باستخدام البيولوجيا الاصطناعية إلى المهندس الخلايا الحية تتفاعل مع المواد القابلة للبرمجة

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

تعرض هذه الورقة مجموعة من بروتوكولات لتطوير الخلايا المهندسة والسطوح functionalized التي تمكن المهندسة صناعي كولاي للسيطرة والتعامل مع أسطح المواد القابلة للبرمجة.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

لقد قمنا بتطوير واجهة غير الحيوية للالأحيائية التي تمكن خلايا هندسيا للسيطرة على خصائص المواد من سطح functionalized. ويتكون هذا النظام من خلال إنشاء وحدتين: سلالة هندسيا صناعيا من E. خلايا القولونية واجهة المواد functionalized. ضمن هذه الورقة، ونحن بالتفصيل بروتوكول للهندسة وراثيا السلوكيات المختارة ضمن سلالة كولاي باستخدام استراتيجيات الاستنساخ الجزيئي. وحالما يتم وضع هذه السلالة تنتج مستويات مرتفعة من البيوتين عند التعرض لمحفز كيميائي. بالإضافة إلى ذلك، فإننا بروتوكولات التفاصيل لخلق سطحين functionalized مختلفة، كل منها قادرة على الرد على البيوتين توليفها الخلية. معا، ونحن تقديم منهجية لخلق صلة، نظام اللاأحيائي للالأحيائية التي تسمح خلايا للسيطرة على تركيب المواد والتجمع على ركائز غير الحية هندسيا.

Introduction

هنا، ونحن التقرير الإجراءات لتطوير ركيزة للبرمجة قادرة على الاستجابة لإشارة كيميائية من خط خلية هندسيا. 1 ونحن نفعل ذلك من خلال خلق واجهة البيوتين streptavidin أن يستجيب لالبيوتين التي تنتجها المهندسة صناعي القولونية (إي كولاي) الخلايا. سابقا، وقد تم تصميم الأسطح القابلة للبرمجة لمجموعة واسعة من التطبيقات من الكشف عن السموم 2 ونقطة من الرعاية التشخيص 3 في الدفاع والأمن. 4 بينما الأسطح القابلة للبرمجة يمكن أن تكون مفيدة كما أجهزة الاستشعار والمحركات، فإنها يمكن أن تكون "أكثر ذكاء" من وهب لهم القدرة على التكيف مع التحديات البيئية المختلفة. في المقابل، حتى الكائنات الدقيقة بسيطة، مثل كولاي، لديها القدرة على التكيف الكامنة وقادرة على الاستجابة للتحديات مع حلول متطورة وغالبا غير متوقعة. وقد مكن هذا التكيف E.السكان القولونية، التي تسيطر عليها شبكات الجينات المعقدة، وإلى فعالية من حيث التكلفة البحث عن موارد، 5 خلق منتجات ذات قيمة مضافة، 6 وحتى السلطة الروبوتات الصغيرة الحجم. 7 بواسطة اقتران مزايا التكيف من الخلايا الحية مع استخدام الأسطح القابلة للبرمجة، ونحن يمكن أن تخلق ركيزة الذكية قادرة على الاستجابة للظروف البيئية المختلفة.

وقد أعطى البيولوجيا الاصطناعية الباحثين قدرات جديدة لبرمجة سلوك الكائنات الحية. عن طريق الهندسة خلايا لاحتواء شبكات تنظيمية الجين الجديد، يمكن للباحثين تصميم الخلايا التي تظهر مجموعة من السلوكيات المبرمجة. 9 أبعد من البحوث الأساسية، ويمكن استخدام هذه السلوكيات لتطبيقات مثل السيطرة على تجميع المواد وإنتاج بيولوجيا المنتجات ذات القيمة المضافة. 10 وهنا، ونحن بالتفصيل كيف استخدمنا أدوات البيولوجيا الاصطناعية أونgineer على القولونية E. سلالة تؤلف البيوتين على الاستقراء. وقد تم تطوير هذه السلالة باستخدام أساليب انزيم التقييد استنساخ لتجميع البلازميد، pKE1-اسي-bioB. هذا البلازميد، عندما تتحول إلى E. القولونية سلالة K-12 MG1655، يمنح الخلايا مع القدرة على التعبير عن مستويات مرتفعة من bioB، وهو إنزيم أساسي لتخليق البيوتين. عندما الناجم عن الخلايا تحولت مع الآيزوبروبيل β-D-1-thiogalactopyranoside (IPTG)، وقدمت مع مقدمة البيوتين، desthiobiotin (DTB)، أنتجت مستويات مرتفعة من البيوتين.

التفاعل البيوتين هي ملزمة مع streptavidin هي واحدة من أقوى الروابط غير التساهمية الموجودة في الطبيعة. على هذا النحو، والتفاعل البيوتين streptavidin على حد سواء، تتميز بشكل جيد وتوظيف للغاية في مجال التكنولوجيا الحيوية. 11 وفي هذه المخطوطة، نقدم استراتيجيتين توظيف التفاعل البيوتين streptavidin على الإحساس وكشف البيوتين تنتج الخلية مع سطح functionalized. نحنالرجوع إلى هذه السطوح المتناقضة كما خطط "غير المباشرة" و "مباشرة" السيطرة. في مخطط السيطرة غير المباشرة، والبيوتين المنتجة خلية تتنافس مع البيوتين الذي تم مترافق وثبتوا على سطح البوليسترين لstreptavidin مواقع الربط. بالإضافة إلى ذلك، مترافق في streptavidin مع البيروكسيديز الفجل (HRP). برنامج الصحة الإنجابية يعدل 3، 3، 5، 5'-tetramethylbenzidine (TMB)، لإنتاج إشارة ضوئية (12) الذي قد يخضع للمراقبة عن طريق قياس الامتصاصية الطيفية (أي الكثافة البصرية) في 450 نانومتر (OD 450). وهكذا، فإن مخطط السيطرة غير المباشرة يسمح للباحثين لقياس البيوتين تنتج الخلية من خلال رصد attentuation للإشارة OD 450.

مخطط السيطرة المباشرة يستغل الحدث streptavidin البيوتين عن طريق شل حركة streptavidin مباشرة إلى سطح المادة والسماح البيوتين تنتج الخلية وHRP المعقدة البيروكسيديز للتنافس على streptavidin مواقع الربط. مرة أخرى،ويتم رصد المستويات النسبية للالبيوتين تنتج الخلايا عن طريق قياس إشارة OD 450.

معا، والخلايا المهندسة والسطوح functionalized تتيح لنا التحكم في خصائص سطح برمجة عن طريق حفز الشبكات في الخلايا الحية. وبعبارة أخرى، لقد أنشأنا نظاما يستفيد من القدرة على التكيف للكائنات الحية وموثوقية ومواصفات واجهة المواد الهندسية من خلال ربط هذه الأنظمة معا.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. وسائل الإعلام وإعداد الثقافة

  1. إعداد استذابة مرق (LB) وسائل الاعلام عن طريق خلط 25 غراما من مسحوق الأوراق المالية LB مع 1 لتر من الماء (DI) منزوع الأيونات والتعقيم الحل في درجة حرارة 121 مئوية لمدة 20 دقيقة لتعقيم.
    1. لإعداد لوحات LB، إضافة 15 غراما أجار (1.5٪) إلى وسائل الإعلام LB قبل التعقيم
    2. إعداد الحلول الأسهم من 1،000x كربنيسيلين (البنك التجاري) في المياه DI (50 ملغ / مل).
    3. لو كان يستعد LB وسائل الإعلام يتضمن المضادات الحيوية لاختيار transformants المقاوم، والانتظار حتى درجة حرارة LB سائل الإعلام تعقيمها هي أقل من 60 درجة مئوية، ثم قم بإضافة 1 ميكرولتر من الأسهم للمضادات الحيوية لكل 1 مل من LB وسائل الإعلام.
  2. لM9 الحد الأدنى من وسائل الإعلام (الجدول 1)، وإعداد الحلول الأسهم منفصلة مما يلي: أملاح 5X M9 (56.4 غرام / لتر)، 1 م MgSO 1 م CaCl 2 و 20٪ جلوكوز، و 2٪ الأحماض casamino خالية من البيوتين.
    1. في زجاجة آمنة الأوتوكلاف، والجمع بين 20 مل من 5X M9 الأملاح، 200 &# 181؛ L من 1M MgSO 10 ميكرولتر من 1 M CaCl 2 مل من 20٪ جلوكوز، 1 مل من 2٪ الأحماض casamino خالية من البيوتين، و76،8 مل من الماء DI.
    2. الأوتوكلاف الحل أعد في الخطوة 1.2.1 على درجة حرارة 121 مئوية لمدة 20 دقيقة.
  3. احتضان جميع الثقافات عند 37 درجة مئوية مع الإثارة في 400 دورة في الدقيقة. حضانة مرات تختلف باختلاف التجربة والتوتر، ولكن عادة ما تستغرق 8-12 ساعة.

2. جيل من البيوتين إنتاج كولاي (البلازميد pKE1-اسي-bioB)

ملاحظة: الدائرة الوراثية يحتوي على جزأين: كاظمة اسي، يقودها P L، تيتو-1 المروج مما أدى إلى التعبير التأسيسية نظرا لعدم وجود بروتين كاظمة tetR، فضلا عن نظام التعبير البيوتين التي تحتوي على P TRC-2 المروج تليها موقع ملزمة الريبوسوم قوي (RBS) تعبيرا عن bioB القيادة. أعدم كل الاستنساخ في التجاري، وتقسيم بسرعة كولاي سترافي. وتحول التركيبة النهائية في كولاي MG1655WT للاختبار. تم شراؤها الاشعال (الجدول 2) تجاريا.

  1. عزل bioB الجينات من كولاي الجينوم عن طريق أداء خلية كاملة تفاعل البلمرة المتسلسل (PCR):
    1. تنمو الخلايا كولاي MG 1655WT بين عشية وضحاها في 37 درجة مئوية.
    2. في 0.2 مل أنبوب PCR، والجمع بين 1 ميكرولتر من الثقافة بين عشية وضحاها أعد في الخطوة 2.1.1 مع 9 ميكرولتر من المياه DI العقيمة.
    3. احتضان الأنبوب في درجة حرارة 95 درجة مئوية لمدة 5 دقائق في thermocycler ونقل على الفور الأنبوب إلى -80 درجة مئوية الثلاجة لمدة 10 دقيقة لليز الخلايا. وهذا يتيح الحمض النووي الجيني لتكون بمثابة قالب PCR.
    4. ذوبان الجليد في حل وإضافة (ط) 2.5 ميكرولتر كل من الاشعال nBioB2-F1 وnBioB2-ص، (ب) 5 ميكرولتر من العازلة البلمرة 5X الحمض النووي، (ج) 0.25 ميكرولتر من البلمرة DNA، (د) 0.5 ميكرولتر من مزيج dNTP ، و (ت) 6.75 ميكرولتر من الماء DI لحجم رد الفعل الكلي لل25 ميكرولتر(جدول 4).
    5. ضرب جانب (أي نفض الغبار) أنبوب لخلط محتوياتها. التالي، وتدور على الفور إلى أسفل الأنبوب بسرعة (~ 2 ثانية) لضمان العينة في الجزء السفلي من الأنبوب.
    6. وضع أنبوب في thermocycler PCR واستخدام البرنامج هو موضح في الجدول رقم 3 مع خطوة إضافية من 3 دقائق عند 95 درجة مئوية في بداية البروتوكول.
    7. تأكيد نجاح PCR باستخدام الكهربائي للهلام (1،0-1،2٪ الاغاروز في DI الماء + إيثيديوم بروميد) في قاعدة تريس، حمض الخليك، وعازلة EDTA (تاي). يجب أن يكون المنتج PCR 1070 basepairs (بي بي) لفترة طويلة.
    8. استخدام مجموعات تجارية وفقا لتعليمات الشركة الصانعة لاستخراج شظايا من الحمض النووي من الجل من الخطوة 2.1.7.
  2. عزل P TRC-2 المروج والاوبرون اسي من البلازميد pKDL071 13 (من باب المجاملة مختبر جيمس كولينز في معهد ماساتشوستس للتكنولوجيا):
    1. تنمو الخلايا E. القولونية التي تحتوي علىالبلازميد pKDL071 بين عشية وضحاها في LB + البنك التجاري عند 37 درجة مئوية.
    2. استخراج DNA البلازميد من الخلايا باستخدام عدة miniprep التجارية وفقا لتعليمات الشركة الصانعة. والبلازميد بمثابة قالب PCR.
    3. متابعة بروتوكول PCR من الخطوات 2.1.4. إلى 2.1.8. مع إجراء التعديلات التالية:
    4. استبدال الخلايا هي lysed مع استخراج البلازميد في الخطوة 2.2.2.
    5. استخدام 2.5 ميكرولتر كل من الاشعال 1-F و 1 ص لاستخراج كاسيت اسي. بدلا من ذلك، استخدام 2.5 ميكرولتر كل من الاشعال nBioB1-F وnBioB1-R لP TRC-2 الاستخراج.
    6. أداء الكهربائي للهلام (الخطوة 2.1.7) لتأكيد المنتجات PCR هي كاسيت اسي وP موقع المروج TRC-2. ينبغي أن تكون 1213 سنة مضت و 109 نقطة أساس طويل، على التوالي.
  3. استخدام الربط عن طريق تمديد العارضة (الشركات المملوكة للدولة) PCR لبناء كاسيت bioB تحتوي P TRC-2، وهو موقع الريبوسوم الاصطناعية ملزمة (RBS) في التمهيدي nBioB2-F2، وbioB الجدول 3.
  4. إدراج بنيات (P L، تيتو-1 + اسي وP TRC-2 + bioB) في pKE1-MCS ناقلات البلازميد 13 العمود الفقري (مجاملة للمختبر جيمس كولينز في معهد ماساتشوستس للتكنولوجيا) من خلال هضم ناقلات وتضاف مع الإنزيمات تقييد:
    1. استخراج الجينات باستخدام أنزيمات التقييد والكهربائي للهلام. يحتوي كل رد فعل (ط) 5 ميكرولتر من 10X العازلة رد فعل، (ب) 1 ميكرولتر من تقييد انزيم 1، (ج) 1 ميكرولتر من تقييد انزيم 2، (د) لا يقل عن 1 ميكروغرام من الحمض النووي، و (ت) الماء DI ل جلب الحجم النهائي إلى 50 ميكرولتر (الجدول 5). الهضم مع الانزيمات AatII وEcoRI للكاسيت اسي ومع الانزيمات HindIII وSacII للكاسيت bioB.
    2. بعد أن يتم تجميعها ردود الفعل، دوامة عليها بسرعة وأجهزة الطرد المركزي لفترة وجيزة (~ 2 ثانية) قبل الحضانة لمدة 1 ساعة عند 37 درجة مئوية.
    3. أثناءالهضم، وإعداد المواد الهلامية لالكهربائي وفقا لبروتوكولات موحدة.
    4. الجمع بين الحمض النووي يتفاعل مع هلام الكهربائي العازلة تحميل 6X.
    5. استخدام سلم 2-سجل للتحقق من موقع بناء المطلوب، وقطع جزء من الحمض النووي للهلام، واستخدام مجموعات استخراج الهلام التجارية وفقا لتعليمات الشركة الصانعة لاستخراج شظايا من الحمض النووي من هلام.
  5. قياس الحمض النووي باستخدام التحليل الطيفي وحساب كميات ل0: 1، 1: 1، و 3: 1 نسب الرحى من إدراج لالمتجه باستخدام المعادلة 1:
    المعادلة 1 المعادلة 1
    في المعادلة 1، M هي نسبة إدراج لناقلات (0 أو 1 أو 3)، X ط هو كمية إدراج الحمض النووي، بي بي i هو طول من إدراج في قاعدة أزواج، بي بي الخامس هو طول الموجه في basepairs، وX v هي كمية متجهة (50 نانوغرام).
  6. مزيج رد فعل الربط عن طريق الجمع بين (ط) 1 ميكرولتر 10X يغاز العازلة، (ب)1 ميكرولتر T4 يغاز، (ج) 50 نانوغرام ناقلات الحمض النووي، (د) كتلة من إدراج DNA محددة لكل رد فعل، و (ت) الماء DI إلى 10 ميكرولتر إجمالي حجم رد الفعل (الجدول 6).
  7. يحضن في درجة حرارة الغرفة (RT) لمدة 1 ساعة.
  8. أثناء الحضانة ربط في الخطوة 2.7، وإعداد الخلايا المختصة كيميائيا.
    1. قسامة 1 مل من الثقافات بين عشية وضحاها إلى 1.5 مل أنابيب الطرد المركزي.
    2. أجهزة الطرد المركزي في 16200 x ج لمدة 1 دقيقة.
    3. صب طاف و resuspend بيليه في 200 ميكرولتر من برود (على الجليد) 100 ملي CaCl 2. Resuspend وبيليه بواسطة pipetting بلطف. لا الدوامة.
    4. وضع أنبوب microcentrifuge على الجليد لمدة 10 دقيقة.
    5. أجهزة الطرد المركزي، وإزالة طاف، resuspend الكرية في 100 ميليلتر من المبرد 100 ملي CaCl ووضع أنبوب على الجليد مرة أخرى.
    6. أجهزة الطرد المركزي أنبوب مرة أخيرة و resuspend بيليه في 50 ميكرولتر من المبرد 100 ملي CaCl 2.
    7. مكانأنبوب على الجليد واستخدام الخلايا المختصة كيميائيا على الفور.
  9. إضافة 5 ميكرولتر من الحمض النووي ligated، أعد الخطوات 2.6 و 2.7، على كل أنبوب من الخلايا المختصة، التي أعدت في الخطوة 2.8.
  10. تستنهض الهمم الأنبوب لفترة وجيزة خلال ضرب الجانب (أي عبها) الأنابيب ومن ثم وضع أنابيب على الجليد لمدة 30 دقيقة.
  11. الحرارة صدمة الأنابيب لمدة 45 ق على 42 درجة مئوية، وتعود الأنابيب إلى الجليد لمدة 2 دقيقة.
  12. خلايا ماصة على انتقائية LB أجار + لوحات المضادات الحيوية وتنتشر الخلايا باستخدام الخرز الزجاجي الطلاء.
  13. احتضان لوحات ليلا 37 درجة مئوية.
  14. في صباح اليوم التالي، واختيار المستعمرات من لوحات-إدراج إيجابي (أي 1: 1 و 1: 3 لوحات). اختيار 3 مستعمرات إذا كان 0: 1 السلبية لوحة التحكم تظهر أي نمو، أو اختيار 5-8 المستعمرات إذا كان 0: لوحة 1 لديه بعض النمو. استخدام المستعمرات التقطت لتطعيم 5 مل LB + المضادات الحيوية وتنمو لمدة 8 ساعات عند 37 درجة مئوية مع الإثارة.
  15. استخراج DNA البلازميد من الخلايا باستخدام miniprطقم الجيش الشعبي، باتباع إرشادات الشركة المصنعة. إجراء خفض اختبار باستخدام أنزيمات التقييد (باتباع نفس الإجراء الموضح في الخطوة 2.4.1).
  16. تحديد الخلايا مع ثوابت ناجحة من خلال مقارنة طول شظايا الحمض النووي يتفاعل مع النتائج المتوقعة من بناء الصحيح. الثقافات تحمل يبني البلازميد ناجحة يمكن الحفاظ عليها عن طريق خلط الثقافة أجزاء متساوية بمحلول معقم تصفيتها، و 40٪ الجلسرين (في الماء DI) وتجميد الخليط في -80 درجة مئوية.
    ملاحظة: التحولات من البلازميدات إلى سلالات كولاي أخرى (أي MG1655WT) ويمكن تحقيق ذلك عن طريق اتباع الإجراءات المذكورة أعلاه لصنع خلايا المختصة كيميائيا.

3. خلية توصيف: منحنى النمو والاستجابة للجرعة

  1. تنمو سلالات هندسيا بين عشية وضحاها في وسائل الإعلام LB مع المضادات الحيوية المناسبة.
  2. لمنحنيات النمو، وإعداد 50 مل من وسائل الاعلام M9 مع الحد الأدنى من ودون IPTG (من 0.5 م قتوك) و / أو DTB (من 500 ميكروغرام الأسهم / مل) على النحو التالي:
    1. إعداد 0 نانوغرام / مل DTB (0 ميكرولتر من الأسهم) / 0 ملي IPTG (0 ميكرولتر من الأسهم).
    2. إعداد 200 نانوغرام / مل DTB (200 ميكرولتر من الأسهم) / 0 ملي IPTG (0 ميكرولتر من الأسهم).
    3. إعداد 0 نانوغرام / مل DTB (0 ميكرولتر من الأسهم) / 0.5 ملي IPTG (50 ميكرولتر من الأسهم).
    4. إعداد 200 نانوغرام / مل DTB (200 ميكرولتر من الأسهم) / 0.5 ملي IPTG (50 ميكرولتر من الأسهم).
    5. تطعيم مع الثقافة بين عشية وضحاها في 1: 100 في وسائل الإعلام المحدد أعلاه.
    6. في لوحة 96-جيدا، قسامة 200 ميكرولتر من الثقافة، في ثلاث نسخ، إلى كل بئر.
    7. قياس OD 600 كل 5 دقائق على مدى 24 ساعة مع الهز المستمر والحضانة عند 37 درجة مئوية في قارئ لوحة.
  3. للدراسات الاستجابة للجرعة، استبدال الجينات bioB في pKE1-اسي-bioB مع mCherry (بروتين أحمر فلوري) في الوقت الحقيقي الكمي البصرية.
  4. إضافة كميات من IPTG تتراوح من 0.1 مم إلى 5 مم للحث على التعبير متفاوتةفي وسائل الإعلام LB.
  5. تطعيم مع الثقافة بين عشية وضحاها في التخفيف من 1: 100.
  6. قياس مضان كل 30 دقيقة لمدة 15 ساعة.

4. تحريض البيوتين الإنتاج من الخلايا المهندسة وإعداد طاف

  1. تنمو pKE1-اسي-bioB في سلالة كولاي MG1655 بين عشية وضحاها في وسائل الإعلام LB.
  2. تكملة وسائل الإعلام M9 مع DTB تتراوح 30-200 نانوغرام / مل.
  3. إضافة 0.5 ملي IPTG للحث على التوليف البيوتين.
  4. تطعيم تستكمل، خالية من البيوتين وسائل الإعلام M9 الحد الأدنى مع الثقافة بين عشية وضحاها في 1: 100 التخفيف.
  5. بعد 24 ساعة من النمو، وخلايا الطرد المركزي وجمع طاف التخصيب البيوتين.
  6. قياس طاف التخصيب البيوتين مع السيطرة غير المباشرة والسيطرة المباشرة السطوح functionalized. استخدام طاف في مكان العينة البيوتين في الخطوات 5.23 و 6.12 على التوالي.

5. غير المباشر تحكم مخطط Functionalized تحضير السطح

  1. إعداد عشرالبريد التالي الحلول.
    1. إعداد الحل جنة التنسيق تتكون من 20 ملغ / مل من succinimidyl العابر-4- (maleimidylmethyl) الهكسان الحلقي-1-الكربوكسيل (SMCC) في سلفوكسيد ثنائي ميثيل ([دمس]).
    2. يعد حل SPDP تتكون من 20 ملغ / مل من succinimidyl 3- (2-pyridyldithio) بروبيونات (SPDP) في DMSO.
    3. إعداد 20 ملغ / مل LC-LC-البيوتين في DMSO.
    4. إعداد 10 ملغ / مل الفجل البيروكسيديز (HRP) في الفوسفات مخزنة المالحة (PBS).
    5. إعداد 10 ملغ / مل streptavidin (SA) في برنامج تلفزيوني.
    6. إعداد 10 ملغ / مل زلال المصل البقري (BSA) في برنامج تلفزيوني.
    7. إعداد 100 ملي dithiothreitol (DTT) في المياه DI.
    8. إعداد 5 ملم حمض ethylenediaminetetaacetic (EDTA) في برنامج تلفزيوني.
    9. تحضير 0.5٪ الكازين في برنامج تلفزيوني.
    10. إعداد 20٪ توين 80 الأسهم في المياه DI.
    11. إعداد 0.05٪ توين 80 (من 20٪ الأوراق المالية) في برنامج تلفزيوني.
    12. تجهيز 50 ملم من خلات الصوديوم في المياه DI.
    13. إعداد 1٪ تمب في DMSO.
    14. إعداد 3٪ H 2 O 2 طن DI المياه.
    15. إعداد 2 MH 2 SO 4 في الماء DI.
  2. إضافة 1.4 ميكرولتر من محلول SPDP إلى 20 ميكرولتر SA حل.
  3. احتضان حل من 5.2 مقابل 1.5 ساعة عند RT، ملفوفة في رقائق الألومنيوم لتجنب التعرض للضوء. هذه الخطوة تسمح للcrosslinker SPDP إلى السندات لSA عبر مجموعة الأمينية تشكيل تنشيط pyridyldithio SA.
  4. إضافة 2.4 ميكرولتر من محلول ال دي دي تي في حل من الخطوة 5.3 واحتضان لمدة 1 ساعة على RT. وهذا يسمح لالبيريدين 2-thione الانقسام، مما أدى إلى تنشيط سلفهيدريل SA.
  5. إضافة 7.5 ميكرولتر حل SMCC إلى 72 حل ميكرولتر برنامج الصحة الإنجابية واحتضان لمدة 1.5 ساعة عند RT، ملفوفة في رقائق الألومنيوم لتجنب التعرض للضوء. هذه النتائج في برنامج الصحة الإنجابية تنشيط maleimide ملزمة على مجموعة أمينية.
  6. مزيج حل 17 ميكرولتر LC-LC-البيوتين مع 200 ميكرولتر حل جيش صرب البوسنة واحتضان لمدة 1.5 ساعة عند RT، ملفوفة في رقائق الألومنيوم لتجنب التعرض للضوء. هذه الخطوة تسمح البيوتين إلى المترافقة رس BSA عن طريق السندات أميد.
  7. نقل الحلول من الخطوات 5.4 و 5.5 و 5.6 لفصل مركزات الطرد المركزي داخل أنابيب زيادة ونقصان.
  8. لأنابيب تحتوي SA-SPDP، من الخطوة 5.4، الطرد المركزي في 10000 x ج حتى حجم أنبوب يصل إلى 100 ميليلتر أو لمدة 16 دقيقة. ملء أنبوب تدور إلى 500 ميكرولتر مع PBS-EDTA.
    1. كرر الخطوة 5.8 خمس مرات. تخزين المخزون في 4 درجات مئوية.
  9. لأنابيب تحتوي HRP-SMCC، من الخطوة 5.5، الطرد المركزي في 10000 x ج حتى يصل إلى حجم 25 ميكرولتر أو لمدة 16 دقيقة. ملء أنبوب تدور إلى 500 ميكرولتر مع برنامج تلفزيوني.
    1. كرر الخطوة 5.9 خمس مرات. تخزين المخزون في 4 درجات مئوية.
  10. لأنابيب تحتوي BSA-البيوتين، من الخطوة 5.6، الطرد المركزي في 10000 x ج حتى يصل حجم 100 ميليلتر أو لمدة 12 دقيقة. ملء أنبوب تدور إلى 500 ميكرولتر مع برنامج تلفزيوني.
    1. كرر الخطوة 5.10 أربع مرات.
    2. أجهزة الطرد المركزي في 10000 x ج حتى يصل حجم 100 ميكرولترأو لمدة 12 دقيقة. إضافة 100 ميكرولتر من برنامج تلفزيوني للأنبوب. تخزين المخزون في 4 درجات مئوية.
  11. إضافة 25 ميكرولتر من 10 ملغ / مل حل HRP مع 25 ميكرولتر من 10 ملغ / مل SA الحل وتخزينها في 4 درجات مئوية خلال الليل. يؤدي هذا SA لتصبح مترافق مع HRP عن طريق السندات أثير ثيولي.
    1. إعداد 1: حل العاملة 4 مع الحل بين عشية وضحاها وتخزينها في 4 درجات مئوية الثلاجة. حل المتبقية مخزن في -20 درجة مئوية.
  12. إعداد حلين تتكون من BSA-البيوتين (أو BSA) في برنامج تلفزيوني، وذلك بإضافة 10 ميكرولتر من الأسهم BSA-البيوتين (أو 10 ميكرولتر الأسهم BSA) إلى 490 ميكرولتر من برنامج تلفزيوني.
  13. إضافة 100 ميكرولتر من محلول من الخطوة 5.12 إلى كل بئر من لوحة البوليسترين 96-جيدا.
  14. احتضان لوحة عند 37 درجة مئوية لمدة 1 ساعة، ملفوفة في احباط.
  15. غسل الآبار لوحة مع 0.05٪ توين 80.
    1. إضافة 200 ميكرولتر من 0.05٪ في برنامج تلفزيوني-توين 80 إلى الآبار. احتضان لمدة 2 دقيقة في RT. صب السائل.
    2. <لى> كرر الخطوة 5.15.1 ثلاث مرات.
  16. إضافة 200 ميكرولتر من محلول الكازين 0.5٪ إلى كل من الآبار في لوحة 96-جيدا.
  17. احتضان لوحة عند 37 درجة مئوية لمدة 1 ساعة.
  18. كرر الخطوة 5.15 لغسل الآبار ثلاث مرات.
  19. يعد حل عن طريق خلط 12 مل من 0.5٪ حل الكازين مع 7.5 ميكرولتر من 0.05٪ توين 80.
  20. تمييع الأسهم SA-HRP 1: 10،000 باستخدام الحل أعد في الخطوة 5.19.
  21. إضافة 80 ميكرولتر من الحل أعد في الخطوة 5.20 إلى كل بئر من لوحة 96-جيدا.
  22. إضافة 20 ميكرولتر من العينة البيوتين مستعدة لكل بئر من لوحة البوليسترين. طاف أعد في 4.6 ويمكن استخدام العينة البيوتين في هذه الخطوة.
  23. احتضان لوحة عند 37 درجة مئوية لمدة 1 ساعة. هذه الخطوة تسمح للربط المنافسة بين البيوتين حرة وشل BSA-البيوتين لمواقع الربط SA-HRP.
  24. كرر الخطوة 5.15 لغسل الآبار ثلاث مرات.
  25. مزيج 50 ملي حل خلات الصوديوم، 1٪ محلول TMB،و 3٪ H 2 O 2 حل في 1000: 1 نسبة (20 مل الحجم الكلي): 10.
  26. إضافة 200 ميكرولتر من محلول من الخطوة 5.25 إلى كل بئر والسماح للجلوس لمدة 15 دقيقة في RT، مع تغطية احباط.
  27. إضافة 50 ميكرولتر من 2 MH 2 SO 4 إلى كل بئر لوقف التفاعل. قياس OD 450 باستخدام قارئ لوحة.

6. التحكم المباشر مخطط Functionalized تحضير السطح

  1. إعداد الحلول التالية.
    1. إعداد 20 ملغ / مل LC-LC-البيوتين في DMSO.
    2. إعداد 10 ملغ / مل برنامج الصحة الإنجابية في برنامج تلفزيوني.
    3. إعداد 0.17 ميكروغرام / مل SA في برنامج تلفزيوني.
    4. تحضير 0.5٪ الكازين في برنامج تلفزيوني.
    5. إعداد 20٪ توين 80 الأسهم في المياه DI.
    6. إعداد 0.05٪ توين 80 (من 20٪ الأوراق المالية) في برنامج تلفزيوني.
    7. تجهيز 50 ملم من خلات الصوديوم في المياه DI.
    8. إعداد 1٪ تمب في DMSO.
    9. إعداد 3٪ H 2 O 2 في المياه DI.
    10. إعداد 2 MH 2 SO 4 DI.
  2. إضافة 7.5 ميكرولتر LC-LC-البيوتين إلى 72 ميكرولتر برنامج الصحة الإنجابية ويحضن في مقابل 1.5 ساعة عند RT، ملفوفة في رقائق الألومنيوم لتجنب التعرض للضوء. تؤدي هذه الخطوة إلى البيوتين المترافقة لبرنامج الصحة الإنجابية عن طريق السندات أميد.
  3. نقل الحل من الخطوة 6.2 إلى المكثف الطرد المركزي في أنبوب تدور
    1. أجهزة الطرد المركزي الحل في 10000 x ج حتى يصل حجم 100 ميليلتر أو لمدة 12 دقيقة. ملء أنبوب تدور إلى 500 ميكرولتر مع برنامج تلفزيوني وتكرار الطرد المركزي وبرنامج تلفزيوني إضافة أربع مرات. تخزين المخزون في 4 درجات مئوية.
  4. إضافة 100 ميكرولتر من محلول SA من 6.1.3 إلى كل بئر في لوحة البوليسترين 96-جيدا.
  5. احتضان لوحة عند 37 درجة مئوية لمدة 1 ساعة، ملفوفة في احباط.
  6. غسل الآبار لوحة مع 0.05٪ توين 80.
    1. إضافة 200 ميكرولتر من 0.05٪ توين 80 إلى الآبار. احتضان لمدة 2 دقيقة في RT. صب السائل.
    2. كرر 6.6.1 ثلاث مرات.
  7. إضافة 200 ميكرولتر من محلول الكازين 0.5٪ إلى كل من الآبار في لوحة 96-جيدا.
  8. احتضان لوحة عند 37 درجة مئوية لمدة 1 ساعة.
  9. كرر الخطوة 6.6 ثلاث مرات لغسل الآبار.
  10. تمييع البيوتين HRP الأوراق المالية 1: 10،000 باستخدام الحل أعد في الخطوة 6.3.
  11. إضافة 80 ميكرولتر من الحل أعد في الخطوة 6.10 إلى كل بئر من لوحة 96-جيدا.
  12. إضافة 20 ميكرولتر من العينة البيوتين مستعدة لكل بئر من لوحة البوليسترين. طاف أعد في 4.6 ويمكن استخدام العينة البيوتين في هذه الخطوة.
  13. احتضان لوحة عند 37 درجة مئوية لمدة 1 ساعة. هذه الخطوة تسمح للربط المنافسة بين البيوتين حرة والبيوتين برنامج الصحة الإنجابية للمواقع الربط SA يجمد.
  14. كرر الخطوة 6.6 لغسل الآبار ثلاث مرات.
  15. مزيج 50 ملي حل خلات الصوديوم، 1٪ محلول TMB، و 3٪ H 2 O 2 حل في 1000: 1 نسبة (20 مل الحجم الكلي): 10.
  16. إضافة 200 ميكرولتر من محلول من الخطوة 6.15 على كل بئر واحتضان لمدة 15 دقيقة في RT، مع تغطية احباط.
  17. إضافة 50 ميكرولتر من 2 MH 2 SO 4 حل كل بئر لوقف التفاعل. قياس OD 450 باستخدام قارئ لوحة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

يتم عرض نتائج ممثلة في الأرقام الخمسة المرفقة. أولا، نقدم عملية الاستنساخ بيانيا (الشكل 1) بحيث يمكن للقارئ أن يتبع بصريا الخطوات الحاسمة لخلق E. القولونية سلالة هندسيا صناعيا. من أجل وصف ديناميات السكان من الخلايا، ونحن نقدم منحنى النمو (الشكل 2) التي تم إنشاؤها عن طريق قياس الكثافة البصرية في 600 نانومتر (OD 600) من السكان. ثم، وتبين لنا كيف يتم التحقق من شبكة الجينات التنظيمية، وذلك باستخدام mCherry كوكيل لbioB (الشكل 3)، مما يسمح لنا لقياس بصريا على مبلغ قريب من bioB التي سيتم إنتاجها من قبل الخلية على الاستقراء مع IPTG. المقبل، ونحن تقديم البيانات استجابة للالسيطرة غير المباشرة والسيطرة المباشرة السطوح functionalized. وقد وضعت هذه المؤامرات البيانات (الشكل 4) من خلال استخدام حلول قياس الحرالبيوتين لتوصيف ملامح استجابة السطوح functionalized. وأخيرا، فإننا نقدم بيانات مميزة تبين كيفية الناجم عن الخلايا هندستها لإنتاج البيوتين (الشكل 5)، وبالتالي تعديل أسطح functionalized.

شكل 1
الشكل 1: تصميم وبناء محرض، خلايا المهندسة. تم تصميم (A) الاشعال لعزل الجين bioB من الجينوم كولاي، الذي يشفر انزيم مهم في مسار تخليق البيوتين. (ب) P L، تيتو-1 -lacI وP TRC-2 تسلسل يمكن عزلها عن البلازميد التي تحتوي على مفتاح التبديل الجيني مع الاشعال المقابلة. ويمكن بعد ذلك (C) الجين bioB استخراج وشظايا اثنين من التبديل تبديل يمكن استخدامها لإنشاء حلبة الجينات. إضافة IPTG يمكن IND ثمفوسي التعبير عن bioB والتوليف وبالتالي البيوتين عند إضافة DTB باعتبارها الركيزة لbioB. (D) تحولت البلازميد تجميعها في K-12 MG1655 كولاي. وادى ذلك الى وجود IPTG للحث على التعبير عن bioB والتوليف وبالتالي البيوتين عن طريق خط الخلية المهندسة عندما قدمت DTB باعتبارها الركيزة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: منحنيات النمو للخلايا المهندسة. كانت تزرع، محرض البرية من نوع الخلايا MG1655 هندسيا ورصدها في وسائل الإعلام الحد الأدنى (أي خالية من البيوتين M9 وسائل الإعلام)، وكذلك الحد الأدنى من وسائل الإعلام تستكمل مع DTB (200 نانوغرام / مل) و / أو IPTG (0.5 ملم). وتظهر قطع القراءة OD 600، ويقاس كل 5 ميل ن لمدة 24 ساعة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الرقم 3: اختبار شبكة الجينات المهندسة. تم استخدام بروتين فلوري mCherry في مكان bioB الجينات حتى نتمكن من قياس بصريا الشخصية الحث عندما الناجم عن خلايا هندسيا مع IPTG. ونحن على النقيض من الخلايا المستحثة مع IPTG (الماس الحمراء) مع الخلايا لا يسببها مع IPTG (الماس الأزرق). هذه النتائج تثبت فعالية شبكة الجينات محرض. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

/55300/55300fig4.jpg "/>
الشكل 4: التحقق من واجهة المواد Functionalized. من خلال تعريض لدينا سطح functionalized لتركيزات من البيوتين متفاوتة، ونحن قادرون على قياس استجابة البصرية من خلال قياس OD 450 الامتصاصية. تسمح هذه النتائج لنا لتوليد منحنى المعايرة، وربط تركيز البيوتين لشدة البصرية للاستجابة. هنا، نقدم البيوتين مقابل منحنيات إشارة ضوئية لكل من المخططات سطح غير مباشرة (يسار) ومباشرة (يمين) functionalized. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الرقم 5
الرقم 5: المهندسة خلايا مراقبة واجهة المواد. من خلال الاستفادة من أقسام بروتوكول 5 أو 6، ونحن قادرون على استخدام منتجات التي يسببها، ج هندسياملتعلمي اللغة اإلنكليزية لتعديل كيميائيا سطح functionalized. يمكننا رصد هذه الردود بصريا عن طريق قياس OD 450. وعلاوة على ذلك، باستخدام منحنى المعايرة وضعت في الشكل (4)، ونحن يمكن أن تصل كثافة ضوئية من الرد على البيوتين في التركيز. نقدم هنا تركيزات مختلفة البيوتين، ويقاس سيطرتنا مخطط functionalized سطح غير مباشر، لالبرية من نوع الخلايا (أبيض)، وخلايا uninduced التي تحتوي على البلازميد pKE1-اسي-bioB (برتقالي)، والخلايا التي يسببها تحتوي على pKE1-اسي-bioB البلازميد (الرمادي). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

المواد الكيميائية تركيز النهائي كمية
أملاح 5X M9 1X 20 مل
1 م MgSO 4 2 مم 200 ميكرولتر
1 M CaCl 2 0.1 ملم 10 ميكرولتر
20٪ نسبة الجلوكوز 0.40٪ 2 مل
2٪ حمض خالية من البيوتين Casamino 0.02٪ 1 مل
DI المياه N / A 76.8 مل

الجدول 1: M9 وسائل الإعلام وصفة.

اسم تسلسل التمهيدي استعمال
1-و CCGCCGGAATTCTCCCTATCAGTGATAGAGATT اسي استخراج كاسيت
1-ص CCGACGTCTCACTGCCCGCTTTCCAGTC اسي استخراج كاسيت
nBioB1-F CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P TRC-2 استخراج
nBioB1-ص GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P TRC-2 استخراج
nBioB2-F1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG استخراج bioB
nBioB2-ص TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC استخراج bioB
nBioB2-F2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC الاصطناعية بالإضافة RBS

الجدول 2: قائمة الاشعال.

> الخطوة 1
الخطوة 2 الخطوه 3 خطوة 4 خطوة 5 خطوة 6 خطوة 7 الخطوة 8 خطوة 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / كيلو بايت 00:10 00:30 01: 00 / كيلو بايت 02:00
كرر 12 مرة كرر 25 مرة
-1 ° C / دورة

er.within الصفحات = "1"> الجدول 3: برنامج PCR.

اسم الصوت
خلية المحللة (قالب) 10 ميكرولتر
التمهيدي (كل) 0.625 ميكرولتر (كل)
عازلة Q5 5X 5 ميكرولتر
Q5 البلمرة 0.25 ميكرولتر
dNTP ميكس 0.5 ميكرولتر
DI المياه 6.75 ميكرولتر

الجدول 4: كامل الخلية PCR رد الفعل (25 ميكرولتر).

اسم الصوت
10 عازلة رد الفعل العاشر 5 ميكرولتر
انزيم 1 1 ميكرولتر
انزيم 2 1 ميكرولتر
قالب الحمض النووي 1 ميكروغرام
DI المياه 43 ميكرولتر - حجم الحمض النووي

الجدول 5: تقييد انزيم الهضم رد الفعل (50 ميكرولتر).

اسم الصوت
الحمض النووي 50 ميكروغرام ناقلات + X ميكروغرام إدراج
10X يغاز العازلة 1 ميكرولتر
T4 يغاز 1 ميكرولتر
DI المياه 8 ميكرولتر - حجم الحمض النووي

الآثار البيئية-together.within الصفحات = "1"> الجدول 6: رد فعل من ربط (10 ميكرولتر).

اسم تركيز ملاحظات
CaCl 2 100 ملي
Carbeniccilin 50 ملغ / مل (1000X)
DTB 50 ميكروغرام / مل
IPTG 0.5 M
SMCC 20 ملغ / مل 2 ملغ في 100uL DMSO
SPDP 20 ملغ / مل 2 ملغ في 100uL DMSO
LC-LC-البيوتين 20 ملغ / مل 2 ملغ في 100uL DMSO
برنامج الصحة الإنجابية 10 ملغ / مل في برنامج تلفزيوني
SA (غير مباشر) 10 ملغ / مل في برنامج تلفزيوني
SA (مباشر) 0.17 ميكروغرام / مل في برنامج تلفزيوني
BSA 20 ملغ / مل في برنامج تلفزيوني
DTT 100MM في DI المياه
EDTA 5 ملم 18.6 ملغ في 10 مل برنامج تلفزيوني
الكازين 0.50٪ في برنامج تلفزيوني
توين 80 20٪ في DI المياه
توين 80 في برنامج تلفزيوني 0.05٪
أسيتات الصوديوم 50 ملي في DI المياه، وضبط درجة الحموضة إلى 5.1 باستخدام 3 M حمض الهيدروكلوريك
تمب في DMSO
H 2 O 2 في DI المياه
H 2 SO 4 2 M في DI المياه

الصفحة = "1"> الجدول 7: قائمة الكاشف حلول.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

لقد قدمنا ​​استراتيجية جديدة للتفاعل الخلايا المهندسة الذين يعيشون مع سطح المواد functionalized. وقد تحقق ذلك من خلال تطوير خط الخلية قادرة على تجميع مستويات مرتفعة من البيوتين عندما الناجم مع IPTG. ومن ثم يمكن استخدام مستويات مرتفعة من البيوتين لتعديل سطح functionalized. فصلت البروتوكولات كيف مهندس خط الخلية القولونية E. وكيفية إنشاء سطحين functionalized مختلفة.

تحدث خطوات حاسمة في هذا البروتوكول في جميع أنحاء بناء خط خلية هندسيا. لتجنب المشاكل المصب، واصفا سلالات خلية هندسيا مع كل من منحنيات النمو (الشكل 2) واستجابة فلوري (الشكل 3) تشجيع. يجب أن تنشأ المسائل الإجرائية، استراتيجيات أخرى الاستنساخ الجزيئي، مثل استخراج PCR والتجمع جيبسون 14، قد تكون بديلا عن الخطوات حسب مقتضى الحال. لتحقيق الاستفادة المثلى من yie البيوتيندينار من خط الخلية هندسيا، من الأهمية بمكان لضمان توفير كمية كافية من DTB إلى الخلايا. في دراستنا، وجدنا أن 200 نانوغرام / مل DTB أثارت زيادة كبيرة وذات دلالة إحصائية في إنتاج البيوتين عندما يسببها الخلايا مع IPTG. بالإضافة إلى ذلك، الاقتران الناجح لBSA-البيوتين، SA-برنامج الصحة الإنجابية، والبيوتين، HRP أمر بالغ الأهمية لأداء ورصد مخططات السيطرة المباشرة وغير المباشرة على نحو فعال. الحرص على تجنب التعرض غير الضروري للضوء، والسماح للتقارن لاحتضان بين عشية وضحاها في 4 درجات مئوية لضمان يتم تشكيل المترافقة فعال.

يوفر بروتوكول لدينا المزايا على طرق بديلة 15 نظرا لقدرتها على اكتشاف كميات صغيرة من البيوتين التي هي ذات الصلة بيولوجيا (ص / مل الحجم الكبير) بالمقارنة مع مجموعات كشف البيوتين المتاحة تجاريا، مثل تلك التي تقوم على حمض 4'-hydroxyazobenzene-2-متيل الاستراتيجيات التنافسية ملزمة. على الرغم من أن استخدام streptavidin الحيويةنظام القصدير هو شائع في مجال التكنولوجيا الحيوية 16، 17، قدرة نظامنا على الاستجابة لكميات صغيرة من البيوتين تسمح لنا لربط مباشرة لدينا خط خلية المعدلة وراثيا مع سطح functionalized.

واحد الحد المحتمل لبروتوكول لدينا هو مجموعة ديناميكية مما أدى الكشف البيوتين. في مخططات السيطرة المباشرة وغير المباشرة، ونحن قادرون على كشف البيوتين بين 10 -10 2 3 4 و 10 -10 6 غ / مل على التوالي (الشكل 4). لحسن الحظ، ومجموعة منخفضة من مخطط السيطرة غير المباشرة يسمح لنا للكشف بسهولة إنتاج البيوتين من خلايا هندسيا. ومع ذلك، فإن نطاق ضيق من سيطرة مجموعة ديناميكية غير مباشرة يحد من قدرتها على الإحساس التغييرات الكبيرة (100 أضعاف) في تركيزات البيوتين. أن تغيير النطاق الديناميكي لكلا مخططات السيطرة المباشرة وغير المباشرة تتطلب الهندسة إضافية. ومع ذلك، إذا الكشف عن خلية تنتجد البيوتين هي قضية، وإعداد التخفيفات من طاف البيوتين في الخطوة 4.6 يجب أن تسمح للباحث لاستهداف مجموعة ديناميكية من مخطط السيطرة غير المباشرة (الشكل 5). وجدنا أن التخفيف 1: 5 من طاف سمح لنا لاستهداف مجموعة ديناميكية من مخطط السيطرة غير المباشرة على نحو فعال. وينبغي لهذه الاستراتيجية تخفيف تخفيف الحاجة إلى تعديل النطاق الديناميكي مباشرة.

في جزئين، ونظام الخلايا المواد المقدمة هنا يسمح هندسة الخلايا لتعديل تركيبة سطح functionalized. دينامية، الخلايا الحية يمكن تفسير محيط الكيميائية لإنتاج رد فعل الوراثية. عن طريق الهندسة الوراثية هذه الاستجابة لزيادة إنتاج البيوتين، يمكننا تزويد الخلايا الحية هندسيا مع القدرة على التحكم والتلاعب سطح functionalized. عن طريق اتباع البروتوكولات المعروضة، والخلايا المهندسة قادرة على التصرف أجهزة الاستشعار التي ديناميكية، قادرة على القراءة ومعالجة وتسجيل الشروط في جميع أنحاء ثم عن طريق واجهات functionalized. هذه التكنولوجيا يمكن أن تؤثر المجالات بدءا من الطب الجزيئي للكشف تحليلها لإصلاح البيئة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

والكتاب الامتنان بدعم من جائزة FA9550-13-1-0108 من مكتب سلاح الجو للبحوث العلمية في الولايات المتحدة الأمريكية. الكتاب يقر بالإضافة إلى ذلك بدعم من جائزة N00014-15-1-2502 من مكتب البحوث البحرية للولايات المتحدة الأمريكية، وتمويل من معهد للتكنولوجيا الحرجة والعلوم التطبيقية في معهد البوليتكنيك فرجينيا وجامعة ولاية، ومن مؤسسة العلوم والبحوث الوطنية العليا برنامج الزمالة، جائزة رقم 1607310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics