزئية تحتوي على أليل خطر rs6590330. متحولة: جزئية تحتوي على STAT1 المفترض تعطل موقع المصب rs6590330 ملزمة. الخلايا المحللة: استخراج النووي من الخلايا البائية. يشار إلى كثافة نسبية للعصابات أسفل كل فرقة. النتائج تمثيلية من أربع تجارب. في حين أن جميع التجارب يدل على زيادة STAT1 ملزما للتحقيقات مع أليل خطر، في 2/4 التجارب لا STAT1 أو تم الكشف عن pSTAT1 في immunoprecipitate من جزئية غير خطر، في حين تم الكشف عن كل من immunoprecipitate من جزئية خطر. تم تعديل هذا الرقم من إشارة 34. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

وعلى الرغم من التقدم في مجال تكنولوجيا التسلسل والتنميط الجيني قد تتعزز بشكل كبير قدرتنا على تحديد المتغيرات الجينية المرتبطة بالمرض، لدينا القدرة على فهم الآليات الوظيفية تتأثر هذه المتغيرات متخلفة. مصدر رئيسي من المشكلة هو أن العديد من المتغيرات المرتبطة المرض تقع في ن على الترميز مناطق الجينوم، والتي تؤثر على الأرجح صعوبة في التنبؤ آليات السيطرة على التعبير الجيني. هنا، نقدم بروتوكول تستند إلى تقنيات EMSA وضبا، والأدوات الجزيئية قيمة لتحديد فريق العمل تعتمد على التركيب الوراثي الفعاليات التي تسهم على الأرجح إلى وظيفة العديد من المتغيرات غير الترميز ملزمة. على الرغم من أن هذه التقنيات اثنين استخدمت على نطاق واسع في الماضي، فقد تم مؤخرا تكييف فقط للتحليل البديل الجيني للTF ملزمة. ما وراء TFS، EMSA ويمكن أيضا أن تستخدم لتحليل أثر المتغيرات الجينية على البروتينات ملزمة الحمض النووي الريبي مع سوى تعديلات طفيفة على بروتوكول 36.

ove_content "> بروتوكول المعروضة هنا هي بسيطة وسهلة لأداء؛ ومع ذلك، أجزاء معينة تتطلب اعتبارات إضافية قبل التجريب الأولى، فمن المهم لتوليد قائمة أولية من المتغيرات للنظر من خلال إجراء التحليلات الإحصائية صارمة خطأ في هذه الخطوة. يمكن تعطيل كل التحليلات المصب، كما العديد من المتغيرات قد ربط المحللة النووي تفاضلي دون المساهمة في مخاطر المرض. بالإضافة إلى ذلك، فإن استخدام بيانات الجينوم وظيفية أجريت في أنواع الخلايا ذات الصلة أمر بالغ الأهمية، أنواع الخلايا كما لا صلة لها بالموضوع قد يؤدي إلى توليد TF ايجابية كاذبة ملزم التوقعات في الوقت الحالي، وتشمل الموارد الجينومية الوظيفية الأكثر استخداما على نطاق واسع ترميز 12 وخارطة الطريق Epigenomics 17. معلومات إضافية بشأن مستويات التعبير الجيني في الخلايا أنواع ذات الصلة لمرض الفائدة يمكن الحصول عليها من مصادر أخرى مثل ImmGen 37، BioGPS 38، 39، وSNPsea 20. على سبيل المثال، هذا resourالمجال الاقتصادي الموحد يمكن استخدامها لتصفية التنبؤات ملزمة TF لتشمل فقط تلك TFS التي يتم التعبير عنها في أنواع الخلايا ذات الصلة.

ومن المهم أيضا أن تنظر في محاذير من التجارب في المختبر مثل EMSA وضبا. على وجه الخصوص، فمن الضروري تكرار التجارب مع الاستعدادات المحللة النووية منفصلة للحد من السلبيات كاذبة. وعلاوة على ذلك، يمكن أن تنجح EMSA-supershift يقدم تحولا آخر في الفرقة EMSA، والتي الأجسام المضادة بربط TF، أو فقدان الفرقة، التي الحمض النووي كتل الأجسام المضادة لفريق العمل في مجال الربط. في أي سيناريو، بما في ذلك الأجسام المضادة isotype السيطرة و / أو الأجسام المضادة نحو TF مختلفة هي مفيدة في تأكيد خصوصية supershift. وهناك اعتبار آخر في أداء supershift هو ما إذا كان لتشمل DTT / بوليسوربات في رد الفعل. DTT / بوليسوربات تستقر الصبغة تحميل السماح لتقدير أكثر دقة من الحمض النووي غير منضم. ومع ذلك، فإنه قد يقلل أيضا الروابط ثاني كبريتيد من الأجسام المضادة نتيجةجي في فشل EMSA-supershift. فمن المستحسن محاولة التفاعلات مع وبدون DTT / بوليسوربات عند محاولة supershift مجمع. يجب تحديد المبلغ الأمثل للبولي د (IC) وسمك السلمون الحمض النووي الحيوانات المنوية في رد الفعل تجريبيا عن طريق المعايرة. عموما، المعايرة مجموعة من 1-6 ميكروغرام بولي د (IC) و50-500 الحيوانات المنوية نانوغرام سمك السلمون غير كافية. وتنطوي إحدى مراقبة إيجابية مفيدة لضبا باستخدام تسلسل إجماع لفريق العمل مع عزر ملزمة تتميز كذلك (تم الحصول عليها من قواعد البيانات مثل 23 CIS-BP أو Factorbook 40) وتشغيل الغربية مع الأجسام المضادة المحددة إلى أن فريق العمل. على حد سواء المقايسات، وبنسبة ضئيلة سارعت يمكن أن تستخدم لإظهار أن أي احظ ملزم غير محددة لoligos من الفائدة.

كل من تقنيات EMSA وضبا تنطوي على قيود التجريبية. على سبيل المثال، يتأثر تقارب ملزمة بين فريق العمل والحمض النووي في جزء كبير منه بسبب الظروف العازلة. من الناحية المثالية، ينبغي أن الظروف عازلة تحاكي تكييف الذاتيةملاعق من نواة للسماح لأفضل ملزمة. لEMSA، قد يؤدي الشروط عازلة غير لائقة في الفرقة ضعف أو فقدان عصابة تماما. لضبا، قد تتسبب في ظروف غير مثالية لفريق العمل (ق) إلى أن مزال خلال خطوات غسل. لذلك، كل فحص لا تكون فعالة إلا في تحديد TF-جزئية ملزمة في ظل ظروف عازلة معينة. يتم عرض شروط عازلة الأكثر فائدة عالميا في البروتوكول أعلاه. والقيد الثاني هو أن النتائج التجريبية من وسائل EMSA وضبا توفر القليل من المعلومات حول الآليات التي من خلالها TFS ربط إلى oligos. TFS يمكن ربط oligos مباشرة أو يتم تجنيدهم من قبل عوامل أخرى. وفقا لذلك، فمن المهم لتحليل تسلسل بنسبة ضئيلة حسابيا التنبؤ بكيفية TFS قد ربط oligos وتحقق هذه التنبؤات تجريبيا. على سبيل المثال، سلسلة ملزم محددة يمكن تحور أو شريك ملزمة يمكن أن تستنفد تجريبيا. وأخيرا، فإن كمية استخراج المستخدمة يحتاج إلى معاير لكل ر التجربةس حصول على أفضل النتائج. والكثير من المحللة قد تشبع TF-جزئية ملزمة وتحجب أي تفاوت ملزم بين المخاطر وعدم المخاطرة الأليلات. استكشاف الأخطاء وإصلاحها إضافية، يمكن للقارئ الرجوع إلى عدة ممتازة مراجعة وطريقة المخطوطات 30،41،42.

بالإضافة إلى فحوصات وصفها هنا، وهناك مجموعة متنوعة من في الجسم الحي المقايسات المتاحة لمواصلة دراسة دور متغيرات داخل الخلايا الحية (الشكل 1، أسفل). مناعي لونين تليها الكمية تفاعل البوليميراز المتسلسل-أليل معين (الشذرة QPCR) الدراسات يمكن اتخاذها لتحديد ما إذا الفرق ملزمة لوحظ في النسخ المتماثل في خلايا 34 الذين يعيشون فحوصات في المختبر. على سبيل المثال، في حالة استخدام الخلايا متخالف عن البديل من الفائدة، والتجارب QPCR يمكن الكشف عن الفرق في تخصيب بين الاليلين في لونين TF immunoprecipitated. الشذرة يتطلب الأجسام المضادة رقاقة الصف محددة؛ howeveص، إذا الأجسام المضادة رقاقة الصف TF غير متوفرة، transfecting الخلايا مع فريق العمل الموسومة العلم غير فعال بديل 43. بالإضافة إلى ذلك، يمكن دراسة تأثير التفاضلية ملزمة على التعبير الجيني الهدف من خلال التحليل الكمي التعبير سمة مواضع (eQTL) في أنواع الخلايا ذات الصلة باستخدام البيانات التي تم جمعها التعبير محليا من خلايا مرمزة أو الموارد المتاحة علنا مثل تلك التي جمعتها Genevar 44. ويمكن أيضا فحوصات مراسل وسيفيراز استخدامها لاستكشاف مدى التفاضلية ملزمة من البروتين يؤثر على التعبير الجيني. هذه المقايسات يمكن تعديلها للعمل بغض النظر عن ما إذا كانت توجد متغيرات في المروج، محسن، أو منطقة كاظمة 45-47. وأخيرا، تقنيات الجينوم التحرير، مثل كريسبر / Cas9 48، ويمكن استخدامها لتوليد خطوط الخلايا التي تختلف فقط في متغير واحد، وهو أمر حيوي لتأكيد العلاقة السببية. ويمكن لهذه التقنيات تقلل بشكل كبير من التباين التجريبي لاحظ betwخطوط الخلايا التابعين المستمدة من مواضيع متنوعة وراثيا، منذ التعبير قراءات الوظيفية تحليل الجينات أو بمرض النمط الظاهري وسيطة أخرى يمكن أن يؤديها على خط خلية تحريرها، وبالمقارنة مع خطوط غير تحرير الخلية.

والميزة الرئيسية لاستراتيجية قدم هو أنه يتيح سهولة اكتشاف والسريع من فريق العمل تعتمد على التركيب الوراثي ملزمة. عن طريق تحديد أولويات المتغيرات الجينية الاساسية، المزيد من التجارب يمكن أن تكون مصممة لتحديد التأثير البيولوجي وإثبات العلاقة السببية الخاصة بهم. والجدير بالذكر، يمكن تطبيق هذا البروتوكول للتحقيق في أي مرض أو النمط الظاهري المرتبطة البديل تحديدها من GWAS أو رسم الخرائط على ما يرام. وقال كبير، الدفين المتزايد للبيانات وراثية وقوائم من المتغيرات الجينية المرتبطة بها إحصائيا متاح بالفعل. في معظم الحالات، والآليات البيولوجية يقود جمعية الإحصائية لهذه المتغيرات ليست واضحة. الاستراتيجية الواردة في هذا الاقتراح يسمح للتفسير وظيفي دقيق لكثير من disea غير الترميزالمتغيرات ذاتها المصاحب. هذه المعرفة هي حيوية لتوضيح كامل من الآليات الجزيئية قيادة أي مرض مقرها الوراثية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Materials

Name Company Catalog Number Comments
Custom DNA Oligonucleotides Integrated DNA Technologies http://www.idtdna.com/site/order/oligoentry
Potassium Chloride Fisher Scientific BP366-500 KCl, for CE buffer
HEPES (1 M) Fisher Scientific 15630-080 For CE and NE buffer
EDTA (0.5M), pH 8.0 Life Technologies R1021 For CE, NE, and annealing buffer
Sodium Chloride Fisher Scientific BP358-1 NaCl, for NE buffer
Tris-HCl (1M), pH 8.0 Invitrogen BP1756-100 For annealing buffer
Phosphate Buffered Saline (1x) Fisher Scientific MT21040CM PBS, for cell wash
DL-Dithiothreitol solution (1 M) Sigma 646563 Reducing agent
Protease Inhibitor Cocktail Thermo Scientific 87786 Prevents catabolism of TFs
Phosphatase Inhibitor Cocktail  Thermo Scientific 78420 Prevents dephosphorylation of TFs
Nonidet P-40 Substitute IBI Scientific IB01140 NP-40, for nuclear extraction
BCA Protein Assay Kit Thermo Scientific 23225 For measuring protein concentration
Odyssey EMSA Buffer Kit Licor 829-07910 Contains all necessary EMSA buffers
TBE Gels, 6%, 12 Wells Invitrogen EC6265BOX For EMSA
TBE Buffer (10x) Thermo Scientific B52 For EMSA
FactorFinder Starting Kit Miltenyi Biotec 130-092-318 Contains all necessary DAPA buffers
Licor Odyssey CLx Licor Recommended scanner for DAPA/EMSA
Antibiotic-Antimycotic Gibco 15240-062 Contains 10,000 units/ml of penicillin, 10,000 µg/ml of streptomycin, and 25 µg/ml of Fungizone® Antimycotic
Fetal Bovine Serum Gibco 26140-079 FBS, for culture media
RPMI 1640 Medium Gibco 22400-071 Contains L-glutamine and 25 mM HEPES

DOWNLOAD MATERIALS LIST

References

  1. Hindorff, L. A., et al. Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proc Natl Acad Sci U S A. 106, (23), 9362-9367 (2009).
  2. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, (6099), 1190-1195 (2012).
  3. Ward, L. D., Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat Biotechnol. 30, (11), 1095-1106 (2012).
  4. Paul, D. S., Soranzo, N., Beck, S. Functional interpretation of non-coding sequence variation: concepts and challenges. Bioessays. 36, (2), 191-199 (2014).
  5. Zhang, F., Lupski, J. R. Non-coding genetic variants in human disease. Hum Mol Genet. (2015).
  6. Lee, T. I., Young, R. A. Transcriptional regulation and its misregulation in disease. Cell. 152, (6), 1237-1251 (2013).
  7. Slatkin, M. Linkage disequilibrium--understanding the evolutionary past and mapping the medical future. Nat Rev Genet. 9, (6), 477-485 (2008).
  8. Bush, W. S., Moore, J. H. Chapter 11: Genome-wide association studies. PLoS Comput Biol. 8, (12), e1002822 (2012).
  9. 1000 Genomes Project Consortium. An integrated map of genetic variation from 1,092 human genomes. Nature. 491, (7422), 56-65 (2012).
  10. Chang, C. C., et al. Second-generation PLINK: rising to the challenge of larger and richer datasets. Gigascience. 4, 7 (2015).
  11. Purcell, S., et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 81, (3), 559-575 (2007).
  12. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature. 489, (7414), 57-74 (2012).
  13. Crawford, G. E., et al. Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome Res. 16, (1), 123-131 (2006).
  14. Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y., Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods. 10, (12), 1213-1218 (2013).
  15. Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., Lieb, J. D. FAIRE Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res. 17, (6), 877-885 (2007).
  16. Kent, W. J., et al. The human genome browser at UCSC. Genome Res. 12, (6), 996-1006 (2002).
  17. Roadmap Epigenomics Consortium. Integrative analysis of 111 reference human epigenomes. Nature. 518, (7539), 317-330 (2015).
  18. Martens, J. H., Stunnenberg, H. G. BLUEPRINT: mapping human blood cell epigenomes. Haematologica. 98, (10), 1487-1489 (2013).
  19. Liu, T., et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 12, (8), R83 (2011).
  20. Griffon, A., et al. Integrative analysis of public ChIP-seq experiments reveals a complex multi-cell regulatory landscape. Nucleic Acids Res. 43, (4), e27 (2015).
  21. Staudt, L. M., et al. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature. 323, (6089), 640-643 (1986).
  22. Singh, H., Sen, R., Baltimore, D., Sharp, P. A. A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes. Nature. 319, (6049), 154-158 (1986).
  23. Weirauch, M. T., et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell. 158, (6), 1431-1443 (2014).
  24. Ward, L. D., Kellis, M. HaploReg: a resource for exploring chromatin states, conservation, and regulatory motif alterations within sets of genetically linked variants. Nucleic Acids Res. 40, (Database issue), D930-D934 (2012).
  25. Boyle, A. P., et al. Annotation of functional variation in personal genomes using RegulomeDB. Genome Res. 22, (9), 1790-1797 (2012).
  26. Hume, M. A., Barrera, L. A., Gisselbrecht, S. S., Bulyk, M. L. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43, (Database issue), D117-D122 (2015).
  27. Mathelier, A., et al. JASPAR 2014: an extensively expanded and updated open-access database of transcription factor binding profiles. Nucleic Acids Res. 42, (Database issue), 142-147 (2014).
  28. Smith, M. F. Jr, Delbary-Gossart, S. Electrophoretic Mobility Shift Assay (EMSA). Methods Mol Med. 50, 249-257 (2001).
  29. Franza, B. R., Josephs, S. F., Gilman, M. Z., Ryan, W., Clarkson, B. Characterization of cellular proteins recognizing the HIV enhancer using a microscale DNA-affinity precipitation assay. Nature. 330, (6146), 391-395 (1987).
  30. LI-COR. Odyssey Infrared EMSA Kit: Instruction Manual. Available from: http://www.licor.com/bio/pack_inserts/?pi=829-07910 (2014).
  31. Thermo Fisher Scientific, Inc. BCA Protein Assay Kit: User Guide. Available from: https://tools.thermofisher.com/content/sfs/manuals/MAN0011430_Pierce_BCA_Protein_Asy_UG.pdf (2014).
  32. Wijeratne, A. B., et al. Phosphopeptide separation using radially aligned titania nanotubes on titanium wire. ACS Appl Mater Interfaces. 7, (21), 11155-11164 (2015).
  33. Silva, J. M., McMahon, M. The Fastest Western in Town: A Contemporary Twist on the Classic Western Blot Analysis. J. Vis. Exp. (84), (2014).
  34. Lu, X., et al. Lupus Risk Variant Increases pSTAT1 Binding and Decreases ETS1 Expression. Am J Hum Genet. 96, (5), 731-739 (2015).
  35. Ramana, C. V., Chatterjee-Kishore, M., Nguyen, H., Stark, G. R. Complex roles of Stat1 in regulating gene expression. Oncogene. 19, (21), 2619-2627 (2000).
  36. Fillebeen, C., Wilkinson, N., Pantopoulos, K. Electrophoretic Mobility Shift Assay (EMSA) for the Study of RNA-Protein Interactions: The IRE/IRP Example. J. Vis. Exp. (94), e52230 (2014).
  37. Heng, T. S., Painter, M. W. Immunological Genome Project, C. The Immunological Genome Project: networks of gene expression in immune cells. Nat Immunol. 9, (10), 1091-1094 (2008).
  38. Wu, C., et al. BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, (11), R130 (2009).
  39. Wu, C., Macleod, I., Su, A. I. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 41, (Database issue), D561-D565 (2013).
  40. Wang, J., et al. Sequence features and chromatin structure around the genomic regions bound by 119 human transcription factors. Genome Res. 22, (9), 1798-1812 (2012).
  41. Holden, N. S., Tacon, C. E. Principles and problems of the electrophoretic mobility shift assay. J Pharmacol Toxicol Methods. 63, (1), 7-14 (2011).
  42. Miltenyi Biotec, Inc. µMACS FactorFinder Kit: Data sheet. Available from: http://www.miltenyibiotec.com/en/products-and-services/macsmolecular/protein-research/biotinylated-molecule-isolation/macs-factorfinder-kit.aspx (2014).
  43. Xu, J., Liu, H., Park, J. S., Lan, Y., Jiang, R. Osr1 acts downstream of and interacts synergistically with Six2 to maintain nephron progenitor cells during kidney organogenesis. Development. 141, (7), 1442-1452 (2014).
  44. Yang, T. -P., et al. Genevar: a database and Java application for the analysis and visualization of SNP-gene associations in eQTL studies. Bioinformatics. 26, (19), 2474-2476 (2010).
  45. Fort, A., et al. A liver enhancer in the fibrinogen gene cluster. Blood. 117, (1), 276-282 (2011).
  46. Solberg, N., Krauss, S. Luciferase assay to study the activity of a cloned promoter DNA fragment. Methods Mol Biol. 977, 65-78 (2013).
  47. Rahman, M., et al. A repressor element in the 5'-untranslated region of human Pax5 exon 1A. Gene. 263, (1-2), 59-66 (2001).
  48. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics