Techniques de calcul empirique et métagénomique éclairent les mécanismes de fongicides compromis Bee santé

Environment
 

Summary

Les consortiums microbiens dans les ruches de bourdons enrichissent et conserver le pollen pour les larves d’abeilles. Prochaine génération séquençage, ainsi que le laboratoire et les expériences sur le terrain, ce manuscrit décrit les protocoles utilisés pour vérifier l’hypothèse que des résidus de fongicide modifient le microbiome du pollen et la démographie de colonie, conduisant finalement à la colonie perte.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Steffan, S. A., Dharampal, P. S., Diaz-Garcia, L., Currie, C. R., Zalapa, J., Hittinger, C. T. Empirical, Metagenomic, and Computational Techniques Illuminate the Mechanisms by which Fungicides Compromise Bee Health. J. Vis. Exp. (128), e54631, doi:10.3791/54631 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les producteurs utilisent souvent les pulvérisations pendant la floraison pour protéger les cultures contre les maladies, qui expose les abeilles à des résidus de fongicide. Bien que considéré comme « abeille-safe », il y a des preuves grandissantes que des résidus de fongicide dans le pollen sont associés à des déclins d’abeille (pour les espèces d’abeilles de miel et de bourdons). Alors que les mécanismes restent relativement peu connus, les chercheurs ont émis l’hypothèse que symbioses abeille-microbe sont impliqués. Microbes jouent un rôle essentiel dans la conservation et/ou de transformation de pollen, qui sert de nutrition pour les abeilles larvaires. En altérant la communauté microbienne, il est probable que les fongicides perturbent ces services induite par le microbe et ainsi compromettent la santé des abeilles. Ce manuscrit décrit les protocoles utilisés pour étudier les mécanismes indirects par lequel fongicides peuvent être responsables de déclin de la colonie. Expériences de cage exposition des abeilles aux fleurs traitées par des fongicides ont déjà fourni la première preuve que fongicides causent des pertes de colonies profonde dans un natif bourdon (Bombus impatiens). À l’aide de champ les doses de fongicides, une série d’expériences ont été développés afin de fournir une description plus fine de la dynamique des communautés microbiennes de pollen exposés au fongicide. Changements dans la composition structurelle des assemblages fongiques et bactériennes dans le microbiome du pollen sont étudiés par séquençage de prochaine génération et analyse métagénomique. Expériences élaborées dans cet article ont été conçues pour fournir une interprétation mécaniste de l’incidence des fongicides sur le microbiome du pollen-dispositions. En fin de compte, ces résultats devraient faire la lumière sur la voie indirecte, à travers lequel fongicides peuvent être responsables de déclin de la colonie.

Introduction

Géré et espèces d’abeilles sauvages connaissent des baisses généralisées, avec des implications majeures pour les deux systèmes naturels et agricoles1. Malgré les efforts concertés pour comprendre les causes de ce problème, les facteurs à l’origine de miel abeille baisses ne sont pas encore bien compris2,3,4. Pour certaines espèces d’abeilles sauvages, indigènes, la situation est devenue grave5,6. Si les populations d’abeilles ne saurait être maintenues lorsqu’elles se croisent avec l’agriculture industrielle, leurs populations continuent de baisser et les cultures nécessitant des pollinisateurs (35 % de la production mondiale7) durera réduit les récoltes.

Alors que de nombreux facteurs potentiels tels que l’exposition aux pesticides, maladies et habitat perte1,4,8,9,10 ont été impliqués en déclin d’abeille miel, On connaît assez l’effet interactif de ces facteurs de stress sur la santé des abeilles indigènes, au sein ou à proximité des systèmes agricoles. De nombreux efforts de recherche actuels continuent de se concentrer sur les insecticides, (p. ex., néonicotinoïdes11,12), bien que des recherches antérieures indiquent que fongicides peuvent également jouer un rôle dans le déclin de l’abeille en altérant la formation de la mémoire, réception olfactive13, nid reconnaissance14, l’activité enzymatique et fonctions métaboliques15,16,17. Dans le monde, fongicides continuent de s’appliquer aux cultures de floraison pendant la floraison. Des études récentes démontrent que les abeilles ramener couramment des résidus de fongicide à la ruche18, en effet, des études ont montré une forte proportion des ruches testés contenaient des résidus fongicide19,20. Poursuite des travaux a révélé que les résidus fongicide sont associée à des taux élevés de miel abeille la mortalité larvaire21,22,23 et la présence de « pollen enseveli » au sein de colonies, qui bien que non toxique, est dépourvu d’activité microbienne et nutritionnellement compromis24. Malgré le fait que fongicides ont longtemps été considérés comme « abeille-safe », il est désormais établi que l’exposition aux fongicides seul peut causer des pertes sévères colonie dans une espèces de bourdons native, Bombus impatiens25.

Pour établir le lien de causalité entre l’exposition de fongicide et colonie de mortalité, modus operandi de ces produits chimiques doivent être déterminées. Comme en témoigne les sols26, sédiments27et28de milieux aquatiques, en ciblant les champignons, fongicides probables modifient fongique abondance et la diversité au sein de pollen-dispositions, invoquant ainsi une très importante communauté shift qui peut fortement favoriser les bactéries. Sans concurrents fongiques ou antagonistes, certaines bactéries pathogènes peuvent proliférer relativement non coché, facilitant la détérioration des dispositions en matière de pollen. Recherches antérieures a démontré que les microorganismes, en particulier les levures et les champignons, servent de symbiotes nutritionnels pour abeilles29,30,31, protéger contre les parasites et agents pathogènes32 ,33et prévoir la conservation à long terme du pollen magasins. Fongicides, par conséquent, peuvent nuire indirectement abeilles immatures en perturbant la communauté microbienne qui est nécessaire pour fournir ces services, et/ou en augmentant la sensibilité aux agents pathogènes et parasites opportunistes12. Avec l’augmentation des demandes sur la production alimentaire, les cultures dans le monde entier sont à peindre chaque année avec des fongicides pendant la floraison, soulignant la nécessité de comprendre l’ampleur de ces effets induits par le fongicide.

À ce jour, les lacunes de connaissances primaires relatives aux abeilles indigènes microbienne écologie peut être représenté par les questions suivantes : dans quelle mesure le fongicide modifie-t-elle la communauté microbienne au pollen d’abeille-dispositions ? Quels sont les impacts en aval de la consommation de pollen avec une communauté microbienne profondément altérée ? En gardant ces questions pertinentes sur le plan écologique, des expériences ont été élaborés avec les principaux objectifs de révéler 1) que seuls les résidus fongicide peuvent causer la colonie grave déclin dans une espèce d’abeilles indigènes ; 2) le degré auquel des communautés microbiennes dans les dispositions en matière de pollen sont altérées par fongicides et 3) Comment la santé des abeilles est affectée par une communauté microbienne gravement altérée. Les objectifs expérimentaux ont été définies pour répondre aux questions ci-dessus en utilisant une combinaison d’expériences de laboratoire - et sur le terrain. À l’aide d’état-of-the-art métagénomique et techniques moléculaires avec les méthodes traditionnelles d’observation sur le terrain, cette recherche vise à reconstituer les effets potentiels des fongicides sur la santé des abeilles.

Le premier objectif de cette étude est de démontrer que l’exposition fongicide seule peut entraîner des pertes de colonie importante parmi les espèces d’abeilles indigènes. Une étude portant sur les cages de grand champ a été utilisée pour étudier les effets de l’exposition de fongicide sur la croissance de la colonie Bombus impatiens, une abeille indigène omniprésente et abondante aux États-Unis (Figure 1, Figure 2, Figure 3). L’hypothèse a été que les ruches traitées par des fongicides présentera une aptitude inférieure et démographie atypique par rapport aux ruches non exposés. Données tirées de cette expérience appuient cette hypothèse, en démontrant que des résidus de fongicide dans le pollen peuvent être la seule cause des pertes de colonie profonde dans un natif bumble bee espèces25. Le deuxième objectif de cette étude est d’étudier la réponse du microbiome du pollen à l’exposition de fongicide. Il est possible que la composition de la communauté des microbes dans pollen-dispositions exposées aux fongicides sera différente de celle du pollen non traitée. Alors que la diversité et l’abondance de champignon devraient diminuer considérablement, bactéries ou une seule espèce fongique dominante augmentera probablement incontrôlée en l’absence d’autres champignons concurrentes. Grâce à une série d’essais in vivo , ces changements dans la composition des communautés microbiennes seront analysées à l’aide de métagénomique.

Protocol

1. examiner l’effet de l’exposition au fongicide sur Bumble Bee Colony succès à l’aide de Cage expériences sur le terrain

  1. Set up dix cages en treillis dans un domaine planté d’avoine. Creuser une tranchée autour de chaque cage et creusez tous les quatre bords de la cage de maille dans le sol pour s’assurer que les abeilles ne peuvent pas s’échapper. Les cages avec des plantes à fleurs en pot, qui sont connus pour être attractive pour les abeilles (p. ex. sarrasin, bourrache, alyssum, cosmos et tournesol) en stock ( Figure 2).
  2. Supplément les cages avec un seul plateau (36 x 42 cm) du trèfle en fleurs. Regrouper les ressources florales dans un coin de la cage, occupant un espace environ 2,5 m x 1 m. végéter la surface restante de la cage de l’avoine.
  3. Attribuer au hasard le bourdon, colonies, chaque contenant les travailleurs et une seule reine, un traitement (fongicide présent/absent, N = 5 colonies par traitement, totales 10 colonies), ensuite les placer dans une cage de champ (N = 1/cage) pendant 29 jours (23 juin -21 juillet 2014).
  4. Orienter les cases de la colonie telle que la colonie ' ouvertures s pointent vers le sud pour fournir les abeilles avec des conditions optimales de navigation. Subventionner les colonies avec les réservoirs d’eau de sucre, placées dans les cases de la ruche pour compléter la disponibilité de nectar.
  5. Appliquer axée sur le chlorothalonil fongicide au niveau champ pertinent (20 g/L) pour plantes à fleurs dans les cages de traitement cinq fongicide, à l’aide d’une main tenue pulvérisateur de pesticide, deux fois au cours de l’étude (jour 0 et 13). Enduire les fleurs uniformément tels qu’aucun autre liquide n’adhère aux surfaces florales ( Figure 3).
  6. À l’issue de l’étude de cage sur le terrain, enlever les colonies b. impatiens de cages à la main, refroidir les ruches en plaçant dans le congélateur -20 ° C pendant 20 min.
  7. Enlever les abeilles à l’aide de la pince stérile et noter le nombre de larves, les nymphes, les femelles adultes (je. e. butineuses) et les mâles adultes. À l’aide d’une balance analytique enregistrer le poids sec de la Reine mère, larves, nymphes, femelles adultes (c.-à-d. les fouilleurs de poubelles) et les mâles adultes.

2. Examiner les effets de l’exposition fongicide sur les communautés microbiennes dans les passages de Pollen de Bumble Bee nids à l’aide de laboratoire selon des essais In Vivo

  1. Pulverize acheté dans le commerce pollen à une poudre fine à l’aide d’une norme ball-Moulin de laboratoire. Stériliser en poudre pollen par trempage dans l’éthanol à 70 %, ce qui lui permet de s’évaporer du jour au lendemain sous la lumière UV. Vérifier la stérilité du pollen en ensemençant ~0.5 mg sur milieux gélosés polyvalent.
    1. à la sec, pollen stérile, à l’aide de pipettes stérilisés, ajoutez dosage pertinent de champ de fongicide : propiconazole à 14,3 % ; azoxystrobine à 22,9 % pour les traitements (0,74 µL et 0,65 µL respectivement / jour / la ruche). Mélangez bien à l’aide de bâtons en bois stérilisés.
  2. Place 6 ruches expérimental (n = 3 chaque de contrôle et de traitement) dans un laboratoire propre et hygiénique de benchtop maintenu à température ambiante. Chaque jour environ 4,27 g de pollen 34 , 35, mélangé avec des fongicides (pour les traitements) ou d’eau stérile (pour contrôle) à l’intérieur d’une hotte à l’aide de la technique d’asepsie standard.
    1. à l’aide des trappes fournis par le côté de la boîte en carton renfermant des ruches, introduire le pollen à l’intérieur de la ruche. Compléter les ruches avec une solution stérile de sucre chaque semaine. Continuer l’alimentation régime pendant quatre semaines.
  3. à la fin de l’étude en laboratoire, refroidir les ruches en plaçant dans le congélateur-20 ° C pendant 20 min. gratter le pollen-application des dispositions contenues dans les chambres de couvée à l’aide de forceps stérilisé et spatules et en place dans des tubes stériles de stockage. Conserver à-80 ° C. comte et enregistrer le poids des travailleurs et de la Reine-mère au début et fin de l’expérience (étape 1.7).
  4. Kits d’isoler l’ADN d’échantillons de pollen-disposition en utilisant l’isolement d’ADN disponible dans le commerce (voir Table des matières pour plus de détails).
    1. Ajouter 0,25 g de pollen-disposition d’extraction tubes, brièvement vortex mixer.
    2. Faire un 200 mg/mL solution de lysozyme dans l’eau distillée désionisée, suffisant pour 50 µL/échantillon. Agiter vigoureusement à la solution entièrement forme.
    3. Ajouter 50 µL de la solution de lysozyme aux tubes d’extraction avec échantillon dedans et bien mélanger en retournant plusieurs fois. Incuber le tube pendant 10 min à 37 ° C dans un bain d’eau. Si précipité a formé, chauffer la solution à 60 ° C jusqu'à dissolution avant utilisation.
    4. Ajouter 70 µL de solution de lyse aqueuse aux tubes d’extraction, fixer horizontalement sur un socle de vortex à plat avec du ruban adhésif et vortexer pendant 10 min. centrifuger les tubes à 10 000 g pendant 30 s à température ambiante.
    5. Transférer le surnageant dans un tube de prélèvement propre de 2 mL. Ajouter 250 µL de solution de précipitation de protéine et vortex pour 5 s. Incuber à 4 ° C pendant 5 min dans un bain de glace.
      Remarque : Attendez entre 400 µL à 500 µL de liquide surnageant. Surnageant peut encore contenir certaines particules.
    6. Centrifuger les tubes à température ambiante pendant 1 min à 10 000 x g et transférer jusqu'à 600 µL du surnageant dans un tube de prélèvement propre de 2 mL. Ajouter 200 µL de solution de suppression d’inhibiteur aqueux, brièvement, vortex et incuber à 4 ° C pendant 5 min. centrifuger les tubes à température ambiante pendant 1 min à 10 000 x g. transférer jusqu'à 750 µL de liquide surnageant dans un tube de prélèvement propre de 2 mL.
    7. Ajouter 1200 µL de solution aqueuse de lier le surnageant et vortexer pendant 5 s. charger environ 675 µL du liquide surnageant sur un filtre de spin et centrifuger à 10 000 x g pendant 1 min à température ambiante. Jeter le débit par.
    8. Répéter 2.4.7. deux fois par.
      Nota : Un total de trois charges pour chaque échantillon traité sont nécessaires.
    9. Ajouter 500 µL éthanol et centrifuger à température ambiante pendant 30 s à 10 000 x g. jeter le débit à travers et centrifuger à nouveau à température ambiante pendant 1 min à 10 000 x g. Place spin filtre dans un tube de prélèvement propre de 2 mL.
    10. Ajouter 100 µL d’élution tampon au centre de la membrane filtrante. Centrifuger à température ambiante pendant 30 s à 10 000 x g. jeter le filtre de l’essorage. Magasin prélevés ADN entre-20 ° C et -80 ° C
  5. usage isolé ADN pour l’ordonnancement de.
    1. Quantifier et de normaliser l’ADN isolé à 2 ng/µL par analyse fluorimétrique. Réactions
      1. Prepare en trois exemplaires pour chaque échantillon prélevé comparer les quantités relatives de 28 s (plante), analyser sa (champignons) et 16 s (bactérienne) composants de chaque échantillon de pollen-disposition 36. S’assurer que chaque réaction contienne 10 ng d’ADN total x 2 du mélange principal de colorant à base de cyanine asymétriques et 2,5 µL de chaque des amorces et inverses paires 28KJ/28, b 37 pour plante et ITS1/ITS5.8R pour l’ADN fongique 38 .
    2. Amplifier l’ADN en utilisant les paramètres suivants : dénaturation préalable 2 min à 50 ° C, dénaturation initiale de 2 min à 95 ° C, 40 cycles de (15 s à 98 ° C, 15 s à 58 ° C, 60 s à 72 ° C), suivie par une courbe fonte.
    3. Préparer un protocole PCR 2-step, imbriqué à l’aide de bibliothèques de séquençage de prochaine génération ciblant l’ARNr 16 s région variable V3/V4 et STI / 5,8 s espaceur ARNr.
      1. Ajouter 12,5 µL d’ADN à 5 pmol de chaque amorce et 2 x mélange principal. Faire des réactions distinctes pour chaque région (16 s ou STI ; voir tableau 1). Modifier des amorces spécifiques de région comme décrit précédemment 39 ,, 40, d’ajouter des séquences nucléotidiques spécifiques séquenceur Adaptateur porte-à-faux pour les séquences de gène-spécifique.
      2. Exécuter amplification initiale en utilisant les paramètres suivants : dénaturation initiale de 3 min à 95 ° C, 25 cycles de (30 s à 95 ° C, 30 s à 55 ° C, 30 s à 72 ° C), extension finale 5 min à 72 ° C.
      3. Qui suit initial d’amplification, vérifiez la taille de la bibliothèque et la quantité de mobilité électrophorétique et nettoyer à l’aide d’un 1 x volume en phase solide réversible immperles d’obilization pour enlever les amorces résiduels et les réactifs de la réaction. Piscine de 16 ans et les amplicons quantitativement pour créer un pool de l’amplicon unique pour chaque échantillon.
      4. Ajouter des adaptateurs spécifiques séquenceur et dégustez duals spécifiques utilisant les amorces suivantes (voir tableau 1). Ajouter 2,5 µL d’ADN amplifié à 5 pmol de chaque amorce et 2 x mélange principal. Effectuer l’amplification de bibliothèque en utilisant les paramètres suivants : dénaturation initiale de 3 min à 95 ° C, 8 cycles de (30 s à 95 ° C, 30 s à 55 ° C, 30 s à 72 ° C), extension finale 5 min à 72 ° C.
    4. PCR suivant, bibliothèques propre finis à l’aide d’un volume de 1 x de billes d’immobilisées réversible en phase solide. Évaluer la qualité et la quantité des bibliothèques finis à l’aide de mobilité électrophorétique et fluorimétrie, respectivement. Normaliser les bibliothèques à 2 µM et piscine avant séquençage.
    5. Effectuer le séquençage de nouvelle génération sur une plate-forme analogue aux cartes ajoutées dans la PCR secondaire, avec une longueur adaptée pour couvrir l' amplicon ensemble 41.
  6. Séquence annotation et l’analyse de la composition microbienne.
    1. Moissonneuses paire-fin les données du séquençage (R1 et R2) en contigs unique pour les bibliothèques tout séquencées. Après la fusion des fichiers fois R1 et R2, format fasta unique pour chacune des bibliothèques est produite.
      Remarque : Cette étape et les processus décrits ci-dessous (sauf indication contraire) sont effectuées en Mothur version 1.38.0 38.
    2. D’écran chaque fichier fasta pour supprimer des bases ambiguës et inattendu de longues séquences long homopolymères.
      Remarque : Les paramètres pour le dépistage et le retrait de la séquence sont maxambig = 0, maxlength = 600 et maxhomop = 8 pour les deux gènes. Supprimer des séquences identiques, mais garder une table menace séparément pour toutes les bibliothèques (alias comte table Mothur).
    3. Alignement des séquences uniques de la bibliothèque du gène 16 s contre la version de base de données SILVA 123 et la STI génothèque contre la de base de données unir ses 42.
      Remarque : Les séquences doivent être annotées au niveau du Royaume au niveau du genre.
      1. Par la suite, cluster alignés séquences avec la fonction pre.cluster à l’aide de diff = 5 et supprimer les chimères.
    4. Classer les séquences à l’aide de la méthode Wang 43 basé sur les unir ses (pour le gène ITS) taxonomie fichiers (valeur seuil de 80 %) et SILVA (pour le gène 16 s).
    5. Charger dans R 44 les tableaux de menace (un par gène) générés lors du processus de classification en Mothur. À chaque niveau taxinomique, obtenir l’abondance relative par bibliothèque pour une analyse plus approfondie des changements de population microbienne.
      Remarque : À chaque niveau taxinomique, fusionner les groupes taxonomiques lorsque l’abondance relative est inférieure à 2 % pour toutes les répétitions expérimentales.

Representative Results

Étude de terrain de cage :

Données obtenues à partir des expériences de cage a montré que les colonies d’abeilles de bourdon avaient une réponse significative à l’exposition de fongicide. Les ruches traitées par des fongicides produit beaucoup moins de travailleurs (12,2 ± 3.8, moyenne ± et) que les ruches de contrôle (43,2 ± 11.2, F1,9= 6,8, p = 0,03) (Figure 4). En outre, la biomasse de l’abeille des ruches traitées par des fongicides (0,91 g ± 0,15) était significativement plus faible que les ruches de contrôle (2,36 g ± 0.55 ; F 1,9 = 8.3, p = 0,02). Cette tendance à la baisse biomasse dans des ruches traitées par des fongicides a été également observée parmi les reines de la mère. Les reines des ruches traitées par des fongicides présentés avec une biomasse significativement plus faible (0,14 g ± 0,04) que les reines des ruches contrôle (0,27 g ± 0,01 ; Z = 2,5, p = 0,01). Cependant, l’exposition fongicide n’affecte pas le nombre de larves, nymphes et les hommes dans les traitements. La biomasse des étapes de la vie discrète (larves, nymphes, les travailleurs et les mâles adultes) et des poids individuels pour les larves, nymphes et travailleurs n’ont pas montré de différence travers traitées par des fongicides et contrôle hives.

Étude en laboratoire :

Données obtenues à partir des expériences en laboratoire ont indiqué qu’avant l’exposition au fongicide, contrôle et les ruches traitées par des fongicides avaient des comte de travailleur moyenne statistiquement comparable (contrôle des ruches = 28,0 ± 3,1 ; ruches traitées par des fongicides = 31,67 ± 2.0 ; n = 3 chaque) et Reine poids (contrôle des ruches = 0,77 g ± 0,04 ; ruches traitées par des fongicides = 0,74 g ± 0,01). Toutefois, à la fin de l’étude, le nombre de travailleurs était significativement plus élevé dans des ruches de contrôle (67.67 ± 4,3), par rapport aux ruches traitées par des fongicides (45.33 ± 3,8) (t4 = 3,89, p = 0,01). Population de travailleurs a augmenté de 150 % dans des ruches de contrôle contre ~ 45 % dans les ruches traitées par des fongicides. De même, poids final de la Reine-mère est restée relativement stable en contrôle ruches (0,76 g ± 0,02) comparées à un ~ 35 % diminuent dans des ruches traitées par des fongicides (0,49 g ± 0,16). Pris ensemble, ces résultats concordent avec les résultats précédemment publiés25 et indiquent fongicide exposition touchés fitness de la colonie, comme en témoignent les moins grand nombre de travailleurs et réduit le poids de Sultane (Figure 5).

Analyse métagénomique de pollen-dispositions a indiqué des différences marquées entre les communautés microbiennes prélevées traitement par des fongicides et contrôlent les ruches (Figure 6). On observe une diminution (> 95 %) dans l’abondance relative des Streptomycetales souvent isolés, Enterobacteriales dans les ruches traitées par des fongicides. Fait intéressant, ces deux groupes sont connus pour leur activité antifongique et leur rôle dans la préservation du pollen30,45 au sein d’environnements de ruche de bourdons. Membres bactériennes de l’ordre des Rickettsiales, qui comprend les agents pathogènes courants des arthropodes46, a montré beaucoup plus grande abondance dans les ruches traitée de fongicide. Les ruches traitées par des fongicides avaient une plus faible abondance de champignons appartenant à l’ordre des Eurotiales et Sordariales et une plus grande abondance de commandes Capnodiales et Ascosphaerales par rapport aux ruches de contrôle (Figure 7). Comme prévu, de bactéries et de champignons, indice de diversité (H) et une bonne uniformité (E) de Shannon était plus faible dans les ruches traitées par des fongicides par rapport aux témoins, bien que ces différences n’étaient pas statistiquement significatifs (bactéries : H contrôler les ruches =1,25 ± 0,3, Hruches traitées par des fongicides = 0,82 ± 0,2, Econtrôle ruches = 0,46 ± 0,1 ; Eles ruches traitées par des fongicides = 0,31 ± 0,1 ; champignons : Hcontrôle ruches =0,99 ± 0,3, Hruches traitées par des fongicides = 0,72 ± 0,4, Econtrôle ruches = 0.57 ± 0,2 ; Eles ruches traitées par des fongicides = 0,42 ± 0,2). Bien que détaillant les conséquences métaboliques et fonctionnelles de cette communauté se déplace au-delà de la portée de cette étude, combiné avec le comptage des colonies et les données sur le poids, ces résultats suggèrent que l’exposition fongicide pourrait affecter déclin dans la santé de la colonie par perturber la symbiose entre les abeilles et le microbiome du pollen. Enquête plus approfondie sur le rôle des groupes microbiens spécifiques affectant la survie larvaire est recommandé pour mieux évaluer le rôle du microbiome du pollen dans le maintien des populations d’abeilles en bonne santé.

Figure 1
Figure 1 : à l’intérieur d’un nid de Bombus impatiens . Image en haute résolution des travailleurs qui tendent à des cellules de couvain. Des cellules de couvain peuvent contenir plusieurs œufs et des larves à un moment donné. Développement des larves se nourrit de pollen-dispositions périodiquement introduits dans la chambre. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : cages de grandes érigé pour abriter les colonies d’abeilles. Chaque cage de maille (N = 10) a été approvisionné avec un acheté dans le commerce Bombus impatiens ruche, mais aussi en fleurs planter des espèces connues pour attirer des abeilles. Fleurs ont été stockés dans un coin de la cage et le reste de la zone était couverte de végétation avec de l’herbe d’avoine. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : résidus de fongicide sur un tournesol récemment pulvérisé. Champ pertinent des doses de fongicides ont été pulvérisés sur les jours 0 et 13 de l’expérience. À l’aide d’un pulvérisateur de pesticide, les fleurs ont été uniformément recouvert d’une solution de fongicide au crépuscule et le soir pour éviter le contact direct avec les abeilles butineuses. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : effets des résidus de fongicide sur les bourdons dans l’expérience de la cage. Bourdon des colonies d’abeilles qui avaient été exposées à des résidus de fongicide sur pollen présentaient une baisse importante de la taille de la colonie (reductions dans l’abondance des femelles adulte) au cours d’un seul mois. Barres d’erreur représentent ± 1SE ; p < 0,05. Ce chiffre a été modifié de Bernauer et al. 25. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : effets des résidus de fongicide sur les bourdons dans une expérience en laboratoire. Des colonies d’abeilles bourdons qui ont été exposés au pollen traitées par des fongicides présentaient une baisse importante de la taille de la colonie (les réductions dans l’abondance des ouvrières adultes) et de la diminution de poids de la Reine-mère au cours d’un seul mois. Barres d’erreur représentent ± 1SE ; p = 0,03. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : diagramme de classification métagénomique de la diversité fongique et bactérienne à l’ordre le grade. Analyses fondées sur (un) 16 s) et (b) ITS basé classification des échantillons de pollen-disposition provenant de contrôle et les ruches traitées par des fongicides. Ruches de contrôle a montré plus de diversité et de régularité dans la distribution microbienne. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 7
Figure 7 : pourcentage de changement dans l’abondance relative rang ordre des bactéries et des champignons en réponse à l’exposition de fongicide. Métagénomique classification des communautés microbiennes utilisant (a) 16 s) et (b), ITS base amorces s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Paire d’amorces Type d’apprêt Séquence d’amorce
28KJ/28 B Plante GGC GGT AAA TTC CGT CC /
CGT GCC TGT TTC AAG ACG
ITS1 / ITS5.8 Fongique LA STC GTA GGT GAA TDC GCG G /
BÂILLON ATC CGT TGT TGA AAG TT
16 s avant / arrière Bacterial imbriqué 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG-3'/
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACHVGGGTATCTAATCC-3'
Apprêt ITS1F / ITS4 Imbriquées fongique 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTCGTAGGTGAACCTGCGG - 3'
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC - 3'
Amorces d’adaptateur 5'-AATGATACGGCGACCACCGAGATCTACAC [55555555]
ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
5'-CAAGCAGAAGACGGCATACGAGAT [77777777]
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3 '

Tableau 1 : liste des paires d’amorces et de séquences d’amorces utilisées pour l’amplification de l’ADN. Voir le texte pour les références.

Discussion

Recherches sur les effets des fongicides sur la santé des abeilles sont restées un aspect peu étudiée de stratégies de lutte antiparasitaire. Notre étude vise à combler cette lacune à l’aide d’un ensemble de techniques complémentaires qui isolent explicitement les facteurs possibles baisses de l’abeille. La planification, la justification et le rendu de ces expériences sont détaillées ci-dessous.

Il est important de s’assurer qu’aucune abeille n’est autorisés à s’échapper le maillage des expériences cage, puisque cela compromettrait l’analyse de la démographie. Il est également important que les nids artificiels ont une isolation suffisante pour protéger contre la pluie et le soleil direct. Il faut donc que les fongicides ne sont pas pulvérisés directement sur les nids. Les colonies devraient recevoir des réservoirs d’eau de sucre pour compléter nectar recueilli et prévenir la déshydratation.

Pour le laboratoire d’après des essais d’alimentation, des conditions d’asepsie strictes devraient être maintenues afin de prévenir la contamination lors de la préparation des repas de pollen. Pollen acheté dans le commerce doit être en poudre et UV stérilisés avant usage. Hygiène de la ruche doit être maintenue afin d’empêcher l’infestation de parasites externes comme garde-manger mites et les cafards. Vessies fluides devraient être complétées par la solution de sucre stérilisé pour prévenir la déshydratation. Pour le recensement avant le traitement, il faut pas au stress les abeilles par manipulation excessive et à les garder en dehors de la hived pour prolongée périodes.

Rendement d’ADN dépend de l’âge et le type de matériel de départ, seulement des échantillons frais ou bien congelés doivent être utilisés en amplification et l’extraction d’ADN. Poids de l’échantillon pour l’extraction de l’ADN ne doit pas dépasser 0,25 gm, car cela fera baisser le rendement d’ADN. Rendements d’ADN doivent être quantifiées à l’aide de l’électrophorèse sur gel. Upfront électrophorétique quantification de l’ADN isolé est indispensable avant de procéder à des réactions de qPCR pour assurer l’amplification efficace47.

Pour l’analyse métagénomique, une analyse plus détaillée de la dynamique microbienne peut être obtenue en limitant le nombre de séquences annotés (en relachant la fraction des écarts tolérables entre séquences) et en réduisant le nombre de groupes taxonomiques, comme ainsi que la fusion de ceux pour lesquels l’abondance relative est très faible (< 2 %).

La taille de l’échantillon conservatrice (N = 5 pour les deux fongicides traitées et non traitées ruches étude cage) peut gonfler les écarts dans les données, qui seront minimisées dans de futures études en utilisant la réplication supérieure. Pour ajouter une plus grande résolution et la puissance statistique des résultats, les colonies d’abeilles seront recensés et pesé avant et après l’exposition de fongicide. L’expérience de la cage pendant de longues périodes en cours d’exécution permettra la production de nouvelles reines, qui peut servir comme une variable de réponse supplémentaire. Avec ces modifications au protocole actuel, futures études fourniront davantage de détails sur la dynamique de population de ruche.

Le caractère hydrophobe du pollen dissuade son mélange efficace avec de l’eau. Pulvérisation et tamiser les grains de pollen à une poudre fine, favorise le processus de mélange. Le montant de la poudre de pollen est réglable pour obtenir la consistance désirée. Il faut pour bien mélanger le liquide (eau ou fongicide) à réaliser une répartition homogène des ingrédients actifs et de la livraison même pour les ouvrières.

Comme excès ADN peut inhiber les réactions de PCR, il est recommandé que l’échantillon ne devrait pas peser plus d’agitation Excessive de 0,25 g. doit être évitée car cette cisaille ADN, abaissant le rendement. Rendement faible ADN peut également être le résultat d’une exposition prolongée à la mémoire tampon de lyse. Amorces bactériennes doivent être choisis de préférence de la région de V7-V9 de l’ARNr 16 s pour minimiser l’amplification non spécifique de l' ADN de chloroplaste48. En outre, séquençage d’autres gènes, comme le gène de l’ARN ribosomique 18 s peut fournir une meilleure compréhension de la diversité microbienne dans le pollen, ainsi que les changements de population sur l’utilisation de fongicide.

Compte tenu de la quantité de bibliothèques pour traiter avec Mothur, temps de calcul peut être très forte. Suppression des singletons lors de la comparaison des séquences uns contre les autres (si calcul de ressources sont limitées, enlevez-les avant filtration chimère) peuvent diminuer considérablement le temps requis pour le calcul des unités taxonomiques opérationnelles.

Les expériences de cage limitent la plage de trajectoire naturelle des abeilles (par opposition à leur permettant de se nourrir largement à travers le paysage), et on ignore le degré auquel ces restrictions peuvent influer sur les variables de réponse. Bien que les cages de contrôle et de traitement a vécu la même gamme de variables biotiques et abiotiques, il est logistiquement impossible à contrôler pour le microenvironnement dans chaque cage.

La véritable portée des interactions microbiennes au sein de la communauté est beaucoup trop complexe et de complexe à se répliquer via des essais expérimentaux. Alors que nos données susceptibles de document un sous-ensemble de la diversité microbienne totale dans les dispositions en matière de pollen, il est le premier aperçu des effets interactifs qui peuvent exister entre les bactéries et les champignons dans la présence ou l’absence de fongicides.

Utilisant des bases de données alternatives pour l’alignement des séquences49 ou prédire les États métaboliques fonctionnelles basées sur la diversité bactérienne de pollen50 peut fournir une vue plus large sur le microbiome du pollen. Finalement, afin de mieux caractériser la dynamique métabolique et fonctionnelle des communautés microbiennes après application de fongicide, séquençage du génome entier de pollen microbiome est nécessaire.

Expériences de cage à l’aide de ruches achetées dans le commerce fournissent un des meilleurs cadres pour mesurer les variables de réponse dans un milieu semi-contrôlé. Ce qui provoque l’altération minime à l’écologie naturelle des abeilles (efficacité alimentaire, structure sociale, soins de la progéniture), expériences de cage minimiser la ruse et du stress, introduite par le manuel de manutention au cours en laboratoire et environnement artificiel expériences.

Au meilleur de notre connaissance, aucune étude a encore été réalisée afin d’évaluer les effets des fongicides sur la dynamique des communautés microbiennes dans le pollen de fournir des bourdons. Exposition aux fongicides peut éliminer une ou plusieurs des espèces sensibles, perturber la trêve écologique entre les bactéries et les champignons. À l’aide de champ et essais en laboratoire comme un creuset de jouer sur ces interactions, cette étude vise à démontrer que l’extermination d’espèces microbiennes résidant peut pervertir l’équilibre écologique de la microbiome de pollen, qui peut-être à leur tour compromis santé des abeilles.

Techniques spécifiques à une culture comme la dilution et le placage sur des supports standard captureseule une fraction de la microflore d’un environnement donné. Cela peut conduire à une sous-représentation brute de la diversité microbienne et impossibles microbes peuvent passer inaperçus51. Afin d’étudier l’ampleur des microorganismes, scientifiques doivent s’appuyer sur des techniques indépendants de la culture, plus inclusive et globale, pour par exemple analyse métagénomique et séquençage de prochaine génération. Puisant largement dans ces puissantes techniques moléculaires, cette étude vise à obtenir une plus grande résolution dans le microbiome du pollen que celle prévue par les techniques traditionnelles basée sur l’élevage seuls.

Les résultats de cette étude ont révélé des pertes profondes du nombre de travailleurs à l’intérieur des colonies d’abeilles bourdons exposés aux fongicides. Pour une colonie d’abeilles de bourdon réussir, les travailleurs ont besoin de fournir des ressources suffisantes et de soin pour la Reine-mère et en particulier pour le développement des larves. En fin de compte, l’objectif de la colonie est de maximiser capture de ressource (pollen et nectar) tels que fille-reines autant que possible peuvent être produits à la fin de l’été. Fille en bonne santé-queens sont la mesure de remise en forme pour une colonie. Des réductions majeures des travailleurs, puis, effet de détruire de pouvoir de la colonie produire des reines pour l’année suivante. Dans cette étude, non seulement nombre de travailleur ont significativement diminué, mais les mère-reines de fongicide traitement ruches présenté avec une biomasse plus faible, probablement suite à une alimentation insuffisante par les ouvrières. Compte tenu de la complexité des interactions microbiennes dans les dispositions en matière de pollen, il est difficile de discerner les effets interactifs exactes entre les champignons et les bactéries qui contribuent à ces modèles. Cependant, résultats d’expériences répétées et répétées comme décrit ici, fournira des informations vitales dans les symbioses mouvantes entre ces deux groupes microbiens (qu’ils soient compétitifs, mutualistes ou commensaux) en réponse au stress xénobiotique, et ses effets en aval sur le microbiome du pollen.

Grâce à l’utilisation de puissants outils moléculaires, la complexité écologique du microbiome pollen peut être mieux résolue. L’accord préliminaire révèle une pléthore d’origine naturelle de bactéries et de champignons qui contribuent collectivement pour garder la forme de la colonie. En particulier, les levures qui ont été isolés des dispositions en matière de pollen sont connus pour porter des propriétés bactéricides et fermentatives, qui sont cruciales pour le développement des larves abeilles. Ces associations écologiques sont évocateurs d’un degré élevé de mutualisme entre les abeilles et leur pollen microbiome. Pollen-dispositions, représentent donc un effet émergent de la diversité, provoqué par la culture d’une communauté bactérienne composée de rôles fonctionnels clés. En l’absence de ces symbiotes clés, la pollen-disposition semble être compromise à degrés inconnus. Poursuite des travaux dans ce sens, sera probablement expliquer la diversité fonctionnelle de ces microbes et démasquer leur rôle de symbiotes de l’abeille.

Une recherche récente a démystifié la notion de fongicides comme étant sans danger pour les abeilles19,24,52,53,54. L’objectif de cette recherche est d’isoler les mécanismes conduite fongicide effets sur les abeilles, éclairant ainsi la relation de cause à effet entre les baisses d’utilisation et abeille fongicide. Le centre d’hypothèses autour du concept que symbioses abeille-microbe sont sensiblement modifiés par des résidus de fongicide dans le pollen. En fin de compte, ce travail sera ré-enligner comment les fongicides sont lus et utilisés en agriculture et en milieu urbain. À la lumière de la crise mondiale pollinisateur, le projet de recherche génère de nouvelles connaissances sur l’écologie de l’abeille indigène, en ce qui concerne les pratiques de production agricole. Fongicides restent le dernier groupe agrochimique d’être effectivement exemptés des règlements limitant les applications aux cultures pendant la floraison. Ainsi, des abeilles sauvages et gérés sont constamment exposés aux fongicides. Un nombre croissant de la littérature suggère que, bien que les fongicides ne sont pas mortels pour les abeilles au contact, à des doses élevées, l’exposition est tout à fait préjudiciable, conduisant à la plus élevée de la mortalité larvaire21 et altéré le comportement de l’ensileuse. Il est prévu que ce travail s’allume l’ou les mécanismes par lesquels les fongicides nuisent pollinisateurs. En outre, cette recherche forment la base de la politique de gestion des ravageurs plus sage et informer les cultivateurs des meilleures pratiques de gestion. Ce travail sera également joué un rôle important dans la fourniture de lignes directrices pour la pulvérisation de pesticides améliorées, qui peuvent influencer les lois et règlements de pesticides. Plus largement, ces résultats seront utiles à tout écosystème géré dans lequel plantes à fleurs sont visitées par pollen-collecte insectes. Avec des estimations mondiales d’abeille spécifiques des services de pollinisation étant extraordinairement élevé55,56, si ce travail peut atténuer le déclin des populations d’abeilles, les impacts potentiels seront considérables.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

L’auteur remercie l’installation de séquençage ADN Université du Wisconsin Biotechnology Center permettant l’amplification et installations de séquençage et de services, Caitlin Carlson, Jennifer Knack, Jake Otto et Max Haase pour fournir une assistance technique avec analyse moléculaire. Ce travail a été soutenu par les fonds de l’USDA-Agricultural Research Service ouvert (Current Research Information System #3655-21220-001). A été confortée par la National Science Foundation (sous le Grant No. DEB-1442148), le centre de recherche de bioénergie DOE Great Lakes (DOE Bureau des sciences DE BER-FC02-07ER64494) et l’USDA National Institute of Food et Agriculture (Hatch projet 1003258). C.T.H. est un érudit de Pew en Sciences biomédicales et Alfred Toepfer Faculté Fellow, appuyé par le Pew Charitable Trusts et la Fondation Alexander von Humboldt, respectivement.

Materials

Name Company Catalog Number Comments
Natupol Beehive Koppert USRESM1 16 hives
Propiconazole 14.3 Quali-Ppro 60207-90-1 Propiconazole 14.3%
Abound Syngenta 4033540 Azoxystrobin 22.9%
Chlorothalonil Syngenta 3452 Fungicide used for trials
Pollen granules Bee rescued B004D5650C 3X 16oz bottles, pollen for trials
Bacterial strains for inoculation Currie Lab
Yeast strains for inoculation Hittinger lab
Primer pairs UW Biotech Center
DNA Isolation Kit Mo Bio 12830-50 Commercial DNA isolation kit
Qubit dsDNA HS Assay Kit Thermo Fisher Q32851 DNA quantification tool
Select Master Mix for CFX Thermo Fisher 4472952 Used to perform real-time PCR using SYBR GreenER dye.
Real-Time PCR Detection System Bio Rad 1855196 Instrument used for PCR amplification
PCR Clean-Up Kit, Axygen 10159-696 Used for efficient removal of unincorporated dNTPs, salts and enzymes
DNA 1000 Kit Agilent 5067-1504 Used for sizing and analysis of DNA fragments
MiSeq Sequencer Illumina Used for next-generation sequencing
Assorted glassware (beaker, flasks, pipettes, test tubes, repietters) VWR

DOWNLOAD MATERIALS LIST

References

  1. Potts, S. G., Biesmeijer, J. C., Kremen, C., Neumann, P., Schweiger, O., Kunin, W. E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol Evolut. 25, (6), 345-353 (2010).
  2. Vanengelsdorp, D., Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J Invertebr Pathol. 103, Suppl 1. S80-S95 (2010).
  3. Ellis, J. D., Evans, J. D., Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, (1), 134-136 (2010).
  4. Vanbergen, A. J. Insect Pollinators Initiative. Threats to an ecosystem service: pressures on pollinators. Front Ecol Environ. 11, (5), 251-259 (2013).
  5. Cameron, S. A., et al. Patterns of widespread decline in North American bumble bees. Proc. Natl. Acad. Sci. U.S.A. 108, (2), 662-667 (2011).
  6. Szabo, N. D., Colla, S. R., Wagner, D. L., Gall, L. F., Kerr, J. T. Do pathogen spillover, pesticide use, or habitat loss explain recent North American bumblebee declines? Conser Lett. 5, (3), 232-239 (2012).
  7. Klein, A. -M., et al. Importance of pollinators in changing landscapes for world crops. Proc R Soc Lond [Biol]. 274, (1608), 303-313 (2007).
  8. Sánchez-Bayo, F., Goulson, D., Pennacchio, F., Nazzi, F., Goka, K., Desneux, N. Are bee diseases linked to pesticides? - A brief review. Environ Int. 89, 7-11 (2016).
  9. Kwong, W. K., Moran, N. A. Gut microbial communities of social bees. Nature Rev. Microbiol. 14, (6), 374-384 (2016).
  10. Engel, P., et al. The Bee Microbiome: Impact on Bee Health and Model for Evolution and Ecology of Host-Microbe Interactions. mBio. 7, (2), e02164-e02115 (2016).
  11. Henry, M., et al. A common pesticide decreases foraging success and survival in honey bees. Science. 336, (6079), New York, N.Y. 348-350 (2012).
  12. Pettis, J. S., vanEngelsdorp, D., Johnson, J., Dively, G. Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Die Naturwissenschaften. 99, (2), 153-158 (2012).
  13. Williamson, S. M., Wright, G. A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honeybees. J. Exp. Biol. 216, (10), 1799-1807 (2013).
  14. Artz, D. R., Pitts-Singer, T. L. Effects of fungicide and adjuvant sprays on nesting behavior in two managed solitary bees, Osmia lignaria and Megachile rotundata. PLoS ONE. 10, (8), (2015).
  15. Johnson, R. M., Wen, Z., Schuler, M. A., Berenbaum, M. R. Mediation of Pyrethroid Insecticide Toxicity to Honey Bees (Hymenoptera: Apidae) by Cytochrome P450 Monooxygenases. J. Econ. Entomol. 99, (994), 1046-1050 (2006).
  16. Pilling, E. D., Bromleychallenor, K. A. C., Walker, C. H., Jepson, P. C. Mechanism of synergism between the pyrethroid insecticide lambda-cyhalothrin and the imidazole fungicide prochloraz, in the honeybee (Apis mellifera L). Pest Biochem Physiol. 51, (1), 1-11 (1995).
  17. Iwasa, T., Motoyama, N., Ambrose, J. T., Roe, R. M. Mechanism for the Differential Toxicity of Neonicotinoid Insecticides in the Honey Bee Mechanism for the differential toxicity of neonicotinoid insecticides in the honey bee, Apis mellifera. Crop Protection. (2016).
  18. Mullin, C. A., et al. High levels of miticides and agrochemicals in North American apiaries: implications for honey bee health. PLoS One. 5, (3), e9754 (2010).
  19. Pettis, J. S., Lichtenberg, E. M., Andree, M., Stitzinger, J., Rose, R., Vanengelsdorp, D. Crop pollination exposes honey bees to pesticides which alters their susceptibility to the gut pathogen Nosema ceranae. PLoS One. 8, (7), e70182 (2013).
  20. David, A., et al. Widespread contamination of wildflower and bee-collected pollen with complex mixtures of neonicotinoids and fungicides commonly applied to crops. Environ Int. 88, 169-178 (2016).
  21. Zhu, W., Schmehl, D. R., Mullin, C. A., Frazier, J. L. Four common pesticides, their mixtures and a formulation solvent in the hive environment have high oral toxicity to honey bee larvae. PLoS One. 9, (1), e77547 (2014).
  22. Simon-Delso, N., Martin, G. S., Bruneau, E., Minsart, L. A., Mouret, C., Hautier, L. Honeybee colony disorder in crop areas: The role of pesticides and viruses. PLoS ONE. 9, (7), (2014).
  23. Park, M. G., Blitzer, E. J., Gibbs, J., Losey, J. E., Danforth, B. N. Negative effects of pesticides on wild bee communities can be buffered by landscape context. Proc R Soc Lond [Biol]. 282, (1809), (2015).
  24. van Engelsdorp, D., et al. "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J Invertebr Pathol. 101, (2), 147-149 (2009).
  25. Bernauer, O. M., Gaines-Day, H. R., Steffan, S. A. Colonies of bumble bees (Bombus impatiens) produce fewer workers, less bee biomass, and have smaller mother queens following fungicide exposure. Insects. 6, (2), 478-488 (2015).
  26. Tu, C. M. Effect of fungicides, captafol and chlorothalonil, on microbial and enzymatic activities in mineral soil. J Environ Sci Health B. 28, (B28), 67-80 (1993).
  27. Huang, C. -Y., Ho, C. -H., Lin, C. -J., Lo, C. -C. Exposure effect of fungicide kasugamycin on bacterial community in natural river sediment. J Environ Sci Health B. 45, (5), 485-491 (2010).
  28. Artigas, J., et al. Effects of the fungicide tebuconazole on microbial capacities for litter breakdown in streams. Aquat. Toxicol. 122, 197-205 (2012).
  29. Goerzen, D. W. Microflora associated with the alfalfa leafcutting bee, Megachile rotundata (Fab) (Hymenoptera: Megachilidae) in Saskatchewan, Canada. Apidologie. 22, (5), 553-561 (1991).
  30. Anderson, K. E., Sheehan, T. H., Eckholm, B. J., Mott, B. M., DeGrandi-Hoffman, G. An emerging paradigm of colony health: Microbial balance of the honey bee and hive (Apis mellifera). Insectes Sociaux. 58, (4), 431-444 (2011).
  31. Crotti, E., et al. Microbial symbionts of honeybees: a promising tool to improve honeybee health. N. Biotechnol. 30, (6), 716-722 (2013).
  32. Koch, H., Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. U.S.A. 108, (48), 19288-19292 (2011).
  33. Anderson, K. E., et al. Microbial ecology of the hive and pollination landscape: bacterial associates from floral nectar, the alimentary tract and stored food of honey bees (Apis mellifera). PloS One. 8, (12), e83125 (2013).
  34. Evans, E. C., Spivak, M. Effects of Honey Bee (Hymenoptera: Apidae) and Bumble Bee (Hymenoptera: Apidae) Presence on Cranberry (Ericales: Ericaceae) Pollination. J Econ Entomol. 99, (3), 614-620 (2006).
  35. Goulson, D., et al. Can alloethism in workers of the bumblebee, Bombus terrestris, be explained in terms of foraging efficiency? Anim. Behav. 64, (1), 123-130 (2002).
  36. ThermoFisher Scientific. User Guide: Qubit dsDNA HS Assay Kits. Available from: https://tools.thermofisher.com/content/sfs/manuals/Qubit_dsDNA_HS_Assay_UG.pdf 3-6 (2010).
  37. Khadempour, L., LeMay, V., Jack, D., Bohlmann, J., Breuil, C. The Relative Abundance of Mountain Pine Beetle Fungal Associates Through the Beetle Life Cycle in Pine Trees. Microbial Ecol. 64, (4), 909-917 (2012).
  38. Dorn-In, S., Hölzel, C. S., Janke, T., Schwaiger, K., Balsliemke, J., Bauer, J. PCR-SSCP-based reconstruction of the original fungal flora of heat-processed meat products. Int J Food Microbiol. 162, (1), 71-81 (2013).
  39. Klindworth, A., et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, (1), (2013).
  40. White, T., Bruns, T., Lee, S., Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications. 18, (1), 315-322 (1990).
  41. Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Available from: http://ngs.biodiv.tw/NGSCore/wp-content/uploads/Documents/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  42. Kõljalg, U., et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 22, (21), 5271-5277 (2013).
  43. Wang, Q., Garrity, G. M., Tiedje, J. M., Cole, J. R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 73, (16), 5261-5267 (2007).
  44. Team, R. C. R: A language and environment for statistical computing [Computer software]. R Foundation for Statistical Computing. Vienna, Austria. (2015).
  45. Kaltenpoth, M., Engl, T. Defensive microbial symbionts in Hymenoptera. Funct Ecol. 28, (2), 315-327 (2014).
  46. Gerth, M., Saeed, A., White, J. A., Bleidorn, C. Extensive screen for bacterial endosymbionts reveals taxon-specific distribution patterns among bees (Hymenoptera, Anthophila). FEMS Microbiol Ecol. 91, (6), (2015).
  47. Smith, C. J., Osborn, A. M. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology. FEMS Microbiol Ecol. 67, (1), 6-20 (2009).
  48. Kim, M., Morrison, M., Yu, Z. Evaluation of different partial 16S rRNA gene sequence regions for phylogenetic analysis of microbiomes. J Microbiol Methods. 84, (1), 81-87 (2011).
  49. DeSantis, T. Z., et al. Greengenes, a Chimera-Checked 16S rRNA Gene Database and Workbench Compatible with ARB. Appl. Environ. Microbiol. 72, (7), 5069-5072 (2006).
  50. Langille, M. G. I., et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature Biotechnol. 31, (9), 814-821 (2013).
  51. Malik, S., Beer, M., Megharaj, M., Naidu, R. The use of molecular techniques to characterize the microbial communities in contaminated soil and water. Environ Int. 34, (2), 265-276 (2008).
  52. Ladurner, E., Bosch, J., Kemp, W. P., Maini, S. Assessing delayed and acute toxicity of five formulated fungicides to Osmia lignaria and Apis mellifera. Apidologie. 36, (3), 449-460 (2005).
  53. Huntzinger, C. I., James, R. R., Bosch, J., Kemp, W. P. Fungicide Tests on Adult Alfalfa Leafcutting Bees (Hymenoptera: Megachilidae). J Econ Entomol. 101, (4), 1088-1094 (2008).
  54. Gradish, A. E., Scott-Dupree, C. D., Shipp, L., Harris, C. R., Ferguson, G. Effect of reduced risk pesticides for use in greenhouse vegetable production on Bombus impatiens (Hymenoptera: Apidae). Pest Manag. Sci. 66, (2), 142-146 (2010).
  55. Calderone, N. W. Insect pollinated crops, insect pollinators and US agriculture: trend analysis of aggregate data for the period 1992-2009. PloS One. 7, (5), e37235 (2012).
  56. Ollerton, J., Winfree, R., Tarrant, S. How many flowering plants are pollinated by animals? Oikos. 120, (3), 321-326 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics