마우스 마음에서 과발현하는 rAAV9의 제조 또는 최저 유전자

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

뮤린 모델에서 유전 물질의 전달을 통해 심근 발현 또는 특정 유전자의 활성을 조절하는 유전자 기능의 조사를 허용한다. 마음에 그들의 치료 가능성도 결정될 수있다. 마우스 마음에 생체 분자의 개입에 대한 제한된 접근 방법이있다. 재조합 아데노 관련 바이러스 (rAAV) 기반 게놈 엔지니어링은 생체 내 심장 유전자 조작을위한 필수적인 도구로 활용되고있다. 이 기술의 구체적인 장점은 최소한의 높은 효율, 특이성, 낮은 게놈 통합 레이트를 포함 면역 원성, 최소한의 병원성. 여기서, rAAV9 벡터를 구성하는 패키지와 정화 상세한 절차를 설명한다. 신생아 새끼로 rAAV9의 피하 주사는 간 및 기타 조직에서 강력한 발현 또는 마우스 심장에 대한 관심의 유전자 (들)의 효율적인 최저의 결과가 아니라. 심장-보고 특정 사용C TnnT2 프로모터, 마음에 GFP 유전자의 고 발현을 얻었다. 또한, rAAV9-U6-shRNA를가 이용 될 때의 mRNA가 마음에 억제 대상. rAAV9 기술의 지식을 작업 심장 혈관 연구에 유용 할 수있다.

Introduction

다양한 생물학적 시스템에서 특정 유전자의 발현 또는 활성을 제어하는 유전자 기능 (1)의 연구에 귀중한 전략이되고있다. 이러한 목적을 달성하는 직접적인 방법은 뉴클레오티드 서열을 조작하여 돌연변이 대립 유전자를 생성한다. 살아있는 세포의 게놈에 정확한 타겟 변경하는 것은있을지라도 a는 시간과 노동 집약적 인 연습, 강력한 TALEN 및 Crispr / Cas9 도구의 개발은 게놈 편집 2-5의 새로운 시대를 열었습니다. 유전자 조작보다 일상적인 실험 방법은 유전 물질 (DNA를 코딩 서열 또는 siRNA를 / shRNA를 포함하는 RNA를) 명시 적 또는 관심 1,6의 유전자 (들)를 넉다운 할 수있는 세포로을의 도입에 초점을 맞추고있다.

많은 경우에, 유전자 조작을위한 주요 병목 세포 내로 DNA, RNA 또는 단백질의 전달이다. 시험관 연구와 관련, 효율적인 transfecti로시스템에 많은 배양 세포 라인에 설립되었습니다. 그러나, 특히 마우스 모델에서 생체 내 유전자 전달은 더 도전이다. 외인성 시약의 효율적인 세포 흡수를 달성하기 위하여 바이 패스 될 필요 역외 세포 내 장벽의 시리즈가있다. 추가 장애물은 신속한 통관 및 전달 물질의 7,8의 짧은 기간을 포함한다. 이러한 문제를 회피하기위한 한 가지 전략은 생체 내 유전자 전달에 대한 "캐리어"또는 "차량"으로 바이러스 벡터를 사용하는 것이다. 바이러스의 자연적 진화 전달 특성은 세포 7,9,10에 관심있는 유전자의 효율적인 전달을 할 수 있습니다. 바이러스 벡터의 많은 종류가 개발 마우스에서 다른 유형의 세포 및 기관의 생체 내 유전자 조작 유연한 사용되었다.

가장 일반적으로 사용되는 바이러스 시스템은 레트로 바이러스, 렌티 바이러스, 아데노 바이러스 및 아데노 - 관련 바이러스 (AAV)를 포함 12-14에서 형질 도입 유전자의 평생 발현의 가능성을 제공하고, 유사 분열 분할 중에 안정한 방식으로 숙주 세포의 게놈에 유전 물질을 도입 할 수있다. 그러나, 레트로 바이러스의 여러 유형의 세포만을 분할 감염, 비 - 분할 세포의 효능 15 매우 낮다. 이 유전자 전달을 위해 자신의 유틸리티를 제한합니다. 렌티 바이러스는 Retroviridae 가족의 속입니다. 다른 레트로 바이러스와는 달리, 렌티 바이러스 모두 분할 및 비 - 분할 세포를 감염시킬 수있는 널리 포스트 유사 분열 및 고도로 분화 된 세포 (16)에 유전자 전달을 위해 사용되었다. 렌티 바이러스의 생활주기는 숙주 게놈 내로 벡터 DNA의 통합을 포함한다. 따라서,의 Lentivirus이 매개 유전자 전달은 형질 유전 적 요소 16-18의 안정적이고 오래 지속 표현을 할 수 있습니다. 그러나이 기능은 이중 전자를 나타낼 수있다벡터 DNA의 통합 삽입 성 돌연변이를 초래할 수있다 이러한 바이러스의 사용 dged 검, 유전자 발현을 조작 할 및 숙주 세포에 artefactual 효과를 일으킬 수 있습니다. 아데노 다른 널리 사용되는 유전자 전달 시스템이다. 레트로 바이러스 및 렌티 바이러스와는 달리, 아데노 바이러스는 비 통합하고 숙주 세포의 게놈 8,10,11,19 무결성을 방해하지 않는다. 또한, 아데노 바이러스는 많은 종류의 세포로 DNA를 형질 감염 할 수 있으며, 감염 활성 세포 분열 (19)에 의존하지 않다. 바이러스 벡터의 능력 (19, 20)를 복제 할 필요 같이 아데노 바이러스의 또 다른 중요한 특징은, 벡터 정제의 용이성이다. 그러나, 이러한 시스템의 주요주의 할 점은 아데노 바이러스 감염, 특히 유전자 치료 연구에서, 여러 연구에서의 사용을 제한하는 대상 세포 및 기관 (19)의 강한 면역 반응을 유발할 수 있다는 것이다.

서로 다른 유형에 비해바이러스 벡터들, 재조합 아데노 - 관련 바이러스 (rAAV)는 이상적인 유전자 전달 시스템 (21, 22)로 나타난다. 그것은 최소한의 면역 원성 및 병원성 (23, 24)을 나타낸다. 또한 rAAV는 핵공 포함한 세포 유형의 넓은 범위를 감염시킨다. 대부분의 경우, rAAV가 숙주 게놈에 통합되지 않는다; 따라서, 표적 세포의 바람직하지 않은 유전자 또는 게놈 변화의 위험이 낮은 (22)이다.

최근 rAAV 시스템 성공적 쥐 심근 23,25-29 DNA로 인코딩 단백질의 miRNAs, shRNA를하고 Crispr-gRNAs의 생체 내 전달을 위해 사용되었다. 이 방법론은 심혈관 연구 분야의 기초 연구 및 유전자 치료 연구를 촉진했다. 여기서, 자세한 절차는 효율적으로 기술되었다 과발현 또는 마우스 마음에 대한 관심의 유전자를 녹다운 rAAV9 벡터를 생성한다. 프로토콜은 간단하고 효과적인 방법을 제공한다실험 쥐 모델에서 심장 유전자 발현을 조작.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

모든 기술 단계는 바이오 안전성위원회와 보스턴 어린이 병원의 기관 동물 관리 및 사용위원회에 의해 승인 된 프로토콜에 따라 수행 하였다. 보스턴 어린이 병원은 규제 빛 / 어둠주기와 온도 조절과 무균 마우스 시설을 갖추고 있습니다. 수의학 및 동물 관리 직원의 변화 케이지는 마우스의 상태를 확인합니다. 시설은 AAALAC 인증을하고 활동적인 동물 복지 보증 인증 (AAALAC의 인증이 1992년 2월 24일 동물 복지 보증 번호를 부여. : A3303-01)이있다. 마우스는 가압 가스 공급원으로부터 공급 CO (2)에 의해 안락사시켰다. 조직 샘플은 정지 한 동물의 심장 박동수, 움직임 및 호흡 확인 후 수집 하였다. 신생아 설치류 2 안락사를 공동 내성과 날카로운 가위를 사용하여 잘린에 의해 안락사시켰다. 이러한 방법은 미국 수의학 메디카의 안락사에 대한 패널의 권고와 일치리터 협회.

플라스미드 백본으로의 cDNA 또는 shRNA를 발현 카세트를 복제하여 rAAV9를 구축 1. 생성

참고 : rAAV9 플라스미드 유전자 과발현에 사용되는 반전 터미널 반복 AAV2의 (LTR에)을 함유하는 닭 TNNT2 항구하도록 수정되었습니다 형질 유전자 25,26,29의 심근 - 특이 적 발현을 가능하게 프로모터 (rAAV9.cTNT). 고유 된 NheI 및 KpnI로 절단 부위는 프로모터 하류의 플라스미드에 도입되었다. 관심의 유전자를 코딩하는 cDNA 단편을 이들 두 제한 부위를 사용하여 25,26,29 rAAV9 골격 내로 클로닝 될 수있다. 여기서, 예를 들어, 마우스 마음에 GFP 유전자의 과발현을위한 rAAV9 벡터를 생성 하였다. 그 결과 플라스미드이 ITR 사이트 (그림 1) 측면에 나란히 서고 cTnT의 :: GFP 카세트가 포함되어 있습니다. rAAV9.U6 ::의 shRNA 구조는 25 녹다운 유전자를 사용 하였다. 사용하여 디자인 shRNA를온라인 shRNA를 디자인 서버. rAAV9.U6 :: shRNA를 어닐링함으로써 상기 U6 프로모터를 보유하는 제한 효소 소화 rAAV9 벡터로의 shRNA 서열을 DNA를 함유 올리고 결찰 또는 장거리하여 PCR과 분자 내 깁슨 조립체 기반 "완벽"하거나 생성 할 수있다 건설 30. 그 결과 플라스미드이 ITR 사이트 (그림 2) 측면에 나란히 서고 U6-shRNA를 카세트를 포함해야합니다. 여기서, 일례로서, rAAV9.U6 :: shRNA를 벡터는 mRNA의 Trbp (: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG Trbp shRNA를 순서) 넉다운하도록 구성 하였다. 스크램블의 shRNA는 음성 대조군 (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG)로서 사용 하였다.

  1. rAAV9 플라스미드 골격으로하는 cDNA 또는 shRNA를 발현 카세트를 복제. 유능한 대장균 세포 (25)으로 DNA를 변형.
    주 : DNA rAAV9 변환에 사용하거나 stbl3 STBL2 대장균 세포가 원하지 않는 ITR 재결합을 최소화하기.
  2. 데리러형질 전환 된 대장균 세포에서 양성 클론. 릴리 - 바넷 매체의 500 ml의의 문화를 증폭하고 박테리아 세포 25-30에서 rAAV9 플라스미드를 추출합니다.
    주 : MIDI / 맥시 DNA (> 100 μg의) 높은 양을 얻기 위해 rAAV9 플라스미드 수험. 전술 한 바와 같이 바이러스를 생성하기 전에, 항상 제한 소화 및 아가 로스 겔 전기 영동에 의해 AAV 플라스미드 서열 무결성 분석 (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

rAAV9 플라스미드 HEK293 세포의 형질 감염 2

  1. 선형 폴리에틸렌 이민 (PEI) 솔루션의 1 μg의 / μl를 준비합니다. 내 독소 무 DH에서 70-80 ℃로 가열 된 2 O를 PEI 분말을 녹인다. RT까지 애프터, 1 M HCl로 pH를 7.0으로 용액을 중화. 필터 소독 (0.22 μm의) 솔루션. 1 μg의 / μL PEI 원액 (1,400 μL / 튜브) 나누어지는 및 오디오 솔루션을 저장-20 ° C에서 이온.
  2. 10 % 소 태아 혈청 (FBS) 및 1 % 페니실린 / 스트렙토 마이신을 둘 베코 변형 이글 중간 (DMEM)에서 배양 HEK293 세포. 배양 5 ± 0.5 %의 이산화탄소와 37 ° C의 배양기에서 세포 (CO 2).
  3. 2 희석 : 1 일 0시 10 150-mm 요리에 1 분할> 90 % 합류 세포의 형질 전환 이전에 18 ~ 20 시간을 HEK293 세포를 접시.
    참고 : 1 일에, 세포는 90 %의 합류에 도달해야한다.
  4. 1 일에서, rAAV9 플라스미드 (예를 들어, rAAV9.cTNT :: GFP 또는 rAAV6.U6 :: shRNA를 구축), 광고 도우미 플라스미드 및 PEI 25,26,29를 사용하여 AAV-담당자 / 캡 플라스미드와 HEK293 세포를 형질.
    1. 90 %의 합류 세포의 10 요리를 들어, 50 ml의 원심 분리기 튜브에 광고 도우미 플라스미드의 70 AAV-담당자 / 캡 플라스미드의 μg의, rAAV9 플라스미드 PF 70 μg의, 200 μg의 혼합.
    2. 세포 융합 적은 경우 비례 DNA 량을 조정한다. 세포가 75 % 합류에있는 경우 예를 들어,을 줄이기비례 DNA의 양 (단계 2.4.1에 표시된 금액의 90분의 75) : 70 X 90분의 75 = AAV-담당자 / 캡 플라스미드의 58.3 μg의, rAAV9 플라스미드의 X 90분의 75 = 58.3 μg의 70, 200 X 믹스 50 ㎖의 원심 분리기 튜브 광고 도우미 플라스미드의 90분의 75 = 166.7 μg의.
    3. 50 ML 튜브에 (FBS)없이 RT DMEM의 49 ML을 추가하고 잘 섞는다.
    4. PEI를 만들기 위해 PEI 솔루션의 1,360 μl를 추가 : DNA 비율 (V / w)는 4 일 : 1. 잘 섞다. 30 분 - 15 RT에서 품어.
    5. (열 150 mm 접시에 대해, 혼합물을 50 mL)을 각각 150 mm 접시에 단계 2.4.4에서 제조 한 혼합물을 5 mL를 추가한다.
  5. 문화 60-72 시간 동안 5 ± 0.5 % CO 2와 37 ° C를 인큐베이터에있는 세포.

3. 수확 트랜 HEK293의 세포와 rAAV9 벡터의 정화

  1. 세포를 형질 감염 후 60-72 시간을 수확. 시키다 최대 피펫 팅하여 배양 배지 아래 접시에 세포를 정지. 멸균하는 모든 세포 현탁액을 전송50ml의 튜브.
  2. 5 분 동안 500 XG에 세포를 원심 분리기. 각 튜브에 5 ㎖ PBS로 세포 펠렛을 재현 탁 한 50 ㎖ 튜브에 모든 세포 현탁액을 결합한다.
  3. 5 분 동안 500 XG에 세포를 원심 분리기. 상층 액을 버린다. 이 단계에서, -80 ° C에서 세포 펠렛을 보관하거나 즉시 단계 3.4-3.15에 설명 된 것처럼 펠렛으로부터 AAV 정제.
  4. 150 mM의 염화나트륨 및 20 mM 트리스 - 염산, pH가 8.0 : 용해 버퍼를 준비합니다. 필터 소독 (0.22 μM). 4 ° C에서 버퍼를 저장합니다.
  5. 용해 완충액 10 mL로 펠렛을 재현 탁.
  6. 해동 후 37 ° C에서 -80 ° C에서 또는 드라이 아이스 / 에탄올 배스에서 동결 해물. 1 분 동안 소용돌이. 동결과 용해 액을 3 회 해동.
  7. 해동 해물로의 MgCl 2 용액을 추가 (1 mM의 수 분해물에서의 MgCl 2의 최종 농도를 확인하십시오). 250 U / ㎖의 최종 농도로 클레아 추가. DNA / 단백질 AGGR을 용해 15 분 동안 37 ℃에서 인큐베이션egation.
    참고 : DNA / 단백질 응집은 클레아 제 또는 효소 처리 후 용해되지 않는 경우 다운스는 해물을 20 번 균질화.
  8. 4 ℃에서 20 분 동안 4,800 XG에서 샘플을 원심 분리기. 상층 액을 수집합니다.
  9. 한편, Iodixanol 그라데이션 용액을 제조 :
    1. 10 배 PBS 5 ㎖, 1 M의 MgCl 2, 0.05 ㎖, 1 M KCl을 0.125 ㎖, 5 M NaCl을 10 ㎖ 및 구배 매질 ofdensity 12.5 ml를 혼합하여 구배 용액의 17 %를 준비한다. H 2 O를 사용하여 50 ㎖로 전체 볼륨을 조절
    2. 10 배 PBS 5 ㎖, 1 M의 MgCl 2, 0.05 ㎖, 1 M KCl을 0.125 ㎖, 밀도 구배 배지 20 ㎖, 0.5 %, 0.2 ㎖ (w / v)의 페놀 레드를 혼합하여 25 % 용액을 제조 하였다. H 2 O를 사용하여 50 ㎖로 전체 볼륨을 조절
    3. 10 배 PBS 5 ㎖, 0.05 ~ 1 M의 MgCl 2 ㎖, 1 M KCl을 0.125 ㎖, 및 밀도 구배 매체를 33.3 mL로 혼합하여 40 % 용액을 제조 하였다. 사용하여 50 ㎖로 전체 볼륨을 조절H 2 O
    4. 혼합하여 60 % 용액을 제조 0.05 ml의 1 M의 MgCl 2, 1 M KCl을 0.125 ㎖를 밀도 구배 배지 50 ㎖, 0.1 ㎖의 0.5 % (W / V) 페놀 레드.
  10. 바늘과 주사기, 바닥부터 60 % 5 17 %의 ㎖, 25 %의 5 ㎖, 40 % 5 ㎖ 및 5 ㎖의 순으로 폴리 프로필렌 튜브에 Iodixanol 구배 용액로드. 그라디언트의 상단에 단계 3.8 (14 ~ 16 ㎖)에서 얻은 모든 해물을 넣습니다. 아래에서 위로 나와 구배, 60 %, 40 %, 25 %, 17 %, 및 파쇄 층이다. 용해 버퍼와 튜브를 입력하고 코르크로 커버.
  11. 16 ° C에서 90 분 동안 185,000 XG에 원심 분리기.
  12. 주사기 바이러스 분획 (40 % 층)을 수확. 단지 40 %의 층을 흡입, 40 %와 60 % 분수 사이의 교차점에 바늘 (21 게이지)를 삽입합니다.
    주 : 25 % 층의 어떤을 흡입하지 마십시오.
  13. 멸균 폴리 옥시 에틸렌 - polyoxypro으로 바이러스 성 부분을 혼합15 ml의 총 부피 : 최대 pylene 블록 공중 PBS 용액 (PBS에 희석 10,000 10 % 폴리 옥시 에틸렌 - 폴리 옥시 프로필렌 블록 공중 합체의 1 개). 필터 튜브 (차단 MW = 100 kD의)에 혼합물을로드합니다. 4 ℃에서 30 분 동안 2,000 XG에 원심 분리기.
  14. 하단의 솔루션을 폐기하십시오. 15 ml의 총 부피로 폴리 옥시 에틸렌 - 폴리 옥시 프로필렌 블록 공중 합체를 PBS 용액으로 필터 튜브 리필. 4 ℃에서 20 분 동안 2,000 XG에 원심 분리기. 이 단계를 두 번 더 반복합니다. 정제 된 rAAV9 바이러스 (필터 위의 부분)를 수집합니다.
  15. 1.7 mL의 튜브에 필터 튜브의 정제 rAAV9을 전송합니다. 정제 된 rAAV9 나누어지는 (100 - AAV의 볼륨 및 역가에 따라 400 μL / 튜브) 및 -80 ° C에서 바이러스를 저장합니다.
    참고 : 반복 동결 해빙을 피하십시오.

rAAV9의 역가 4. 측정

  1. 표준 DNA 샘플을 준비합니다.
    1. 구체적이고 효율적인 PCR 디자인rAAV9 벡터에 대한 프라이머와는 PCR 조건을 최적화 할 수 있습니다.
      참고 : "TCGGGATAAAAGCAGTCTGG, 역방향 : 정 TCGGACGGAGATACGTGAGT을"이 연구에 사용 된 프라이머이다. PCR 반응은 다음과 같은 조건으로 수행 하였다 : 초기 변성을 3 분 동안 95 ℃로; 20 초, 15 초, 60 ° C, 10 초 동안 72 ° C 95 ° C의 35주기; 10 분 동안 72 ℃에서 최종 연장. rAAV9 벡터에 삽입 된 서열을 PCR (31)의 특이성 및 효율에 영향을 미칠 수있다 그러나, 최적화 된 프라이머와 PCR 조건은 특정 플라스미드이다.
    2. 단계 4.1.1에 도시 된 상태로 PCR 반응을 수행한다. 겔 추출 키트와 PCR 생성물을 정제 하였다.
    3. 분광 광도계를 사용하여 정제 된 DNA의 농도를 측정한다. PCR 산물의 분자량 / 길이에 기초 DNA 분자 수의 농도를 계산한다.
      1. 다음 식을 사용하여 분자의 농도를 계산한다 모lecular 농도 (DNA 분자 또는 조각 / ㎖) = 6.23 × 10 23-1 X 콘. × 10 -6 / MW. 참고 : (6.23 × 10 23-1 Avagadro의 수이다 콘 : DNA 농도 μg의 / ㎖에서, MW : g / 몰의 분자량). PCR 산물의 수득 농도가 100 μg의 / ㎖이고, 길이는 200 bp의 경우, 예를 들어, 이중 가닥 DNA의 분자량은 각각의 뉴클레오티드 2 X 200 X 310 = 124,000 (평균 분자량은 단일 가닥 DNA는 약 310g / 몰)입니다. 분자 농도 (DNA 분자 / ㎖)을 6.23 X 10 23-1 × 100 μg의 / ㎖ X 10-6 / 124,000g / 몰 = 5.18 × 106 (14) DNA 분자 / ㎖를 =.
      2. 1013 분자 / ㎖, 10 내지 12 분자 / ㎖, 1011 분자 / ㎖, 1010 분자 / ㎖, 109 분자 / ㎖, (10)의 농도의 DNA 단편의 일련의 희석을 수행하여 표준 시료를 조제 (7) 분자 / ㎖. (단계 4.6, qPCR에) 정량 PCR의 각 표준 샘플 액 1 μl를 사용합니다.
  2. 10 배의 DNase 완충액 5 μL, 1 μL의 DNase (10,000 U / ㎖)이 DDH O. 39 μl의 총 부피는 50 μL로 정제되어야 rAAV9 용액 5 μl를 섞는다.
  3. 잔류 패키징 플라스미드 DNA를 제거하기 위해 30 분 동안 37 ℃에서 유리 병을 부화.
  4. 10 분 동안 95 ° C에서 DNase의 불활. 용액을 냉각 H 2 O 44 μL, 10 배의 DNase 버퍼의 5 μL 및 테 K 주식의 1 μL (10 ㎎ / ㎖)를 추가합니다.
  5. 2 시간 동안 50 ° C에서 상기 용액을 인큐베이션. 반응을 정지하고 10 분간 95 ℃에서 테 K 불 활성화.
  6. 정량적 PCR (qPCR에) 분석을위한 시료의 1 μl를 사용합니다. 역가를 계산합니다.
    1. 샘플의 FR을 사용하여 단계 4.1.1 설계 프라이머로 정량적 PCR (qPCR에)를 실행옴 단계 4.1.4 (표준 시료) 및 4.5 단계에서 (샘플을 측정 할).
      1. 각 반응의 경우, (Taq 중합 효소,의 dNTP 혼합물, 버퍼의 MgCl 2 및 녹색 염료 함유) 배 그린 마스터 믹스를 10 ㎕의 정방향 프라이머 (5 μM) 0.5 ㎕의 역방향 프라이머 (5 μM) 0.5 ㎕를 혼합 H 2 O 8 μL, 샘플 1 ㎕를 측정한다. 다음의 조건을 qPCR을 수행하여 2 분, 10 분, 95 ° C, 50 ° C에서 샘플을 보유; 15 초 동안 1 분 동안 60 ° C에서 95 ° C에서 40 사이클을 수행; 용융 단계를 들면, 30 초, 15 초 동안 60 ° C에서 95 ° C에서 샘플을 배양한다. 표준 시료 (그림 3)의 C T 번호에 따라 표준 곡선을 생성합니다.
    2. 표준 곡선에 대한 AAV 샘플의 분자 농도 / 역가를 계산합니다. rAAV9 단일 가닥 DNA 게놈을 가지고 있으므로, 분자 농도보다 2 배 것계산 된 값 (배 전원 (10, y)를,도 3b). 또한, 정제 rAAV9의 역가 인해 DNase를 테와 K의 반응에 바이러스 (100 μl의 총 5 μL)의 1시 20분 희석 계산에서 얻어진 것보다 더 높은 20 배 것이다.

마음에 신생아 마우스 및 유전자 발현 분석 실험 5. rAAV9 주입

  1. 폴리 옥시 에틸렌 - 폴리 옥시 프로필렌 블록 공중 합체 PBS 용액 rAAV9 작업 용액을 준비한다. 1-7 × 10 12 입자 / ml의의 역가와 바이러스 재고를 확인하십시오.
    참고 : 피하 주사하여 각 출생 후의 일 0.5 ~ 1.5 마우스로 rAAV9 솔루션의 50-70 μl를 제공합니다. 효율적인 유전자 과발현 또는 최저를 달성하기 위하여, 주입 AAV의 양을 최적화하기 위해 각 연구에 대한 파일럿 테스트를 수행 할 것을 권장한다. 바이어스를 최소화하기 위해 각 연구 rAAV9.cTNT :: 루크 또는 rAAV9.U6 :: 스크램블 컨트롤의 동일한 금액을 사용합니다.
    참고 : 우리는 1.5을 사용× 10 11 개 / 강아지 과발현 및 2.5 - 출생 후 하루 0.5 ~ 1.5 마일 CE)에서 최저 5 × 10 11 개 / 강아지.
  2. 피하 주사에 의해 P0.5-P2.5에서 rAAV9와 신생아 쥐를 치료.
    1. rAAV9 솔루션과 29G1 / 2, 0.33 X 12.7 mm 인슐린 주사기를 사전 입력합니다. 공기 방울을 제거주의하십시오.
    2. 엄지와 집게 손가락으로 한 손에 극저온 마취 강아지를 잡으십시오. 주입 전에, 무균 상태를 유지하기 위해 70 % 이소 프로필 알콜로 포화 된 면봉 막대기와 강아지의 피부를 다시 와이프. 5 내지 10 °의 각도에서 동물의 전방 - 등쪽 피하에 주사기 바늘을 삽입한다. 인슐린 주사기를 사용 rAAV9 용액 50-70 ㎕를 주입한다.
      참고 rAAV9 또한 복강 내 또는 정맥 내 주사 (26, 27)를 통해 마우스에 전달 될 수있다. 마음에 전달 된 유전자의 효율적인 표현을 얻을 수있다. 그러나, 복강 내 분사이온은 때때로 간에서 새는 표현 될 수 있습니다. 주입 후, 새끼 조건 매일 모니터링 하였다.
  3. 마음에 유전자 발현의 수준은 qPCR에, 면역 형광 또는 웨스턴 블롯으로 모니터링 할 수 있습니다 (대표 결과는 그림 4에 표시됩니다 5) 25, 26.
    참고 : 마우스는 압축 가스 소스로부터 전달 CO 2 안락사시켰다. 조직 샘플은 동물의 심장 박동수, 움직임 및 호흡이 멈춘 것을 확인한 후 수집 하였다. 신생아 설치류 2 안락사를 공동 내성과 날카로운 가위를 사용하여 잘린에 의해 안락사시켰다. 이 방법은 미국 수의학 협회의 안락사에 대한 패널의 권고와 일치한다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

rAAV9.cTNT : GFP 또는 rAAV9.U6 :: shRNA를 플라스미드 rAAV9 구조에 대한 전략은 각각도 1 및도 2에 나타내었다. 예로서, rAAV9 벡터는 마우스의 마음에 GFP 유전자를 과발현하기 위해 생성 하였다. 그 결과 플라스미드이 ITR 사이트 (그림 1) 측면에 나란히 서고 cTnT의 :: GFP 카세트가 포함되어 있습니다. rAAV9.U6 :: shRNA를 벡터가 Trbp의 mRNA를 넉다운하기 위해 건설되었다 (그림 2)

rAAV9 적정의 표준 곡선 선형 회귀에 의해 qPCR에 데이터를 생성되었습니다. 조작 변수 Y는 각 표준 시료의 DNA 분자의 농도의 로그 (10)의 값을 나타내고, 해당 변수 X는 C T 값을 나타낸다. 로그 (10) (농도) 값 (Y) 및 C T 번호 (x)는 좋은 선형 상관 관계를 나타낸다 (R 2 = 0.9971) 및 방정식 Y = -0.2832x + 14.616 (그림 3A)이 맞습니다. rAAV9 샘플 역가 선형 방정식 (도 3b)에 기초하여 산출 하였다. 프로토콜 (단계 4.6.2 및도 3b)에 기재된 방법, rAAV9 벡터의 고역가 (50-200 μL> 6 × 1013 입자 / ㎖)를 대표적인 연구를 얻었다.

rAAV9.cTNT 벡터의 효율성과 조직 특이성을 모니터링하려면 P0.5 새끼는 같은 양의 rAAV9.cTNT :: 루시 페라 제 (AAV-루크)의 (1 × 11 개 / 강아지) 또는 rAAV9.cTNT :: GFP 처리 하였다 피하 주사 (AAV-GFP). 두 주 주사 한 후, GFP 신호가 마우스의 다양한 조직에서 관찰되었다. GFP의 강력한 표현은 마음에서 검출 되었으나되지 않은 다른 기관 (그림 4, N> 3)이다. 따라서, 효율적이고 심장 특이 적 유전자 발현은 rAAV9.cTNT 벡터를 얻을 수 있었다.

"FO : 유지-together.within 페이지 ="jove_content 1 "> 최저 효율과 rAAV9.U6 벡터의 조직 특이성을 모니터링하기는 P0.5 마우스는 같은 양의 rAAV9 (3 × 10 11 개 / 강아지)로 처리 하였다 피하 주사에 의해 .U6 :: 스크램블 (AAV-스크램블) 또는 rAAV9.U6 :: Trbp의 shRNA (AAV-shTrbp). 두 주사 후 주, qPCR에 (그림 5에 의해 모니터링 된 다양한 조직에서 Trbp의 발현, N = 3 Trbp의). 마음에 Trbp의 mRNA의 수준이 실질적으로 rAAV9.U6 :: shTrbp (68 % 하향 조절, P = 0.0004452)에 의해 감소되었다. 아래 규정도 rAAV9.U6에서 간 조직에서 검출 된 :: shTrbp 처리 쥐. 그러나, 변화는 훨씬 더 낮다.

그림 1
그림 1 : 전략은 rAAV9.cTNT :: GFP 플라스미드를 구축합니다. (A)에 cTnT의 :: GFP 카세트의 방식. (B TNNT2 프로모터 (rAAV9.cTNT를) 항구하도록 수정되었습니다. GFP 오픈 리딩 프레임은 rAAV9.cTNT :: GFP 플라스미드를 생성하기 위해 제한 부위 결찰 매개하여 rAAV9.cTNT 벡터에 클로닝 하였다. (B)이 rAAV9.cTNT :: GFP 플라스미드 깁슨 조립체로 구성 될 수있다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : 전략은 rAAV9.U6 :: shRNA를 플라스미드를 구축합니다. (A)가 U6의 방식 :: shRNA를 카세트가 도시되어있다. shRNA를 발현은 U6 프로모터 (블루)에 의해 구동된다. (B) rAAV9-U6-shRNA를 카세트는 어닐링 및 결찰에 의해 생성 된 DNA 올리고가 함유 될 수있다U6 프로모터를 품고 제한 효소 소화 rAAV9 벡터에 ING의 shRNA 서열. (C) : rAAV9.U6 shRNA를 카세트가 장거리 PCR과 분자 내 깁슨 조립체 기반 "완벽"구조에 의해 발생 될 수있다. shRNA를의 5 '암, 루프, 및 3'아암 각각 녹색, 주황색에 도시 한 빨간색. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3 : rAAV9 역가의 계산. (A) rAAV9 적정의 표준 곡선은 qPCR의 데이터를 사용하여 선형 공격에 의해 발생되었다. 조작 변수 y를 각 표준 시료의 DNA 분자의 농도의 로그 값 (10)과 대응하는 변수 x를 나타내고는 C T의 값을 나타냅니다. rAAV9 샘플 (B) 역가 표준 곡선의 선형 수학 식에 따라 계산된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 4 : 마우스 조직에서 rAAV9.cTNT :: GFP의 발현 패턴입니다. P0.5 새끼는 피하 주사에 의해 rAAV9.cTNT :: 루시 페라 제 (AAV-루크, 음성 대조군) 또는 rAAV9.cTNT :: GFP (AAV-GFP)의 같은 양의 (1 × 11 개 / 강아지)로 처리 하였다. 두 주 주사 후, 상기 조직 샘플을 수확 하였다. GFP의 발현은 형광 해부 범위에서 측정 하였다. 모두 밝은 필드 및 형광 이미지가 표시됩니다. 실험은 (N> 3)이 3 번 이상 반복 하였다.스케일 바 = 2.0 mm. SKM, 골격 근육. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 5 : AAV-shRNA를 함께 최저 유전자 발현. P0.5 마우스는 피하 주사에 의해 rAAV9.U6 :: 스크램블 (AAV-스크램블) 또는 rAAV9.U6 :: Trbp의 shRNA (AAV-shTrbp) 같은 양의 (3 × 10 11 개 / 강아지)로 처리 하였다. 두 주 주사 후, 다양한 조직에서 Trbp의 mRNA 수준은 qPCR에 의해 모니터링 하였다 (N = 3). 데이터는 평균 ± SEM으로 표시하고 있습니다. 컷오프 P 값은 0.05이다. NS, P> 0.05, 중요하지. **, P <0.01. SKM, 골격 근육. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 플라스미드를 구조 중에 원하지 ITR 재결합을 최소화하는 것이 중요하다. 바이러스를 생성하기 전에, 하나는 항상 제한 분해 및 아가 로스 겔 전기 영동을 사용하여 플라스미드 AAV ITR의 무결성을 모니터링한다. 이는 100 % 그대로 플라스미드를 획득하는 것은 불가능하지만, 재결합 율은 가급적 최소화되어야한다. 20 % 미만에 성공 rAAV9 포장 허용됩니다. 참고로, 저급 진탕 속도 (RPM 180-200)와 하부 온도 (30 °의 C)에서 박테리아를 배양하는 ITR 재조합의 가능성을 감소시킬 수있다.

HEK293 세포가 성공적으로 형질 전환 및 rAAV9 포장 건강한 있는지 확인하는 것이 필수적이다. "정상"세포는 일반적으로 높은 증식하고 빠르게 성장한다. 그러나 급속한 확산 및 HEK293 세포의 성장은 반드시 rAAV9 포장의 높은 효율을 보장하지 않습니다. 따라서, 신선한 세포 실험을 시작하는 것이 중요하다. 이것낮은 통로를 HEK293 세포를 사용하는 것이 좋습니다 rAAV9의 포장 (<10 구절을, 세포를 2-3 일마다 계대된다). 참고로, rAAV의 다른 혈청 형은 다른 절차 (32)를 사용하여 정제 할 필요가 있습니다.

연구자는 rAAV9 플라스미드의 생성에 유연성을 부여됩니다. 어느 제한 부위 결찰 또는 매개 깁슨 조립체 (30)를 사용할 수있다. rAAV9.U6 ::의 shRNA 구조의 경우, 분자 내 깁슨 조립체 기반 전략이 효율적인 방법이다 (도 1 및도 2). 다중 AAV-shRNA를 플라스미드 나는 AAV-shRNA를 빠르게 구성 할 수 풀링. rAAV9를 이용하여 유전자를 과발현하기 위해 삽입 된 cDNA 서열에 대한 크기 제한이 존재한다. 일반적으로 LTR에 간의 크기 단편 미만 5킬로바이트 33 일 필요가있다. 피코 - 촉매 단백질이 접합 rAAV9 벡터 (34)의 장비 크기 제한을 회피 할 수있다.

다른 바이러스 시스템레트로 바이러스, 렌티 바이러스 및 아데노 바이러스를 포함한들 역시 개발가요 유전자 조작을 가능하게하고있다. 최소한의 높은 효율, 특이성, 낮은 게놈 통합 속도 : 바이러스 벡터의 이러한 다른 종류와 비교 rAAV 특정 장점을 갖는다 면역 원성, 최소한의 병원성. 따라서, rAAV 기반 유전자 공학은 생체 내 유전자 조작을위한 이상적인 도구로 부상하고있다.

이전의 연구는 rAAV9 시스템은 생체 내 전달 된 유전자를 효율적으로 발현 가능 것으로 나타났다. cTnT의 (닭 TnnT2) 프로모터로, 심장 관련 유전자 발현 (그림 4) 25, 26를 얻었다. U6 프로모터는 마우스 조직, rAAV9.U6에 의해 대상의 mRNA (Trbp)의 가장 눈에 띄는 억제에 보편적으로 활성화되어 있지만 :: shRNA를 다른 기관에 (그림 5) 중심부에서 관찰되지만되지 않았다. 간은 가장 일반적인 기관은 서로 다른 혈청 형에 의해 형질 도입한다rAAV 35, 36. 그러나, 간에서 최저 효율 (mRNA 발현 36 % 감소)는 심장 (mRNA 발현의 68 % 감소)에서보다 훨씬 낮다. 이것은 간에서 높은 바이러스 게놈의 존재에도 불구하고, rAAV9로의 shRNA의 전신 배달 중심 (35)에 넉다운보다 효율적으로 유전자를 제공하는 것을 보여주는 이전 연구와 일치한다. 간세포가 심근 세포보다 증식하고 더 적극적으로 간 조직에 상당한 벡터 게놈 희석 결과 신생아 나이에 rAAV9 관리, 후 세포 분열을 진행하는 것이 가능하다. 그러나, 이것은 또한 rAAV9의 혈청보다 효율적으로 다른 종류의 세포에 비하여 심근 세포를 형질 도입 수 있음을 시사한다. Lovric 등의 알에 의해 입증으로., 차별화 된 근육 세포에서 DNA 손상 반응 MRN 복잡한 단백질은 억제된다. MRN 복잡한 단백질은 AAV 게놈을 결합하여 전사 침묵을 통해 AAV 전달을 억제한다. 따라서, 당AAV 전달에 missivity은 마음에 유전자 조작에 매우 적합 다른 바이러스 벡터에 비교의 rAAV9 시스템을 만들고, 심근 (36)의 단자 분화에 의해 유도 될 수있다. 또한 다른 기관 (예를 들어, 간), 하나는 심장 (29)에 대한 관심의 유전자를 억제하기 위해 심장 관련 cTnT의 프로모터 중심은 miR-30A 기반 shmiR를 사용할 수있는 바람직하지 않은 최저 영향을 최소화합니다. 이 원고는 심장 혈관 연구에서 rAAV9 기술에 활용에 대한 특정 기술과 독자를 제공합니다.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics