Подготовка rAAV9 к гиперэкспрессией или Нокдаун Гены в мышиных сердец

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Контроль экспрессии или активности специфических генов через инфарктом доставки генетического материала в мышиных моделях позволяет исследовать функции генов. Их терапевтический потенциал в сердце может быть также определена. Существуют ограниченные подходы к молекулярной вмешательства в естественных условиях в сердце мыши. Рекомбинантный аденовирус-ассоциированный вирус (Раав) основе генной инженерии была использована в качестве основного инструмента для сердца манипуляции генов в естественных условиях. Особые преимущества этой технологии включают в себя высокую эффективность, высокую специфичность, низкий уровень геномную интеграции, минимальный иммуногенность, и минимальный патогенность. Здесь подробно процедура построения, упаковки и очистить векторы rAAV9 описано. Подкожное введение rAAV9 в неонатальных крысят приводит к надежной экспрессии или эффективной нокдауна гена (ов), представляющие интерес в сердце мыши, но не в печени и других тканях. Использование сердечной Удельныйбыл получен с TnnT2 промотор, высокий уровень экспрессии гена GFP в сердце. Кроме того, мРНК-мишени ингибируется в сердце, когда использовали rAAV9-U6-shRNA. Практическое знание технологии rAAV9 могут быть полезны для сердечно-сосудистых исследований.

Introduction

Контроль экспрессии или активности специфических генов в различных биологических системах стала ценной стратегией при изучении функции гена 1. Прямым средством достижения этой цели является манипулировать нуклеотидные последовательности и генерируют мутантные аллели. Несмотря на то, что делает точные, целенаправленные изменения в геном живых клеток по-прежнему отнимающий много времени и трудоемкая практика, развитие мощных инструментов Talen и Crispr / cas9 открыл новую эру редактирования генома 2-5. Более рутинной лабораторный метод для генных манипуляций была сосредоточена на введении генетических материалов (ДНК и РНК , содержащих кодирующие последовательности или миРНК / shRNAs) в клетках , чтобы выразить или нокдауна ген (ы) интерес 1,6.

Во многих случаях основным сдерживающим генная инженерия является доставка ДНК, РНК или белка в клетки. Что касается исследований в лабораторных условиях , эффективного transfectiв системах, были установлены во многих культивируемых клеточных линий. Тем не менее, в мышиной модели , в частности, в естественных условиях доставки гена является более сложной задачей. Есть целый ряд внеклеточном и внутриклеточном барьеров, которые необходимо обойти для достижения эффективного клеточного поглощения экзогенных реагентов. Дополнительные препятствия включают быстрый клиренс и короткую продолжительность поставляемого материалов 7,8. Одна из стратегий , чтобы обойти эти проблемы является использование вирусных векторов в качестве "носителей" или "транспортные средства" для в естественных условиях доставки генов. Естественно-эволюционировали свойства трансдукции вирусов позволяют эффективную доставку интересующего гена в клетки 7,9,10. Известны многочисленные типы вирусных векторов, были разработаны и позволяют гибко в естественных условиях манипуляции генов в различных типах клеток и органов у мышей.

Наиболее часто используемые вирусные системы включают ретровирусов, лентивирусов, аденовирусы и адено-ассоциированный вирус (AAV) 12-14. Тем не менее, многие виды ретровирусов инфицируют только делящиеся клетки, и их эффективность в непролиферирующих клетках очень низкий 15. Это ограничивает их полезность для доставки генов. Лентивирус является род семейства ретровирусы. В отличие от других ретровирусов, Лентивирус может заражающие как разделительные и не делящиеся клетки и широко используется для переноса генов в постмитотическими и высоко дифференцированных клеток 16. Жизненный цикл Лентивирус также включает в себя интеграцию векторной ДНК в геном хозяина. Таким образом, Лентивирус-опосредованной доставки генов обеспечивает стабильную и длительную экспрессию трансдуцированных генетических элементов 16-18. Тем не менее, эта функция может представлять собой двойную-еdged меча в использовании этих вирусов манипулировать экспрессию генов, а интеграция векторной ДНК, может привести к инсерционного мутагенеза в клетках-хозяевах и может вызвать артефактного эффекты. Аденовирус является еще одним широко используемой системой доставки генов. В отличие от ретровирусов и лентивирусов, аденовирусов неинтегрированы и не мешают геномного целостности клеток - хозяев , 8,10,11,19. Кроме того, аденовирусы могут трансфекцию ДНК во многие типы клеток, и инфекция не зависит от активной клеточного деления 19. Другой важной характеристикой аденовирусов является легкость очистки вектора, как вирусные векторы имеют возможность быть воспроизведен 19,20. Тем не менее, основной нюанс этой системы является то, что аденовирус - инфекция может вызвать сильный иммунный ответ в клетках - мишенях и органов 19, ограничивающей его применение во многих исследованиях, в частности , в исследованиях по генной терапии.

По сравнению с этими различного типаs вирусных векторов, рекомбинантный аденосателлитные вирус (Раав) , как представляется , система доставки 21,22 идеальным гена. Он обладает минимальной иммуногенность и патогенность 23,24. Кроме того, Раав инфицирует широкий спектр типов клеток, в том числе и как разделяющего непролиферирующих клеток. В большинстве случаев Раав не интегрируется в хост геномов; Таким образом, риск нежелательных генетических или геномных изменений в клетках - мишенях является низким 22.

В последнее время системы Раав были успешно использованы для доставки в естественных условиях ДНК , кодирующей белки, микроРНК, shRNAs и Crispr-gRNAs в сердечной мышцы мыши 23,25-29. Эта методика способствовала фундаментальных исследований и исследований генной терапии в области сердечно-сосудистых исследований. Здесь подробная процедура генерации векторов rAAV9, которые эффективно сверхэкспрессируют или нокдауна генов, представляющих интерес в сердцах мышей было описано. Протокол обеспечивает простой и эффективный методманипулируя экспрессию генов сердца в мышиных экспериментальных моделях.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все описанные шаги были выполнены в соответствии с процедурами, утвержденными Комитетом по биобезопасности и по уходу и использованию животных Institutional комитета Бостонской детской больницы с. Бостон детская больница имеет патогена удобства мышь с регулируемым свет / темнота циклов и климат-контроля. Ветеринарные и ухода за животными садки изменения персонала и обеспечить здоровье мышей. Объекты AAALAC сертифицированы и имеют активные сертификации по обеспечению защиты животных (AAALAC Аккредитация предоставлено на 2/24/1992 обеспечению защиты животных. Номер: A3303-01). Мыши были подвергнуты эвтаназии СО 2 доставлялось из источника сжатого газа. Образцы тканей были собраны после того, как подтверждение того, что частота сердечных сокращений, движение и дыхание животных прекратилось. Новорожденных грызуны устойчивы к CO 2 эвтаназии и подвергали эвтаназии путем декапитации с помощью острых ножниц. Эти методы в соответствии с рекомендациями Группы по эвтаназии Американской ветеринарной Medicaл Ассоциация.

1. Генерация rAAV9 конструктов путем клонирования кДНК или shRNA Expression кассеты в плазмиду Backbone

Примечание: Плазмида rAAV9, содержащий инвертированные концевые повторы (РМЭ) из AAV2, используемые для генной избыточной экспрессии был изменен, чтобы питать куриные TNNT2 промотор (rAAV9.cTNT), что позволяет кардиомиоциты специфическую экспрессию генов трансдуцированных 25,26,29. сайтов Уникальные NheI и KpnI были введены в плазмиду, вниз по течению от промотора. Фрагменты кДНК , кодирующие гены , представляющие интерес , могут быть клонированы в остов rAAV9 с помощью этих двух сайтов рестрикции 25,26,29. Здесь, в качестве примера, был создан вектор rAAV9 для избыточной экспрессии гена GFP в сердце мыши. Полученная плазмида содержит cTNT :: GFP кассеты по бокам двумя ITR сайтов (Рисунок 1). rAAV9.U6 :: shRNA конструкции были использованы для гена нокдаун 25. Дизайн shRNAs использованиемонлайн-серверы дизайн shRNA. rAAV9.U6 :: shRNA могут быть получены либо путем отжига и лигирования олиго-ДНК, содержащие последовательности shRNA в энзим-перевариваются векторов рестрикции rAAV9, несущих промотор U6, или с помощью дальнобойных ПЦР и внутримолекулярное Gibson сборки на основе "бесшовные" строительство 30. Полученную в результате плазмиду должна содержать кассету U6-shRNA в сопровождении двух ИТР участков (рисунок 2). Здесь, в качестве примера, вектор rAAV9.U6 :: shRNA был построен в нокдаун TRBP мРНК (TRBP shRNA последовательности: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). Скремблирования shRNA был использован в качестве отрицательного контроля (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Клонирование кассеты экспрессии кДНК или shRNA в плазмиде позвоночника rAAV9. Преобразование ДНК в компетентные клетки E. Coli 25.
    Примечание: Используйте stbl2 или stbl3 Клетки E.coli для трансформации rAAV9 ДНК , чтобы свести к минимуму нежелательные ITR рекомбинации.
  2. ПоднятьПоложительный клон из трансформированных клеток E.coli. Amplify культуру в 500 мл Лилли-Barnett среды и экстракции плазмидной rAAV9 из бактериальных клеток 25-30.
    Примечание: Midi / Maxi приготовительному плазмиду rAAV9, чтобы получить большое количество ДНК (> 100 мкг). Перед созданием вируса, всегда анализировать целостность прямой последовательности AAV плазмид путем расщепления рестриктазами и электрофореза в агарозном геле, как описано ранее (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Трансфекция клеток HEK293 с rAAV9 плазмид

  1. Готовят 1 мкг / мкл раствора линейного полиэтиленимина (PEI). Растворить порошок PEI в эндотоксинов дН 2 O , который был нагрет до 70-80 ° С. Переохлаждение до комнатной температуры, нейтрализуют раствор до рН 7,0 с помощью 1 М HCl. Фильтр стерилизуют (0,22 мкм) раствор. Алиготе 1 мкг / мкл исходного раствора с PEI (1,400 мкл / пробирка) и хранить Solutиона при -20 ° С.
  2. Культура НЕК293 в Дульбекко в модификации Дульбекко (DMEM) с добавлением 10% фетальной бычьей сывороткой (FBS) и 1% пенициллина / стрептомицина. Культуры клеток в 37 ° C инкубаторе с 5 ± 0,5% углекислого газа (CO 2).
  3. В день 0, плиты клетки НЕК293 в десять 150-мм чашках 18-20 ч до трансфекции путем расщепления> 90% слившихся клеток в разбавлении 1: 2.
    Примечание: В 1-й день, клетки должны достигнуть 90% слияния.
  4. В 1 -й день, трансфекции HEK293 клетки с плазмидой rAAV9 (например, rAAV9.cTNT :: GFP или rAAV6.U6 :: shRNA конструирует), Ad-Helper плазмиды и AAV-Rep / Cap плазмиды с использованием PEI 25,26,29.
    1. За 10 чашки клеток при 90% слияния, смешайте 70 мкг AAV-Rep / Cap плазмиды, 70 мкг пф rAAV9 плазмиды и 200 мкг Ad-плазмиды-хелпера в 50-мл центрифужную пробирку.
    2. Если клетки менее сливающиеся, регулировать количество ДНК пропорционально. Например, если клетки на 75% сплошности, уменьшитьколичество ДНК пропорционально (75/90 от суммы, указанной в пункте 2.4.1): смешать 70 х 75/90 = 58,3 мкг AAV-Rep / Cap плазмиды, 70 х 75/90 = 58,3 мкг rAAV9 плазмиды и 200 х 75/90 = 166,7 мкг Ad-Helper плазмиды в 50-мл центрифужную пробирку.
    3. Добавить 49 мл RT DMEM (без FBS) до 50-мл пробирку и хорошо перемешать.
    4. Добавить 1,360 мкл раствора ПЭИ, чтобы сделать PEI: соотношение ДНК (V / W) будет 4: 1. Хорошо перемешать. Инкубируйте при комнатной температуре в течение 15 - 30 мин.
    5. Добавить 5 мл смеси, приготовленной на этапе 2.4.4 к каждому 150-мм чашку (50 мл смеси в течение десяти 150-мм чашках).
  5. Культуры клеток в инкубаторе C 37 ° с 5 ± 0,5% СО 2 в течение 60-72 ч.

3. Урожай трансфицированных НЕК293 и очистки rAAV9 векторов

  1. Сбора клеток 60-72 ч после трансфекции. Выбить и приостановить клетки в посуде с помощью пипетки вверх и вниз с культуральной средой. Перенесите все клеточные суспензии в стерильную50 мл пробирки.
  2. Центрифуга клетки при 500 мкг в течение 5 мин. Ресуспендируют осадок клеток с 5 мл PBS в каждую пробирку и объединить все клеточные суспензии в одну 50 мл пробирку.
  3. Центрифуга клетки при 500 мкг в течение 5 мин. Удалите супернатант. На этом этапе, хранить осадок клеток при -80 ° С или сразу же очищают AAV из гранул, как описано в пунктах 3.4-3.15.
  4. Готовят лизирующий буфер: 150 мМ NaCl и 20 мМ Трис-HCl, рН 8,0. Фильтр стерилизуют (0,22 мкМ). Хранить буфер при температуре 4 ° С.
  5. Ресуспендируют осадок с помощью 10 мл буфера для лизиса.
  6. Замораживание лизат при -80 ° С или в бане сухой лед / этанол, затем оттаивание при 37 ° C. Vortex в течение 1 мин. Замораживании и оттаивании лизата 3 раза.
  7. Добавить раствор MgCl 2 к размороженной лизата (сделать конечной концентрации MgCl 2 в лизате быть 1 мМ). Добавьте нуклеазы до конечной концентрации 250 ед / мл. Инкубируют при 37 ° С в течение 15 мин для растворения ДНК / белок Aggregation.
    Примечание: Если агрегация ДНК / белок не растворяются после того, как нуклеазы или эндонуклеазы лечения, Даунса гомогенизируют лизатов 20 раз.
  8. Центрифуга образца при 4,800 мкг в течение 20 мин при температуре 4 ° С. Собирают супернатант.
  9. В то же время, подготовить градиент раствор иодиксанола:
    1. Готовят 17% раствора градиента путем смешивания 5 мл 10х PBS, 0,05 мл 1 М MgCl 2, 0,125 мл 1 М KCl, 10 мл 5 М NaCl и 12,5 мл ofdensity градиентной среды. Довести общий объем до 50 мл с помощью H 2 O.
    2. Готовят 25% раствор путем смешивания 5 мл 10х PBS, 0,05 мл 1 М MgCl 2, 0,125 мл 1 М KCl, 20 мл в градиенте плотности среды, и 0,2 мл 0,5% -ного (вес / об) феноловый красный. Довести общий объем до 50 мл с помощью H 2 O.
    3. Готовят 40% раствор путем смешивания 5 мл 10х PBS, 0,05 мл 1 М MgCl 2, 0,125 мл 1 М KCl, и 33,3 мл градиентного средней плотности. Отрегулировать общий объем до 50 мл, используяH 2 O.
    4. Готовят 60% раствора путем смешивания 0,05 мл 1 М MgCl 2, 0,125 мл 1 М KCl, 50 мл в градиенте плотности среды, и 0,1 мл 0,5% (вес / объем) Фенол красный.
  10. С помощью иглы и шприца, загрузите решение Иодиксанол градиента в полипропиленовую трубку в порядке 5 мл 17%, 5 мл 25% -ного, 5 мл 40% и 5 мл 60%, начиная с нижней части. Выгрузить все лизата, полученного на стадии 3,8 (14-16 мл) на верхней части градиента. Градиент, перечисленные снизу вверх, составляет 60%, 40%, 25%, 17%, и лизат слой. Заполните пробирку с буфером для лизиса и покрыть ее с пробкой.
  11. Центрифуга на 185000 мкг в течение 90 мин при 16 ° С.
  12. Урожай вирусной фракции (40% слой) с помощью шприца. Вставьте иглу (21 калибра) в пересечении между 40% и 60% фракций, только аспирационных 40% слой.
    ПРИМЕЧАНИЕ: Избегайте аспирационных какой-либо из 25% слоя.
  13. Смешайте вирусную фракцию стерилизованной полиоксиэтилен-polyoxyproблок-сополимер пропилена раствора PBS (10% полиоксиэтилен-полиоксипропилен блок-сополимер, запас 1: 10000 в PBS разводили) до общего объема 15 мл. Нагрузка смесь в фильтровальную трубку (отсечение ММ = 100 кДа). Центрифуга при 2000 х г в течение 30 мин при температуре 4 ° С.
  14. Отменить решение в нижней части. Пополняйте фильтровальную трубку с полиоксиэтилен-полиоксипропилен блок-сополимера раствором PBS до общего объема 15 мл. Центрифуга при 2000 х г в течение 20 мин при температуре 4 ° С. Повторите этот шаг еще два раза. Сбор очищенного вируса rAAV9 (доля над фильтром).
  15. Перенести очищенный rAAV9 в фильтрующей трубке, в 1,7 мл пробирки. Алиготе очищенный rAAV9 (100 - 400 мкл / пробирка, в зависимости от объема и титр AAV) и хранить вирус при -80 ° С.
    Примечание: Во избежание повторных ПРОТИВООБЛЕДЕНИТЕЛЬНОЕ оттепели.

4. Измерение титра rAAV9

  1. Подготовьте стандартные образцы ДНК.
    1. Разработать конкретные и эффективные ПЦРпраймеры для векторов rAAV9 и оптимизации состояния ПЦР.
      Примечание: Праймеры, использованные в данном исследовании, "Вперед: TCGGGATAAAAGCAGTCTGG; Реверс: TCGGACGGAGATACGTGAGT". Реакцию ПЦР проводили при следующих условиях: первоначальный денатурации при 95 ° С в течение 3 мин; 35 циклов при 95 ° С в течение 20 сек, 60 ° C в течение 15 сек и при 72 ° С в течение 10 сек; и окончательное удлинение при 72 ° С в течение 10 мин. Тем не менее, оптимизированные праймеры и условия ПЦР являются плазмида специфические, так как последовательность вставки в векторе rAAV9 может повлиять на специфичность и эффективность ПЦР 31.
    2. Проведение реакции ПЦР с использованием условий, показанных на этапе 4.1.1. Очищают продукт ПЦР с использованием набора для экстракции геля.
    3. Измерить концентрацию очищенной ДНК с помощью спектрофотометра. Вычислить концентрацию в молекулярных чисел ДНК на основе молекулярной массы / длины продукта ПЦР.
      1. Вычислить молекулярную концентрацию, используя следующее уравнение: молярные концентрации (ДНК - молекулы или фрагменты / мл) = 6,23 · 10 23 моль -1 х Con. х 10 -6 / МВт. Примечание: (6,23 х 10 23 моль -1 Число Авогадро в; концентрация Кон .: ДНК в мкг / мл; МВт .: молекулярная масса в г / моль). Например, если полученная концентрация ПЦР-продукта составляет 100 мкг / мл, а его длина составляет 200 п.н., молекулярная масса двухцепочечной ДНК составляет 2 х 200 х 310 = 124000 (средняя молекулярная масса каждого нуклеотида в одноцепочечной ДНК составляет около 310 г / моль). Концентрация молекул (молекул ДНК / мл) = 6,23 · 10 23 моль -1 х 100 мкг / мл х 10 -6 / 124000 г / моль = 5,18 х 10 14 молекул ДНК / мл.
      2. Выполнение серии разведений ДНК - фрагмента , и подготовить стандартные образцы, с концентрацией 10 13 молекул / мл, 10 12 молекул / мл, 10 11 молекул / мл, 10 10 молекул / мл, 10 9 молекул / мл, 10 7 молекул / мл. Используйте 1 мкл раствора для каждого стандартного образца для количественной ПЦР (КПЦР, на этапе 4.6).
  2. Смешайте 5 мкл очищенного раствора rAAV9 с 5 мкл 10 - кратного буфера ДНКазы 1 мкл ДНКазы (10000 ед / мл) и 39 мкл DDH 2 O. Общий объем должен быть 50 мкл.
  3. Инкубируйте флакон при 37 ° С в течение 30 мин для удаления остаточного неупакованных плазмидной ДНК.
  4. Деактивировать ДНКазы при 95 ° С в течение 10 мин. Охладите раствор, добавьте 44 мкл H 2 O, 5 мкл 10x ДНКазы буфера и 1 мкл протеиназы К (10 запаса мг / мл).
  5. Выдержите раствор при 50 ° С в течение 2 часов. Остановка реакции и инактивировать протеиназы К при 95 ° С в течение 10 мин.
  6. Используйте 1 мкл образца для количественной ПЦР (КПЦР) анализа. Вычислить титр.
    1. Запуск количественной ПЦР (КПЦР) с использованием праймеров, разработанных на этапе 4.1.1 с использованием образцов фршаг ом 4.1.4 (стандартные образцы) и от этапа 4.5 (образцы для измерения).
      1. Для каждой реакции, смешать 10 мкл 2x Зеленый мастер - смеси (содержащие Taq полимеразы, дНТФ смесь, буфер, MgCl 2, и зеленый краситель), 0,5 мкл прямого праймера (5 мкМ), 0,5 мкл обратного праймера (5 мкМ), 8 мкл H 2 O и 1 мкл образца для измерения. Выполните КПЦР со следующими условиями: держать образцы при температуре 50 ° С в течение 2 мин и 95 ° С в течение 10 мин; выполнить 40 циклов при 95 ° С в течение 15 сек и при 60 & deg; С в течение 1 мин; на стадии расплава, инкубировать образцов при 95 ° С в течение 30 сек и 60 & deg; С в течение 15 сек. Генерация стандартной кривой на основе чисел С Т стандартных образцов (рисунок 3).
    2. Расчет концентрации молекул / титр образца AAV против стандартной кривой. RAAV9 имеет однонитевой ДНК генома, так что молекулярная концентрация будет в 2 раза выше, чемРасчетное значение (мощность 2x (10, у), фигура 3В). Кроме того, титр очищенного rAAV9 будет в 20 раз выше, чем то, что получается из расчета за счет разбавлении 1:20 вируса в ДНКазная и протеиназы К реакциям (5 мкл в 100 мкл общего количества).

5. rAAV9 Инъекция в неонатальных мышах и экспрессии генов Assays в сердце

  1. Подготовка рабочих растворов rAAV9 в полиоксиэтиленполиоксипропиленовый блок-сополимера раствором PBS. Сделать вирус запас с титрами 1-7 × 10 12 частиц / мл.
    Примечание: Deliver 50-70 мкл раствора rAAV9 в каждый день после рождения 0,5-1,5 мыши путем подкожной инъекции. Для достижения эффективного сверхэкспрессии гена или нокдаун, рекомендуется выполнить пилотное тестирование для каждого исследования, чтобы оптимизировать количество впрыскиваемого AAV. Используйте одинаковое количество rAAV9.cTNT :: Люк или управления rAAV9.U6 :: скремблирования для каждого исследования, чтобы минимизировать смещение.
    ПРИМЕЧАНИЕ: Мы использовали 1-1.5х 10 11 частиц / щенком для избыточной экспрессии и 2,5 - 5 × 10 11 частиц / щенком для нокдауна в постнатальный день 0,5-1,5 мили Ce).
  2. Побалуйте новорожденных мышей с rAAV9 на P0.5-P2.5 путем подкожной инъекции.
    1. Предварительно заполнить 29G1 / 2, 0,33 х 12,7 мм инсулиновый шприц с раствором rAAV9. Будьте осторожны, чтобы удалить пузырьки воздуха.
    2. Держите крио-наркозом щенка в одной руке, с большим и указательным пальцами. Перед инъекцией, проведите кожу спины детеныша тампоном палочкой, насыщенной 70% изопропилового спирта для поддержания стерильных условиях. Вставьте иглу шприца в передне-дорсальный подкожного животного под углом от 5 до 10 °. Вводят 50-70 мкл раствора rAAV9, используя инсулиновый шприц.
      Примечание: rAAV9 также могут быть доставлены в мыши с помощью внутрибрюшинной или внутривенной инъекции 26,27. Обеспечивающем эффективную экспрессию доставленного генов в сердце могут быть получены. Тем не менее, внутрибрюшинного инъекционныеион иногда может привести к негерметичной экспрессии в печени. После инъекции, состояние крысят контролировали каждый день.
  3. Уровень экспрессии генов в сердце можно контролировать с кПЦР, иммунофлуоресценции или вестерн - блоттинга (представительные результаты показаны на рисунках 4 и 5) 25,26.
    ПРИМЕЧАНИЕ: Мыши были подвергнуты эвтаназии СО 2 доставлялось из источника сжатого газа. Образцы тканей были собраны после того, как подтверждение того, что частота сердечных сокращений, движение и дыхание животных прекратилось. Новорожденных грызуны устойчивы к CO 2 эвтаназии и подвергали эвтаназии путем декапитации с помощью острых ножниц. Метод согласуется с рекомендациями Группы по эвтаназии Американской ветеринарной медицинской ассоциации.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Стратегии для rAAV9 строительства rAAV9.cTNT :: GFP или rAAV9.U6 :: shRNA плазмид показаны на рисунках 1 и 2, соответственно. В качестве примеров, вектор rAAV9 был создан, чтобы избыточно экспрессировать ген GFP в сердце мыши. Полученная плазмида содержит cTNT :: GFP кассеты по бокам двумя ITR сайтов (Рисунок 1). Вектор rAAV9.U6 :: shRNA был построен в нокдаун мРНК TRBP (Рисунок 2)

Стандартная кривая для rAAV9 титрования был сгенерирован с данными КПЦР с помощью линейной регрессии. Управляющая переменная Y представляет собой значение log 10 ДНК молекулярной концентрации каждого стандартного образца, и соответствующая переменная х представляет значение С Т. Эти 10 значений (концентрации) Log (у) и числа С Т (х) демонстрируют хорошую линейную корреляцию (R 2 = 0,9971) и согласуется с уравнением у = -0.2832x + 14,616 (рис 3А). Рассчитывались Титры образцов rAAV9 основанный на линейном уравнении (фиг.3В). С помощью метода , описанного в протоколе (этап 4.6.2 и фигуре 3В), высокий титр векторов rAAV9 (50-200 мкл,> 6 х 10 13 частиц / мл) получали в представительном исследовании.

Для контроля эффективности и тканевой специфичности векторов rAAV9.cTNT, P0.5 крысят обрабатывают ту же сумму (1 × 10 11 частиц / крысят) из rAAV9.cTNT :: люциферазы (AAV-Luc) или rAAV9.cTNT :: GFP (ААВ-GFP), путем подкожной инъекции. Через две недели после инъекции, сигнал GFP контролировали в различных тканях мышей. Прочные экспрессия GFP была обнаружена в сердце, но не в других органах (рисунок 4, п> 3). Таким образом, эффективное и сердечно-специфическую экспрессию генов был достигнут с вектором rAAV9.cTNT.

jove_content "ВОК: Keep-together.within-странице =" 1 "> Для того, чтобы следить за нокдаун эффективности и тканевой специфичности векторов rAAV9.U6, P0.5 мышей обрабатывали таким же количеством (3 × 10 11 частиц / крысят) из rAAV9 .U6 :: Scramble (AAV-Scramble) или rAAV9.U6 :: TRBP shRNA (AAV-shTrbp) путем подкожной инъекции. Через две недели после инъекции, экспрессия TRBP в различных тканях контролировали с помощью КПЦР (рис 5, N = 3 ). уровень мРНК TRBP в сердце была существенно уменьшена на rAAV9.U6 :: shTrbp (68% понижающей, P = 0,0004452). Вниз регулирование TRBP был также обнаружен в ткани печени от rAAV9.U6 :: shTrbp лечение мышей. Однако изменение значительно ниже.

Рисунок 1
Рисунок 1: Стратегии Построить rAAV9.cTNT :: GFP плазмида. (А) Схема cTNT :: GFP кассеты. TNNT2 (rAAV9.cTNT) , а затем два уникальных сайтов рестрикции (NheI и KpnI). GFP, открытая рамка считывания, был клонирован в вектор rAAV9.cTNT с помощью сайта рестрикции-опосредованных лигированием для генерирования плазмиды rAAV9.cTNT :: GFP. (В) плазмиду rAAV9.cTNT :: GFP может быть построена по сборке Gibson. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2: Стратегии Построить rAAV9.U6 :: shRNA плазмид. (А) Схема U6 :: shRNA кассета показана. Выражение shRNA приводится в движение промотора U6 (синий). (B) rAAV9-U6-shRNA кассеты могут быть получены путем отжига и лигирования олигонуклеотидов ДНК содержатИНГ shRNA последовательности в энзим-перевариваются векторов рестрикции rAAV9, несущих промотор U6. (C) rAAV9.U6 :: shRNA кассеты могут быть сгенерированы на большие расстояния ПЦР и Gibson сборки на основе "бесшовной" строительство внутримолекулярной. 5 'рука, петля, и 3' рука shRNA показаны в зеленый, оранжевый, и красный, соответственно. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3: Расчет rAAV9 титра. (А) Стандартная кривая для rAAV9 титрования была сгенерирована с помощью линейной агрессии с использованием данных КПЦР. Управляющая переменная Y представляет собой значение log 10 ДНК концентрации молекул каждого стандартного образца, а также соответствующей переменной хпредставляет значение C T. (В) Титры образцов rAAV9 вычисляются на основе линейного уравнения стандартной кривой. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4: Характер экспрессии rAAV9.cTNT :: GFP у мышей ТКАНЕЙ. P0.5 крысят обрабатывали таким же количеством (1 х 10 11 частиц / крысят) от rAAV9.cTNT :: люциферазы (AAV-Luc, отрицательный контроль) или rAAV9.cTNT :: GFP (ААВ-GFP) , путем подкожной инъекции. Через две недели после инъекции, собирали образцы тканей. Экспрессия GFP контролировали под флуоресцентным объем рассечение. Оба светлого поля и флуоресцентные изображения представлены. Эксперименты были повторены более чем в 3 раза (п> 3).Шкала бар = 2,0 мм. SKM, скелетных мышц. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 5
Рисунок 5: Нокдаун экспрессии генов с AAV-shRNA. P0.5 мышей обрабатывали таким же количеством (3 × 10 11 частиц / крысят) от rAAV9.U6 :: Scramble (AAV-Scramble) или rAAV9.U6 :: TRBP shRNA (AAV-shTrbp) путем подкожной инъекции. Через две недели после инъекции, уровни мРНК TRBP в различных тканях контролировали с помощью кПЦР (п = 3). Данные представлены как среднее ± SEM. Значение отсечки Р 0,05. NS, P> 0,05, не имеет существенного значения. **, Р <0,01. SKM, скелетных мышц. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Важно, чтобы свести к минимуму нежелательную ITR рекомбинации во время плазмидной конструкции. Перед созданием вируса, всегда нужно следить за целостностью ITR из AAV плазмиды с помощью рестрикции переваривания и электрофореза в агарозном геле. Невозможно получить 100% интактного плазмид, но отношение рекомбинации должно быть сведено к минимуму, насколько это возможно. Менее 20% является приемлемым для успешной упаковки rAAV9. Следует отметить, что культивирования бактерий при более низкой температуре (30 ° C) с более низкой скоростью встряхивания (180-200 оборотов в минуту) может уменьшить вероятность ITR рекомбинации.

Крайне важно, чтобы гарантировать, что НЕК293 здоровы для успешной трансфекции и rAAV9 упаковки. "Здоровые" клетки, как правило, весьма пролиферативного и быстро растут. Тем не менее, быстрое распространение и рост клеток НЕК293 не обязательно гарантирует высокую эффективность rAAV9 упаковки. Таким образом, важно, чтобы начать эксперименты со свежими клетками. ЭтоРекомендуется использовать низкие проходы НЕК293 (<10 пассажей, клетки пассируют каждые 2-3 дня) для rAAV9 упаковки. Следует отметить, что другие серотипы Раав , возможно , должны быть очищены с использованием различных процедур 32.

Исследователь предоставляется гибкость при генерации rAAV9 плазмид. Либо сайт рестрикции опосредованную лигирование или сборка Gibson может быть использован 30. Для строительства rAAV9.U6 :: shRNA, внутрисетевой молекулярное Gibson сборки на основе стратегии является эффективным методом (1 и 2). Несколько плазмид AAV-shRNA или складочный AAV-shRNAs могут быть быстро построены. Для гиперэкспрессией генов с помощью rAAV9, существует ограничение на размер для встроенных последовательностей кДНК. Как правило, фрагмент размером между ITRs должен быть меньше , чем 5 кб 33. Интеин-катализируемой белок сплайсинг может быть использован , чтобы обойти ограничение на размер упаковки rAAV9 векторов 34.

Другие вирусные системыс, в том числе ретровирусов, лентивирусов и аденовирусов, также были разработаны и обеспечивают гибкую генных манипуляций. По сравнению с этими различными типами вирусных векторов, Раав имеет определенные преимущества: высокая эффективность, высокая специфичность, низкая скорость геномную интеграции, минимальные иммуногенность, и минимальный патогенность. Таким образом, Раав на основе генной инженерии становится как идеальный инструмент для естественных генных манипуляций в.

Предыдущие исследования показали , что система rAAV9 позволяет эффективно экспрессию генов доставленных в естественных условиях. С помощью промотора cTNT (курица TnnT2), экспрессия генов сердца конкретных был получен (рисунок 4) 25,26. Хотя промотор U6 является активным Повсеместно в тканях мышей, наиболее поразительным ингибирование мРНК - мишени (TRBP) по rAAV9.U6 :: shRNA наблюдалось в сердце, но не в других органах (рисунок 5). Печень является наиболее распространенным органом трансдуцированных путем различных серотиповРаав 35,36. Тем не менее, эффективность нокдаун (снижение уровня мРНК 36%) в печени значительно ниже, чем в сердце (снижение уровня мРНК 68%). Это согласуется с предыдущим исследованием , показывая , что, несмотря на более высокое присутствие вирусного генома в печени, системная доставка shRNA по rAAV9 обеспечивает более эффективный ген нокдаун в сердце 35. Вполне возможно, что гепатоциты более чем пролиферативный кардиомиоцитов и более активно проходит деление клеток после введения rAAV9 в неонатальном возрасте, что приводит к существенному вектор генома разбавлении в ткани печени. Тем не менее, это также предполагает, что серотип rAAV9 может более эффективно трансдукции кардиомиоцитов по сравнению с другими типами клеток. Как было показано Ловрич и др., В дифференцированных миоцитов, реакция повреждения ДНК MRN сложные белки подавляются. MRN сложные белки связывают AAV геномы и ингибируют AAV трансдукции через транскрипционного молчания. Таким образом, заmissivity к AAV трансдукции может быть индуцирована терминальной дифференцировки кардиомиоцитов 36, что делает систему rAAV9, по сравнению с другими вирусными векторами, очень подходит для манипулирования генов в сердце. Для дальнейшей минимизации нежелательных эффектов нокдаун в других органах (например, печень), можно также использовать сердечно-специфический промотор cTNT управляемый микроРНК-30а на основе shmiR подавлять гены , представляющие интерес в сердце 29. Эта рукопись дает читателю конкретных методов спекулируя на технологии rAAV9 в сердечно-сосудистых исследований.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics