Preparación de rAAV9 que sobreexpresan o una caída en los genes de ratón Corazones

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

El control de la expresión o actividad de genes específicos a través de la entrega de miocardio de los materiales genéticos en modelos murinos permite la investigación de las funciones de genes. Su potencial terapéutico en el corazón también se puede determinar. Hay enfoques limitados para la intervención molecular in vivo en el corazón del ratón. Virus adeno-asociado (rAAV) basada en la ingeniería del genoma recombinante se ha utilizado como una herramienta esencial para la manipulación genética cardiaca in vivo. Las ventajas específicas de esta tecnología incluyen una alta eficiencia, alta especificidad, porcentajes de integración genómica baja, mínimo inmunogenicidad y patogenicidad mínima. A continuación, se describe un procedimiento detallado para construir, empaquetar y purificar los vectores rAAV9. La inyección subcutánea de rAAV9 en cachorros neonatales como resultado la expresión robusta o knockdown eficaz del gen (s) de interés en el corazón de ratón, pero no en el hígado y otros tejidos. Uso de la cardiaca específiSe obtuvo c TNNT2 promotor, la alta expresión de gen GFP en el corazón. Además, ARNm objetivo se inhibió en el corazón cuando se utilizó un rAAV9-U6-shRNA. Trabajando conocimiento de la tecnología rAAV9 puede ser útil para investigaciones cardiovasculares.

Introduction

El control de la expresión o actividad de genes específicos en diversos sistemas biológicos se ha convertido en una estrategia valiosa en el estudio de la función del gen 1. Un medio directo de lograr este objetivo es manipular secuencias de nucleótidos y generar alelos mutantes. A pesar de hacer cambios precisos, dirigidas al genoma de las células vivas es todavía un tiempo y la práctica intensiva en trabajo, el desarrollo de las poderosas herramientas y TALEN CRISPR / Cas9 ha abierto una nueva era de la edición genoma 2-5. Un método de laboratorio más habitual para la manipulación genética se ha centrado en la introducción de material genético (ADN y ARN que contienen secuencias codificadoras o siRNAs / shRNAs) en las células para expresar el gen o desmontables (s) de interés 1,6.

En muchos casos, el principal cuello de botella para la manipulación genética es la entrega de ADN, ARN, o proteína en las células. Con respecto a los estudios in vitro, transfecti eficienteen los sistemas se han establecido en muchas líneas celulares cultivadas. Sin embargo, en el modelo de ratón, en particular, la entrega de genes in vivo en es más difícil. Hay una serie de barreras extra e intracelulares que necesitan ser pasado por alto con el fin de lograr la captación celular eficiente de los reactivos exógenos. Otros obstáculos incluyen la rápida eliminación y la corta duración del 7,8 entregado materiales. Una estrategia para evitar estos problemas es el uso de vectores virales como "portadores" o "vehículos" para la entrega de genes in vivo. Las propiedades de transducción evolucionado natural de los virus permiten la prestación eficiente de un gen de interés en células 7,9,10. Numerosos tipos de vectores virales se han desarrollado y permitir flexibilidad en la manipulación de genes in vivo en diferentes tipos de células y órganos en ratones.

Los sistemas virales más comúnmente usados ​​incluyen Retrovirus, Lentivirus, adenovirus y virus adeno-asociado (AAV) 12-14. Sin embargo, muchos tipos de retrovirus infectan solamente las células en división, y su eficacia en las células que no se dividen es muy baja 15. Esto limita su utilidad para la administración de genes. Lentivirus es un género de la familia Retroviridae. A diferencia de otros retrovirus, lentivirus puede infectar tanto a células que se dividen y que no se dividen y se ha utilizado ampliamente para la transferencia génica en post-mitótico y células diferenciadas altamente-16. El ciclo de vida de Lentivirus también implica la integración de ADN del vector en el genoma huésped. Por lo tanto el suministro de genes, Lentivirus mediada permite la expresión estable y de larga duración de los elementos genéticos transducidas 16-18. Sin embargo, esta función puede representar un doble-eespada DGED en el uso de estos virus para manipular la expresión génica, como la integración de ADN del vector puede dar lugar a la mutagénesis de inserción en las células huésped y puede causar efectos artefactual. Adenovirus es otro sistema de administración de genes ampliamente utilizado. A diferencia de los retrovirus y lentivirus, adenovirus son no integradas y no interfieren con la integridad genómica de las células huésped 8,10,11,19. Además, los adenovirus puede transfectar ADN en muchos tipos de células, y la infección no depende de la división celular activa 19. Otra característica importante de los adenovirus es la facilidad de purificación de vector, como los vectores virales tienen la capacidad de replicarse 19,20. Sin embargo, la principal advertencia de este sistema es que la infección por adenovirus puede desencadenar respuestas inmunes fuertes en las células diana y los órganos 19, restringiendo su uso en muchas investigaciones, en particular en los estudios de terapia génica.

En comparación con este tipo diferentes de vectores virales, virus asociado a adeno recombinante (rAAV) parece ser el sistema de suministro de genes ideales 21,22. Exhibe inmunogenicidad y patogenicidad 23,24 mínima. Además, rAAV infecta a una amplia gama de tipos de células, incluyendo tanto las células que no se dividen y divisoria. En la mayoría de los casos, rAAV no se integra en el genoma de acogida; por lo tanto, el riesgo de cambios genéticos o genómicos no deseados en las células diana es baja 22.

Recientemente, los sistemas de rAAV se han utilizado con éxito para la entrega in vivo de ADN que codifica proteínas, miRNAs, shRNAs, y CRISPR-gRNAs en ratón músculo cardíaco 23,25-29. Esta metodología ha facilitado las investigaciones fundamentales y los estudios de terapia génica en el campo de la investigación cardiovascular. Aquí, el procedimiento detallado para generar vectores rAAV9 que sobreexpresan de manera eficiente o desmontables los genes de interés en los corazones de ratón se ha descrito. El protocolo proporciona un método simple y eficaz dela manipulación de la expresión génica cardiaca en modelos experimentales murinos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los pasos descritos se realizaron bajo protocolos aprobados por el Comité de Bioseguridad y el Comité de Cuidado y Uso de Animales institucional del Hospital Infantil de Boston. Hospital Infantil de Boston tiene instalaciones libres de patógenos de ratón con regulados por la luz / oscuridad ciclos y climatizador. jaulas de cambio de personal veterinario y cuidado de los animales y garantizar la salud de los ratones. Las instalaciones están certificadas AAALAC y tienen certificación activa Animal Welfare Aseguramiento (AAALAC acreditación otorgada el 24/02/1992 Garantía de Bienestar Animal. Number: A3303-01). Los ratones fueron sacrificados por CO 2 emitido desde una fuente de gas comprimido. Las muestras de tejido fueron recogidos después de confirmar que la frecuencia cardíaca, el movimiento y la respiración de los animales habían cesado. Roedores neonatales son resistentes a CO 2 eutanasia y se sacrificaron por decapitación usando unas tijeras afiladas. Estos métodos son consistentes con las recomendaciones del Grupo sobre la eutanasia de la American Veterinary Medical Asociación.

1. Generación de constructos rAAV9 por clonación de un ADNc o shRNA cassette de expresión en el esqueleto del plásmido

NOTA: El plásmido rAAV9, que contiene las repeticiones terminales invertidas (RTI) de AAV2, que se utiliza para la sobreexpresión de genes se ha modificado para albergar el TNNT2 pollo promotor (rAAV9.cTNT), que permite la expresión de los cardiomiocitos-específico de genes transducidos 25,26,29. sitios únicos NheI y KpnI se han introducido en el plásmido, corriente abajo del promotor. Los fragmentos de ADNc que codifican los genes de interés se pueden clonar en la columna vertebral rAAV9 el uso de estos dos sitios de restricción 25,26,29. Aquí, como un ejemplo, se generó el vector rAAV9 para la sobreexpresión del gen de la GFP en los corazones de ratón. El plásmido resultante contiene el cTNT :: casete de GFP flanqueado por dos ITR sitios (Figura 1). construcciones rAAV9.U6 :: shRNA fueron utilizados para el gen desmontables 25. Diseño shRNAs usandolos servidores en línea de diseño shRNA. rAAV9.U6 :: shRNA se puede generar ya sea por hibridación y ligación de oligos que contienen secuencias de ADN shRNA en las enzimas de restricción digerido vectores rAAV9 que albergan el promotor U6, o por PCR de largo alcance e intra-molecular a base de montaje Gibson "sin costuras" construcción 30. El plásmido resultante debería contener el casete de U6-shRNA flanqueado por dos ITR sitios (Figura 2). Aquí, como un ejemplo, el vector de rAAV9.U6 :: shRNA se construyó para desmontables TRBP ARNm (secuencia TRBP shRNA: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). A scramble shRNA se utilizó como control negativo (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Clonar el casete de expresión de ADNc o shRNA en el plásmido columna vertebral rAAV9. Transformar el ADN en las células de E. coli competentes 25.
    NOTA: Use células de E. coli stbl2 o stbl3 para la transformación del ADN rAAV9 para minimizar la recombinación ITR no deseado.
  2. Recoge laclon positivo a partir de las células de E. coli transformadas. Amplificar el cultivo en 500 ml de medio de Lilly-Barnett y extraer el plásmido rAAV9 de las células bacterianas 25-30.
    NOTA: Midi / Maxi preparar el plásmido rAAV9 para obtener una alta cantidad de ADN (> 100 mg). Antes de generar el virus, siempre analizar la integridad de la secuencia de los plásmidos de VAA mediante digestión de restricción y electroforesis en gel de agarosa, como se describió previamente (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfección de células HEK293 con plásmidos rAAV9

  1. Preparar 1 mg / l de solución de polietilenimina lineal (PEI). Disuelva el polvo de PEI en DH libre de endotoxina de O 2 que se ha calentado a 70-80 ° C. Después de enfriar a RT, neutralizar la solución a pH 7,0 con HCl 1. Se esteriliza con filtro (0,22 micras) la solución. Alícuota de la / l PEI solución de 1 g (1,400 l / tubo) y almacenar el solutión a -20 ° C.
  2. células HEK293 Cultura en de Eagle modificado por Dulbecco (DMEM) con 10% de suero bovino fetal (FBS) y 1% de penicilina / estreptomicina. Cultivar las células en un incubador a 37ºC con dióxido de carbono 5 ± 0,5% (CO 2).
  3. En el día 0, la placa de células HEK293 en diez platos de 150 mm 18-20 h antes de la transfección mediante el fraccionamiento de> 90% de células confluentes en una dilución 1: 2.
    NOTA: En el día 1, las células deben alcanzar el 90% de confluencia.
  4. En el día 1, transfectar células HEK293 con el plásmido rAAV9 (por ejemplo, rAAV9.cTNT :: GFP o rAAV6.U6 :: shRNA construye), plásmido Ad-ayudante, y el plásmido AAV-Rep / Cap usando PEI 25,26,29.
    1. Para 10 platos de células en 90% de confluencia, mezclar 70 g de AAV-Rep plásmido / Cap, 70 g pf rAAV9 plásmido, y 200 g de Ad-Helper plásmido en un tubo de centrífuga de 50 ml.
    2. Si las células son menos confluentes, ajustar la cantidad de ADN proporcionalmente. Por ejemplo, si las células están en 75% confluentes, reducir ella cantidad de ADN de forma proporcional (75/90 de la cantidad que se muestra en el paso 2.4.1): mezclar 70 x 75/90 = 58,3 g de AAV-Rep plásmido / Cap, 70 x 75/90 = 58,3 g de plásmido rAAV9, y 200 x 75/90 = 166,7 g de Ad-Helper plásmido en un tubo de centrífuga de 50 ml.
    3. Añadir 49 ml de RT DMEM (sin FBS) al tubo de 50 ml y se mezcla bien.
    4. Añadir 1,360 l de solución de PEI para que el PEI: relación de ADN (v / w) sea de 4: 1. Mezclar bien. Incubar a TA durante 15 - 30 min.
    5. Añadir 5 ml de la mezcla preparada en la etapa 2.4.4 a cada placa de 150 mm (50 ml de la mezcla durante diez platos 150 mm).
  5. Cultivar las células en una incubadora a 37 ° con 5 ± 0,5% de CO2 durante 60 a 72 hr.

3. Cosecha de células HEK293 transfectadas y purificación de vectores rAAV9

  1. Recoger las células 60-72 horas después de la transfección. Desalojar y suspender las células en los platos pipeteando arriba y abajo con el medio de cultivo. Transferir todas las suspensiones celulares a estérilestubos de 50 ml.
  2. Centrifugar las células a 500 xg durante 5 min. Resuspender el sedimento celular con 5 ml de PBS en cada tubo y combinar todas las suspensiones de células en un tubo de 50 ml.
  3. Centrifugar las células a 500 xg durante 5 min. Descartar el sobrenadante. En este paso, almacenar el sedimento celular a -80 ° C o inmediatamente purificar el AAV a partir del sedimento, como se describe en los pasos 3.4-3.15.
  4. Preparar el tampón de lisis: NaCl 150 mM y Tris-HCl 20 mM, pH 8,0. Se esteriliza con filtro (0,22 M). Almacenar el tampón a 4 ° C.
  5. Resuspender el precipitado con 10 ml de tampón de lisis.
  6. Congelar el lisado a -80 ° C o en el baño de hielo seco / etanol, y luego descongelar a 37 ° C. Vortex durante 1 min. Congelar y descongelar el lisado 3 veces.
  7. Añadir solución de MgCl 2 al lisado descongelado (hacer la concentración final de MgCl 2 en el lisado ser 1 mM). Añadir la nucleasa a una concentración final de 250 U / ml. Incubar a 37 ° C durante 15 min para disolver el ADN aggr / proteínadele-.
    NOTA: Si la agregación de ADN / proteína no quede disuelto después de nucleasa o endonucleasa de tratamiento, Dounce homogeneizar los lisados ​​20 veces.
  8. Centrifugar la muestra a 4.800 xg durante 20 min a 4 ° C. Recoger el sobrenadante.
  9. Mientras tanto, preparar la solución de gradiente de iodixanol:
    1. Preparar el 17% de la solución de gradiente mediante la mezcla de 5 ml de 10x PBS, 0,05 ml de 1 M MgCl 2, 0,125 ml de 1 M de KCl, 10 ml de 5 M NaCl, y 12,5 ml ofdensity medio de gradiente. Ajustar el volumen total a 50 ml usando H 2 O.
    2. Preparar la solución de 25% mediante la mezcla de 5 ml de 10x PBS, 0,05 ml de 1 M MgCl 2, 0,125 ml de 1 M KCl, 20 ml de medio de gradiente de densidad, y 0,2 ml de 0,5% (w / v) de rojo de fenol. Ajustar el volumen total a 50 ml usando H 2 O.
    3. Preparar la solución de 40% mediante la mezcla de 5 ml de 10x PBS, 0,05 ml de 1 M MgCl 2, 0,125 ml de 1 M KCl, y 33,3 ml de medio de gradiente de densidad. Ajustar el volumen total a 50 ml usandoH2O
    4. Preparar la solución de 60% mediante la mezcla de 0,05 ml de 1 M MgCl 2, 0,125 ml de 1 M KCl, 50 ml de medio de gradiente de densidad, y 0,1 ml de 0,5% (w / v) de rojo fenol.
  10. Con una aguja y una jeringa, cargar la solución de gradiente de iodixanol en el tubo de polipropileno del orden de 5 ml de 17%, 5 ml de 25%, 5 ml de 40% y 5 ml de 60%, a partir de la parte inferior. Cargar todo el lisado obtenido de la etapa 3.8 (14-16 ml) en la parte superior de la pendiente. El gradiente, enumerados desde la parte inferior a la parte superior, es 60%, 40%, 25%, 17%, y la capa de lisado. Llenar el tubo con tampón de lisis y se cubre con el corcho.
  11. Se centrifuga a 185.000 xg durante 90 minutos a 16 ° C.
  12. Recoger la fracción viral (capa de 40%) con una jeringa. Insertar la aguja (calibre 21) en la intersección entre los 40% y 60% fracciones, solamente la aspiración de la capa de 40%.
    NOTA: Evitar la aspiración de la capa CUALQUIER 25%.
  13. Mezclar la fracción viral con esterilizada de polioxietileno-polyoxyprosolución de copolímero de bloques de propileno PBS (10% de polioxietileno-polioxipropileno de bloques de copolímero de stock 1: 10.000 diluida en PBS) hasta un volumen total de 15 ml. Cargar la mezcla en el tubo de filtro (corte de PM = 100 kD). Centrifugar a 2000 xg durante 30 min a 4 ° C.
  14. Descartar la solución en la parte inferior. Vuelva a llenar el tubo de filtro con una solución de PBS copolímero de bloque de polioxietileno-polioxipropileno con un volumen total de 15 ml. Centrifugar a 2000 xg durante 20 min a 4 ° C. Repita este paso dos veces más. Recoger el virus rAAV9 purificado (la fracción por encima del filtro).
  15. Transferir el rAAV9 purificado en el tubo de filtro para tubos de 1,7 ml. Alícuota de la rAAV9 purificado (100 a 400 l / tubo, dependiendo del volumen y el título del AAV) y almacenar el virus a -80 ° C.
    NOTA: Evitar repetidas congelaciones deshielos.

4. Medición del título de rAAV9

  1. Preparar las muestras de ADN estándar.
    1. Diseño PCR específica y eficientecebadores para los vectores de rAAV9 y optimizar la condición de PCR.
      NOTA: Los primers utilizados en este estudio son "Adelante: TCGGGATAAAAGCAGTCTGG; Reverso: TCGGACGGAGATACGTGAGT". La reacción de PCR se realizó con las siguientes condiciones: desnaturalización inicial a 95 ° C durante 3 min; 35 ciclos de 95 ° C para 20 segundos, 60 ° C durante 15 seg, y 72 ° C durante 10 seg; y la extensión final a 72 ° C durante 10 min. Sin embargo, los cebadores optimizados y las condiciones de PCR son plásmido específico, como la secuencia de inserción en el vector rAAV9 puede afectar a la especificidad y eficiencia de la PCR 31.
    2. Realizar la reacción de PCR con las condiciones que se muestran en el paso 4.1.1. Se purifica el producto de PCR con un kit de extracción de gel.
    3. Medir la concentración de ADN se purificó usando un espectrofotómetro. Calcular la concentración en número molecular de ADN basado en el peso / longitud molecular del producto de PCR.
      1. Calcular la concentración molecular utilizando la siguiente ecuación: moconcentración lecular (moléculas de ADN o fragmentos / ml) = 6,23 x 10 x 23 -1 moles Con. x 10 -6 / MW. Nota: (6,23 x 10 23 mol -1 es el número de Avogadro; concentración Con .: ADN en microgramos / ml; MW .: peso molecular en g / mol). Por ejemplo, si la concentración obtenida del producto de PCR es de 100 mg / ml y su longitud es 200 pb, el peso molecular del ADN de doble cadena es 2 x 200 x 310 = 124.000 (el peso molecular medio de cada nucleótido en la ADN de una sola cadena es de aproximadamente 310 g / mol). La concentración molecular (moléculas de ADN / ml) = 6,23 X 10 23 mol -1 x 100 mg / ml x 10 -6 / 124.000 g / mol = 5,18 x 10 14 moléculas de ADN / ml.
      2. Realizar una serie de diluciones del fragmento de ADN y preparar las muestras estándar, con concentraciones de 10 13 moléculas / ml, 10 12 moléculas / ml, 10 11 moléculas / ml, 10 10 moléculas / ml, 10 9 moléculas / ml, 10 7 moléculas / ml. Utilice 1 l de solución para cada muestra estándar para la PCR cuantitativa (qPCR, en el paso 4.6).
  2. Mezclar 5 l de solución de rAAV9 purificado con 5 l de 10x tampón de ADNasa, 1 l de ADNasa (10.000 U / ml), y 39 l de ddH 2 O. El volumen total debe ser de 50 l.
  3. Incubar el vial a 37 ° C durante 30 min para eliminar el ADN plasmídico sin embalar residual.
  4. Inactivar la DNasa a 95 ° C durante 10 min. Enfriar la solución, añadir 44 l de H2O, 5 l de 10x tampón de ADNasa, y 1 l de proteinasa K madre (10 mg / ml).
  5. Incubar la solución a 50 ° C durante 2 hr. Detener la reacción e inactivar la proteinasa K a 95 ° C durante 10 min.
  6. Utilice 1 l de la muestra para el ensayo de PCR cuantitativa (qPCR). Calcular el título.
    1. Ejecutar PCR cuantitativa (qPCR) con los cebadores diseñados en el paso 4.1.1 usando las muestras de frpaso om 4.1.4 (muestras estándar) y de la etapa 4.5 (muestras a medir).
      1. Para cada reacción, la mezcla 10 l de 2x mezcla maestra verde (que contiene la polimerasa Taq, mezcla de dNTP, tampón, MgCl2, y el tinte verde), 0,5 l de cebador directo (5 M), 0,5 l de cebador inverso (5 M), 8 l de H2O y 1 l de la muestra a medir. Realizar qPCR con las siguientes condiciones: mantener las muestras a 50 ° C durante 2 min y 95 ° C durante 10 min; realizar 40 ciclos a 95 ° C durante 15 s y a 60 ° C durante 1 min; para la etapa de fusión, se incuban las muestras a 95 ° C durante 30 seg y 60 ° C durante 15 s. Generar la curva estándar en base a los números de C T de las muestras patrón (Figura 3).
    2. Calcular la concentración molecular / título de la muestra de AAV en contra de la curva estándar. El rAAV9 tiene un genoma de ADN de cadena simple, por lo que la concentración molecular será 2 veces más alta que lavalor calculado (potencia 2x (10, y), la Figura 3B). Además, el título de la rAAV9 purificada será 20 veces más alta que la que se obtiene a partir del cálculo debido a la dilución 1:20 del virus en las reacciones de DNAsa y proteinasa K (5 l en 100 total de l).

5. rAAV9 inyección en ratones recién nacidos y los ensayos de expresión génica en el corazón

  1. Preparar soluciones de trabajo rAAV9 en solución de PBS copolímero de bloque de polioxietileno-polioxipropileno. Hacer la reserva de virus con los títulos de 1-7 x 10 12 partículas / ml.
    NOTA: Entregar 50-70 l de solución rAAV9 en cada día posnatal 0,5-1,5 ratón mediante inyección subcutánea. Para lograr la sobreexpresión génica eficaz o desmontables, se recomienda realizar una prueba piloto para cada estudio para optimizar la cantidad de AAV inyectado. Utilice la misma cantidad de rAAV9.cTNT :: Luc o controles rAAV9.U6 :: scramble para cada estudio para minimizar el sesgo.
    NOTA: Se utilizó 1-1,510 x 11 partículas / cachorro para la sobreexpresión ya 2,5 - 5 x 10 11 partículas / cachorro de caída en el día postnatal 0,5-1,5 millas ce).
  2. El tratamiento de ratones recién nacidos con rAAV9 en P0.5-P2.5 mediante inyección subcutánea.
    1. Pre-llenar un / 2, 0,33 x 12,7 mm jeringa de insulina 29G1 con la solución rAAV9. Tenga cuidado de eliminar las burbujas de aire.
    2. Mantenga el cachorro crio-anestesiados en una mano con el pulgar y el índice. Antes de la inyección, desliza la piel de la espalda de la cría con un palo hisopo saturado con alcohol isopropílico al 70% para mantener la condición estéril. Insertar la aguja de la jeringa en el tejido subcutáneo anterior-dorsal del animal en un ángulo de 5 a 10 °. Inyectar 50 a 70 l de la solución rAAV9 utilizando la jeringa de insulina.
      NOTA: rAAV9 también puede ser entregado a la ratón a través de inyección intraperitoneal o intravenosa 26,27. La expresión eficiente de los genes entregados en el corazón se puede obtener. Sin embargo, inyección intraperitonealion a veces puede resultar en la expresión de fugas en el hígado. Después de la inyección, la condición de los cachorros se controló cada día.
  3. El nivel de la expresión génica en el corazón se puede controlar con qPCR, inmunofluorescencia o inmunotransferencia de tipo Western (resultados representativos se muestran en las figuras 4 y 5) 25,26.
    NOTA: Los ratones fueron sacrificados por CO 2 emitido desde una fuente de gas comprimido. Las muestras de tejido fueron recogidos después de confirmar que la frecuencia cardíaca, el movimiento y la respiración de los animales habían cesado. Roedores neonatales son resistentes a CO 2 eutanasia y se sacrificaron por decapitación usando unas tijeras afiladas. El método es consistente con las recomendaciones del Grupo sobre la eutanasia de la American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Las estrategias para la construcción de plásmidos rAAV9 rAAV9.U6 :: shRNA rAAV9.cTNT :: GFP o se muestran en las figuras 1 y 2, respectivamente. Como muestran los ejemplos, el vector rAAV9 fue generado para sobreexpresar el gen de la GFP en los corazones de ratón. El plásmido resultante contiene el cTNT :: casete de GFP flanqueado por dos ITR sitios (Figura 1). El vector rAAV9.U6 :: shRNA se construyó para desmontables TRBP mRNA (Figura 2)

La curva estándar para rAAV9 titulación fue generado con los datos de qPCR por regresión lineal. La variable y manipulado representa el valor de Log 10 de la concentración molecular de ADN de cada muestra estándar, y la correspondiente variable x representa el valor C T. Los 10 valores log (concentración) (y) y números de C T (x) muestran una correlación lineal agradable (R 2 = 0.9971) y encajar con la ecuación y = -0.2832x + 14.616 (Figura 3A). Los títulos de las muestras rAAV9 se calcularon sobre la base de la ecuación lineal (Figura 3B). Con el método descrito en el protocolo (paso 4.6.2 y la Figura 3B), un título alto de vectores rAAV9 (50 a 200 l,> 6 x 10 13 partículas / ml) se obtuvo en el estudio representativo.

Para supervisar la eficiencia y la especificidad de tejido vectores rAAV9.cTNT, cachorros P0.5 se trataron con misma cantidad (1 x 10 11 partículas / PUP) de rAAV9.cTNT :: luciferasa (AAV-Luc) o rAAV9.cTNT :: GFP (AAV-GFP) por inyección subcutánea. Dos semanas después de la inyección, la señal de GFP se monitorizó en diversos tejidos de los ratones. Se detectó la expresión robusta de GFP en el corazón, pero no en otros órganos (Figura 4, n> 3). Por lo tanto, la expresión génica eficiente y específica del corazón se logró con el vector rAAV9.cTNT.

jove_content "fo: keep-together.within-page =" 1 "> Para controlar la eficacia desmontables y especificidad de tejido de vectores rAAV9.U6, los ratones fueron tratados con P0.5 misma cantidad (3 x 10 11 partículas / perrito) de rAAV9 .U6 :: Scramble (AAV-Scramble) o rAAV9.U6 :: TRBP shRNA (AAV-shTrbp) por inyección subcutánea. Dos semanas después de la inyección, la expresión de TRBP en diversos tejidos de se controló mediante qPCR (Figura 5, n = 3 ). el nivel de mRNA de TRBP en el corazón se redujo sustancialmente por rAAV9.U6 :: shTrbp (68% regulación a la baja, P = 0,0004452). la regulación por disminución de TRBP también se detectó en el tejido hepático de rAAV9.U6 :: shTrbp-tratada ratones. Sin embargo, el cambio es mucho más bajo.

Figura 1
Figura 1: Las estrategias para construir el plásmido rAAV9.cTNT :: GFP. (A) El esquema de la cTNT :: casete de GFP. (B TNNT2 pollo (rAAV9.cTNT) seguido de los dos sitios de restricción únicos (NheI y KpnI). El marco de lectura abierto GFP se clonó en el vector rAAV9.cTNT por la restricción de la ligadura de sitio mediada para generar el plásmido rAAV9.cTNT :: GFP. (B) El plásmido rAAV9.cTNT :: GFP puede ser construido por el conjunto de Gibson. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2: Las estrategias para construir el rAAV9.U6 :: shRNA plásmido. (A) El esquema de la U6 :: se muestra shRNA cassette. La expresión de shRNA es impulsado por el promotor U6 (azul). (B) cassettes rAAV9-U6-shRNA pueden ser generados por hibridación y ligadura oligos de ADN contienenING secuencias shRNA en las enzimas de restricción digerido vectores rAAV9 que albergan el promotor U6. (C) rAAV9.U6 :: cassettes shRNA pueden ser generados por PCR de largo alcance y basados en conjunto de construcción intra-molecular Gibson "sin costuras". El brazo 5 ', lazo, y 3' del brazo de shRNA se muestran en verde, naranja y rojo, respectivamente. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3: Cálculo de la rAAV9 Titulación. (A) La curva estándar para rAAV9 titulación fue generado por la agresión lineal utilizando los datos qPCR. La variable manipulada y representa el valor de Log 10 de la concentración molecular de ADN de cada muestra estándar, y la correspondiente variable xrepresenta el valor CT. (B) Los títulos de las muestras rAAV9 se calculan sobre la base de la ecuación lineal de la curva estándar. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4: Patrón de expresión de rAAV9.cTNT :: GFP en tejidos de ratones. Cachorros P0.5 se trataron con misma cantidad (1 x 10 11 partículas / PUP) de rAAV9.cTNT :: luciferasa (AAV-Luc, control negativo) o rAAV9.cTNT :: GFP (AAV-GFP) por inyección subcutánea. Dos semanas después de la inyección, se recogieron las muestras de tejido. La expresión de GFP se monitorizó en virtud de un alcance de disección fluorescente. Ambos se presentan imágenes de fluorescencia de campo y brillantes. Los experimentos se han repetido más de 3 veces (n> 3).Barra de escala = 2,0 mm. SKM, el músculo esquelético. Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5: Expresión Génica caída con AAV-shRNA. P0.5 los ratones fueron tratados con la misma cantidad (3 x 10 11 partículas / perrito) de rAAV9.U6 :: Scramble (AAV-Scramble) o rAAV9.U6 :: PTRL shRNA (AAV-shTrbp) mediante inyección subcutánea. Dos semanas después de la inyección, los niveles de mRNA de TRBP en varios tejidos se controlaron mediante qPCR (n = 3). Los datos se presentan como la media ± SEM. El valor de corte P es 0,05. NS, P> 0,05, no significativo. **, P <0,01. SKM, el músculo esquelético. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Es importante minimizar la recombinación ITR no deseado durante la construcción del plásmido. Antes de generar el virus, hay que vigilar siempre la integridad de los plásmidos ITR de AAV mediante digestión de restricción y electroforesis en gel de agarosa. Es imposible obtener 100% plásmidos intactos, pero la relación de recombinación debe minimizarse tanto como sea posible. Menos de 20% es aceptable para el envasado rAAV9 éxito. Es de destacar que el cultivo de las bacterias a menor temperatura (30 ° C) con una velocidad de agitación más baja (180-200 rpm) puede reducir la posibilidad de recombinación ITR.

Es esencial para asegurar que las células HEK293 son saludables para la transfección con éxito y envasado rAAV9. células "sanas" son por lo general altamente proliferativa y crecen rápidamente. Sin embargo, la proliferación y crecimiento de las células HEK293 rápido no garantiza necesariamente la alta eficiencia de los envases rAAV9. Por lo tanto, es importante para iniciar los experimentos con células frescas. Esose recomienda el uso de bajo pasaje células HEK293 (<10 pasajes, las células se pasaron cada 2-3 días) para el envasado rAAV9. Es de destacar que otros serotipos de rAAV pueden necesitar ser purificado utilizando diferentes procedimientos 32.

El investigador se otorga flexibilidad en la generación de plásmidos rAAV9. De cualquier ligadura mediada por el sitio de restricción o montaje Gibson se pueden utilizar 30. Para la construcción rAAV9.U6 :: shRNA, la estrategia basada en el montaje intra-molecular Gibson es un método efectivo (Figuras 1 y 2). Múltiples plásmidos VAA-shRNA o pool de AAV-shRNAs se pueden construir rápidamente. Para sobreexpresar genes utilizando rAAV9, existe una limitación de tamaño para las secuencias de ADNc insertadas. En general, el fragmento de tamaño entre ITRs tiene que ser menor que 5 kb 33. Catalizada intein-empalme de proteínas puede utilizarse para eludir el límite de tamaño de los envases de vectores rAAV9 34.

Otro sistema virals, incluyendo retrovirus, lentivirus y adenovirus, también se han desarrollado y permitir la manipulación de genes flexible. Comparado con los diferentes tipos de vectores virales, rAAV tiene ventajas específicas: alta eficiencia, alta especificidad, porcentajes de integración genómica baja, mínimo inmunogenicidad y patogenicidad mínima. Por lo tanto, la ingeniería basada en el genoma de rAAV se está convirtiendo en una herramienta ideal para la manipulación de genes in vivo.

Estudios anteriores han demostrado que el sistema rAAV9 permite la expresión eficiente de genes entregados en vivo. Con el promotor cTNT (TNNT2 pollo), la expresión génica específica del corazón se obtuvo (Figura 4) 25,26. Aunque el promotor U6 es ubicua activo en tejidos de ratón, una inhibición más llamativa de ARNm diana (TRBP) por rAAV9.U6 :: shRNA se observó en el corazón, pero no en otros órganos (Figura 5). El hígado es el órgano más común transducidas por diferentes serotipos derAAV 35,36. Sin embargo, la eficiencia de la precipitación (reducción de 36% del nivel de mRNA) en el hígado es mucho menor que en el corazón (reducción de 68% del nivel de mRNA). Esto es consistente con el estudio anterior que demuestra que, a pesar de mayor presencia del genoma viral en el hígado, la administración sistémica de shRNA por rAAV9 ofrece gen más eficiente desmontables en el corazón 35. Es posible que los hepatocitos son más proliferativa de los cardiomiocitos y están experimentando más activamente la división celular después de la administración rAAV9 en las edades neonatales, lo que resulta en dilución sustancial genoma del vector en el tejido hepático. Sin embargo, esto también sugiere que el serotipo de rAAV9 puede transducir de manera más eficiente los cardiomiocitos en comparación con otros tipos de células. Como se ha demostrado por Lovric et al., En los miocitos diferenciados, la respuesta al daño del ADN proteínas del complejo MRN son reprimidos. proteínas complejas MRN unen genomas de AAV e inhiben la transducción de AAV a través de silenciamiento transcripcional. Por lo tanto, pormissivity para la transducción de AAV puede ser inducida por la diferenciación terminal de los cardiomiocitos 36, haciendo que el sistema rAAV9, en comparación con otros vectores virales, muy adecuado para la manipulación genética en el corazón. Para minimizar aún más los efectos no deseados de derribo en otros órganos (por ejemplo, el hígado), también se puede utilizar cardíaca específica shmiR a base de miR-30a promotor impulsado cTNT para reprimir los genes de interés en el corazón 29. Este manuscrito ofrece al lector con las técnicas específicas para capitalizar en la tecnología rAAV9 en las investigaciones cardiovasculares.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics