जीवित कोशिकाओं अभियंता को सिंथेटिक जीव विज्ञान का प्रयोग कि प्रोग्राम सामग्री के साथ इंटरफेस

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस पत्र इंजीनियर कोशिकाओं और क्रियाशील सतहों कि कृत्रिम नियंत्रित करने और हेरफेर प्रोग्राम सामग्री सतहों के लिए ई कोलाई इंजीनियर सक्षम विकसित करने के लिए प्रोटोकॉल की एक श्रृंखला प्रस्तुत करता है।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हम एक अजैव-बायोटिक इंटरफेस है कि इंजीनियर कोशिकाओं को एक क्रियाशील सतह की सामग्री के गुणों को नियंत्रित करने के लिए अनुमति देता है विकसित किया है। ई कोलाई कोशिकाओं का एक कृत्रिम इंजीनियर तनाव और एक क्रियाशील सामग्री इंटरफ़ेस: इस प्रणाली के दो मॉड्यूल बनाने के द्वारा किया जाता है। इस पत्र के भीतर, हम विस्तार आनुवंशिक रूप से आणविक क्लोनिंग रणनीतियों का उपयोग ई कोलाई के एक तनाव के भीतर चयनित व्यवहार इंजीनियरिंग के लिए एक प्रोटोकॉल है। एक बार विकसित की है, इस तनाव जब एक रासायनिक inducer के संपर्क में बायोटिन का ऊंचा स्तर पैदा करता है। इसके अतिरिक्त, हम विस्तार दो अलग क्रियाशील सतहों, जिनमें से प्रत्येक कोशिका में संश्लेषित बायोटिन के लिए प्रतिक्रिया करने में सक्षम है बनाने के लिए प्रोटोकॉल। साथ में ले ली, हम एक लिंक, अजैव-बायोटिक सिस्टम इंजीनियर निर्जीव substrates पर सामग्री संरचना और विधानसभा को नियंत्रित करने की अनुमति देता है कि कोशिकाओं को बनाने के लिए एक पद्धति प्रस्तुत करते हैं।

Introduction

यहाँ, हम एक प्रोग्राम एक इंजीनियर सेल लाइन से एक रासायनिक संकेत का जवाब देने में सक्षम सब्सट्रेट के विकास के लिए प्रक्रियाओं की रिपोर्ट। 1 हम एक बायोटिन streptavidin इंटरफेस कृत्रिम इंजीनियर कोलाई (ई कोलाई) कोशिकाओं द्वारा उत्पादित बायोटिन के लिए जवाब है कि बनाने के द्वारा यह करते हैं। इससे पहले, प्रोग्राम सतहों विष का पता लगाने 2 और बिंदु का ख्याल निदान 3 रक्षा और सुरक्षा से आवेदनों की एक विस्तृत श्रृंखला के लिए इंजीनियर किया गया है। प्रोग्राम सतहों सेंसरों और actuators के रूप में उपयोगी हो सकता है 4, वे उन्हें विभिन्न पर्यावरणीय चुनौतियों के लिए अनुकूल करने की क्षमता के साथ endowing द्वारा "होशियार" बनाया जा सकता है। इसके विपरीत, इस तरह के ई कोलाई के रूप में भी सरल सूक्ष्मजीवों, निहित अनुकूलनशीलता है और परिष्कृत और अक्सर अप्रत्याशित समाधान के साथ चुनौतियों का जवाब देने में सक्षम हैं। इस अनुकूलनशीलता सक्षम हैकोलाई आबादी, उनके जटिल जीन नेटवर्क द्वारा नियंत्रित है, लागत प्रभावी ढंग से करने के लिए संसाधनों की तलाश है, 5 बनाने मूल्य वर्धित उत्पादों, 6 और यहां तक कि बिजली सूक्ष्म पैमाने रोबोटिक्स। 7 प्रोग्राम सतहों के उपयोग के साथ जीवित कोशिकाओं के अनुकूली फायदे के युग्मन, हम एक स्मार्ट सब्सट्रेट विभिन्न पर्यावरणीय स्थितियों का जवाब देने में सक्षम बना सकते हैं।

सिंथेटिक जीव विज्ञान शोधकर्ताओं ने नई क्षमताओं दिया है रहने वाले जीवों के व्यवहार के कार्यक्रम के लिए। कोशिकाओं इंजीनियरिंग नई जीन विनियामक नेटवर्क को रोकने के लिए, शोधकर्ताओं कोशिकाओं है कि क्रमादेशित व्यवहार की एक श्रृंखला की प्रदर्शनी डिजाइन कर सकते हैं। 8, 9 बुनियादी अनुसंधान के अलावा, इन कार्यों ऐसी सामग्री विधानसभा को नियंत्रित करने और मूल्य वर्धित उत्पादों जैविक रूप से उत्पादन के रूप में आवेदन के लिए इस्तेमाल किया जा सकता है। 10 के साथ साथ, हम विस्तार कैसे हम करने के लिए सिंथेटिक जीव विज्ञान के उपकरणों का इस्तेमाल enएक ई कोलाई तनाव है कि प्रेरण पर बायोटिन synthesizes gineer। इस तनाव एक प्लाज्मिड, pKE1-Laci-bioB इकट्ठा करने के लिए प्रतिबंध एंजाइम क्लोनिंग तरीकों का उपयोग करके विकसित किया गया था। यह प्लाज्मिड, जब ई कोलाई तनाव K-12 MG1655 में तब्दील, bioB, बायोटिन संश्लेषण के लिए एक आवश्यक एंजाइम का ऊंचा स्तर व्यक्त करने की क्षमता के साथ कोशिकाओं endows। बदल कोशिकाओं isopropyl β-D-1-thiogalactopyranoside (IPTG) के साथ प्रेरित और एक बायोटिन अग्रदूत, desthiobiotin (DTB) के साथ प्रदान किया गया है, बायोटिन का ऊंचा स्तर का उत्पादन किया गया।

बायोटिन की streptavidin के साथ बाध्यकारी बातचीत मजबूत न सहसंयोजक प्रकृति में पाया बांड में से एक है। जैसे, बायोटिन streptavidin बातचीत दोनों अच्छी तरह से विशेषता और अत्यधिक जैव प्रौद्योगिकी के क्षेत्र में कार्यरत है। 11 इस पांडुलिपि के भीतर, हम दो रणनीतियों बायोटिन streptavidin बातचीत भावना और एक क्रियाशील सतह के साथ सेल का उत्पादन बायोटिन पता लगाने के लिए रोजगार प्रस्तुत करते हैं। हमके रूप में "अप्रत्यक्ष" और "प्रत्यक्ष" नियंत्रण योजनाओं इन विषम सतहों को देखें। अप्रत्यक्ष नियंत्रण योजना में सेल का उत्पादन बायोटिन बायोटिन कि संयुग्मित किया गया है और बाध्यकारी साइटों streptavidin के लिए एक polystyrene सतह पर स्थिर साथ प्रतिस्पर्धा। इसके अलावा, streptavidin हॉर्सरैडिश peroxidase (एचआरपी) के साथ संयुग्मित है। एचआरपी 3, 3, 5, 5'-tetramethylbenzidine (TMB), एक ऑप्टिकल संकेत, 12 जो 450 एनएम (आयुध डिपो 450) पर वर्णक्रम absorbance (यानी, ऑप्टिकल घनत्व) बढ़ाता द्वारा नजर रखी जा सकती उत्पादन करने के लिए संशोधित करता है। इस प्रकार, अप्रत्यक्ष नियंत्रण योजना के शोधकर्ताओं ने आयुध डिपो के 450 संकेत के attentuation की निगरानी के द्वारा सेल का उत्पादन बायोटिन को मापने के लिए अनुमति देता है।

प्रत्यक्ष नियंत्रण योजना एक सामग्री की सतह को सीधे streptavidin immobilizing और बाध्यकारी साइटों streptavidin के लिए प्रतिस्पर्धा करने के लिए सेल का उत्पादन बायोटिन और biotinylated एचआरपी अनुमति देकर streptavidin बायोटिन घटना कारनामे। फिर,सेल का उत्पादन बायोटिन के रिश्तेदार का स्तर एक आयुध डिपो के 450 संकेत को मापने के द्वारा निगरानी कर रहे हैं।

साथ में ले ली, इंजीनियर कोशिकाओं और क्रियाशील सतहों हमें जीवित कोशिकाओं में नेटवर्क उत्प्रेरण द्वारा एक प्रोग्राम सतह के गुणों को नियंत्रित करने के लिए अनुमति देते हैं। दूसरे शब्दों में, हम एक प्रणाली है कि इन प्रणालियों को एक साथ जोड़ने के द्वारा रहने वाले जीवों की अनुकूलन क्षमता और विश्वसनीयता और एक इंजीनियर सामग्री इंटरफेस के विनिर्देश का फायदा उठाते हैं बनाया है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. मीडिया और संस्कृति तैयारी

  1. विआयनीकृत (डीआई) पानी का 1 एल के साथ लेग पाउडर शेयर की 25 ग्राम मिश्रण और बाँझ 20 मिनट के लिए 121 डिग्री सेल्सियस पर समाधान autoclaving द्वारा Lysogeny शोरबा (पौंड) मीडिया तैयार करें।
    1. लेग प्लेटों तैयार करने के लिए, नसबंदी से पहले लेग मीडिया के लिए 15 ग्राम अगर (1.5%) जोड़ने
    2. डि पानी में 1,000x carbenicillin (सीबी) (50 मिलीग्राम / एमएल) के शेयर समाधान तैयार करें।
    3. लेग मीडिया कि प्रतिरोधी transformants के चयन के लिए एक एंटीबायोटिक शामिल तैयारी करते हैं, तो जब तक निष्फल लेग मीडिया का तापमान 60 डिग्री सेल्सियस से नीचे है प्रतीक्षा करें, और उसके बाद हर 1 एमएल लेग की मीडिया के लिए एंटीबायोटिक शेयर की 1 μL जोड़ें।
  2. 5X M9 लवण (56.4 ग्राम / एल), 1 एम MgSO 4, 1 एम 2 CaCl, 20% ग्लूकोज, और 2% बायोटिन मुक्त casamino एसिड: M9 कम से कम मीडिया (तालिका 1) के लिए, निम्न में से अलग स्टॉक समाधान तैयार करते हैं।
    1. एक आटोक्लेव सुरक्षित बोतल में, गठबंधन 20 5x M9 के एमएल लवण, 200 व# 181; 1M MgSO 4, डि पानी की 1 एम 2 CaCl, 20% ग्लूकोज के 2 एमएल, 2% बायोटिन मुक्त casamino एसिड के 1 एमएल, और 76.8 एमएल के 10 μL के एल।
    2. समाधान 20 मिनट के लिए 121 डिग्री सेल्सियस पर कदम 1.2.1 में तैयार आटोक्लेव।
  3. 400 rpm पर आंदोलन के साथ 37 डिग्री सेल्सियस पर सभी संस्कृतियों सेते हैं। ऊष्मायन बार प्रयोग और तनाव के आधार पर भिन्न है, लेकिन आम तौर पर 8 से 12 घंटे के लिए पिछले।

2. बायोटिन उत्पादन ई कोलाई की पीढ़ी (प्लाज्मिड pKE1-Laci-bioB)

नोट: आनुवंशिक सर्किट दो भागों में शामिल है: एक Laci repressor, एक पी एल द्वारा संचालित है, teto -1 प्रमोटर एक tetr repressor प्रोटीन के अभाव, साथ ही एक बायोटिन अभिव्यक्ति पी टीआरसी -2 युक्त सिस्टम की वजह से विधान अभिव्यक्ति में जिसके परिणामस्वरूप प्रमोटर एक मजबूत राइबोसोम बाध्यकारी साइट (आरबीएस) bioB की अभिव्यक्ति ड्राइविंग द्वारा पीछा किया। सभी क्लोनिंग एक वाणिज्यिक, तेजी से विभाजित ई कोलाई रणनीति में मार डाला गया थामें। अंतिम निर्माण के परीक्षण के लिए ई कोलाई MG1655WT में तब्दील हो गया था। प्राइमर (तालिका 2) व्यावसायिक रूप से खरीदे गए थे।

  1. पूरे सेल पोलीमरेज़ चेन रिएक्शन (पीसीआर) के प्रदर्शन से ई कोलाई जीनोम से bioB जीन को अलग:
    1. 37 डिग्री सेल्सियस पर रात भर कोलाई एमजी 1655WT कोशिकाओं को विकसित।
    2. एक 0.2 एमएल पीसीआर ट्यूब में, बाँझ डि पानी के 9 μL के साथ कदम 2.1.1 में तैयार रातोंरात संस्कृति के 1 μL गठबंधन।
    3. thermocycler में 5 मिनट के लिए 95 डिग्री सेल्सियस पर ट्यूब सेते हैं और तुरंत कोशिकाओं lyse करने के लिए 10 मिनट के लिए एक -80 डिग्री सेल्सियस फ्रीजर के लिए ट्यूब हस्तांतरण। यह एक पीसीआर टेम्पलेट के रूप में सेवा करने के लिए जीनोमिक डीएनए सक्षम बनाता है।
    4. समाधान गला लें और जोड़ (i) 2.5 μL प्राइमरों nBioB2-F1 और nBioB2-आर के प्रत्येक (ii) 5 5x डीएनए पोलीमरेज़ बफर के μL, (iii) डीएनए पोलीमरेज़ के 0.25 μL, (iv) dNTP मिश्रण के 0.5 μL और (v) 25 μL की कुल प्रतिक्रिया मात्रा के लिए डि पानी के 6.75 μL(तालिका 4)।
    5. इसकी सामग्री मिश्रण करने के लिए (यानी, झाड़ू) ट्यूब के पक्ष हड़ताल। इसके बाद, तुरंत नीचे ट्यूब जल्दी (2 से ~) स्पिन सुनिश्चित करने के लिए नमूना ट्यूब के नीचे स्थित है।
    6. एक पीसीआर thermocycler में ट्यूब प्लेस और कार्यक्रम प्रोटोकॉल की शुरुआत में 95 डिग्री सेल्सियस पर 3 मिनट का अतिरिक्त कदम के साथ तालिका 3 में वर्णित का उपयोग करें।
    7. Tris आधार, एसिटिक एसिड, और EDTA बफर (TAE) में - (डि पानी + ethidium ब्रोमाइड में 1.2% agarose 1.0) सफल पीसीआर का उपयोग कर जेल वैद्युतकणसंचलन की पुष्टि करें। पीसीआर उत्पाद 1,070 basepairs (बीपी) लंबा होना चाहिए।
    8. निर्माता के निर्देशों के अनुसार वाणिज्यिक किट का उपयोग कदम 2.1.7 से जेल से डीएनए टुकड़े को निकालने के लिए।
  2. पृथक पी टीआरसी -2 प्रमोटर और प्लाज्मिड pKDL071 13 (एमआईटी में जेम्स कोलिन्स की प्रयोगशाला के सौजन्य से) से Laci operon:
    1. ई कोलाई युक्त कोशिकाओं को विकसित37 डिग्री सेल्सियस पर पौंड + सीबी में pKDL071 प्लाज्मिड रात भर।
    2. निर्माता के निर्देशों के अनुसार एक वाणिज्यिक miniprep किट का उपयोग कोशिकाओं से डीएनए निकालें। प्लाज्मिड एक पीसीआर टेम्पलेट के रूप में काम करेगा।
    3. कदम 2.1.4 से पीसीआर प्रोटोकॉल का पालन करें। 2.1.8 करने के लिए। निम्नलिखित संशोधनों के साथ:
    4. कदम 2.2.2 में प्लाज्मिड निकालने के साथ lysed कोशिकाओं को बदलें।
    5. 2.5 μL प्राइमरों 1-एफ और Laci कैसेट निकासी के लिए 1-आर के प्रत्येक प्रयोग करें। वैकल्पिक रूप से, 2.5 μL पी टीआरसी -2 निकासी के लिए प्राइमरों nBioB1-एफ और nBioB1-आर से प्रत्येक का उपयोग करें।
    6. इस बात की पुष्टि करने के लिए पीसीआर उत्पादों Laci कैसेट और पी टीआरसी -2 प्रमोटर साइट रहे हैं जेल वैद्युतकणसंचलन (कदम 2.1.7) का प्रदर्शन। वे 1213 बीपी और 109 बीपी लंबे, क्रमशः होना चाहिए।
  3. युक्त bioB कैसेट का निर्माण करने के लिए ओवरलैप एक्सटेंशन (SOE) पीसीआर द्वारा splicing का प्रयोग पी टीआरसी -2, एक सिंथेटिक राइबोसोम बाध्यकारी साइट (आरबीएस) प्राइमर nBioB2-F2 में, और bioB तालिका 3 में पाया जाता है।
  4. सम्मिलित निर्माणों (पी एल, teto-1 + Laci और पी टीआरसी -2 + bioB) pKE1-एमसीएस प्लाज्मिड वेक्टर 13 रीढ़ की हड्डी में वेक्टर पचाने और प्रतिबंध एंजाइमों के साथ डालने से (एमआईटी में जेम्स कोलिन्स की प्रयोगशाला के सौजन्य से):
    1. प्रतिबंध एंजाइमों और जेल वैद्युतकणसंचलन का उपयोग जीन निकालें। प्रत्येक प्रतिक्रिया में शामिल है (मैं) 10x प्रतिक्रिया बफर के 5 μL, (ii) प्रतिबंध एंजाइम 1 का 1 μL, (iii) प्रतिबंध एंजाइम 2 की 1 μL, (iv) डीएनए के कम से कम 1 माइक्रोग्राम, और (v) डि करने के लिए पानी 50 μL (5 तालिका) के लिए अंतिम मात्रा लाने के लिए। Laci कैसेट के लिए एंजाइमों AatII और EcoRI के साथ और bioB कैसेट के लिए एंजाइमों HindIII और SacII साथ डाइजेस्ट।
    2. बाद प्रतिक्रियाओं इकट्ठा कर रहे हैं, उन्हें जल्दी और संक्षेप में सेंट्रीफ्यूज (~ 2 एस) ऊष्मायन से पहले 1 घंटे के लिए 37 डिग्री सेल्सियस पर भंवर।
    3. दौरानपाचन, मानक प्रोटोकॉल के अनुसार वैद्युतकणसंचलन के लिए जैल तैयार करते हैं।
    4. जेल वैद्युतकणसंचलन 6x लोड हो रहा है बफर के साथ पचा डीएनए का मिश्रण।
    5. , वांछित निर्माण के स्थान का सत्यापन जेल से डीएनए टुकड़ा काट, और जेल से डीएनए टुकड़े को निकालने के लिए निर्माता के निर्देशों के अनुसार वाणिज्यिक जेल निकालना किट का उपयोग करने के लिए एक 2 लॉग सीढ़ी का प्रयोग करें।
  5. स्पेक्ट्रोस्कोपी का उपयोग डीएनए यों और 0 के लिए संस्करणों की गणना: 1, 1: 1, और 3: 1 दाढ़ डालने का अनुपात 1 समीकरण का उपयोग वेक्टर के लिए:
    1 समीकरण 1 समीकरण
    1 समीकरण में, एम वेक्टर को डालने का अनुपात है (0, 1, या 3), एक्स मैं डालने के डीएनए की मात्रा है, बीपी मैं आधार जोड़े में डालने की लंबाई है, बीपी वी वेक्टर की लंबाई है basepairs में, और एक्स वी वेक्टर (50 एनजी) की मात्रा है।
  6. संयोजन से बंधाव प्रतिक्रिया मिश्रण (i) 1 μL 10X ligase बफर (ii)1 μL टी -4 Ligase, (iii) 50 एनजी वेक्टर डीएनए, (iv) 10 μL कुल प्रतिक्रिया मात्रा (तालिका 6) के लिए प्रत्येक प्रतिक्रिया के लिए विशिष्ट डालने के डीएनए, और (v) डि पानी के एक बड़े पैमाने।
  7. 1 घंटे के लिए कमरे के तापमान (आरटी) पर सेते हैं।
  8. कदम 2.7 में बंधाव ऊष्मायन के दौरान, रासायनिक सक्षम कोशिकाओं तैयार करते हैं।
    1. अशेष 1 से 1.5 एमएल अपकेंद्रित्र ट्यूब में रात भर संस्कृतियों के एमएल।
    2. 1 मिनट के लिए 16,200 XG पर अपकेंद्रित्र।
    3. सतह पर तैरनेवाला छानना और ठंडा के 200 μL (बर्फ पर) 100 मिमी 2 CaCl में गोली resuspend। धीरे pipetting द्वारा गोली Resuspend। भंवर मत करो।
    4. बर्फ पर microcentrifuge ट्यूब 10 मिनट के लिए रखें।
    5. अपकेंद्रित्र, सतह पर तैरनेवाला हटाने ठंडा 100 मिमी 2 CaCl के 100 μL में गोली resuspend, और फिर बर्फ पर ट्यूब जगह है।
    6. ट्यूब एक अंतिम समय अपकेंद्रित्र और ठंडा 100 के 50 μL मिमी 2 CaCl में गोली resuspend।
    7. जगहबर्फ पर ट्यूब और रासायनिक सक्षम कोशिकाओं तुरंत उपयोग करें।
  9. सक्षम कोशिकाओं, 2.8 चरण में तैयार की प्रत्येक ट्यूब, कदम 2.6 और 2.7 में तैयार ligated डीएनए के 5 μL, जोड़ें।
  10. पक्ष (यानी flicking) नलियों हड़ताली द्वारा संक्षिप्त ट्यूब आंदोलन और फिर 30 मिनट के लिए बर्फ पर ट्यूबों जगह है।
  11. गर्मी 42 डिग्री सेल्सियस पर 45 S के लिए ट्यूबों सदमे और 2 मिनट के लिए बर्फ के लिए ट्यूबों वापसी।
  12. चयनात्मक लेग अगर + एंटीबायोटिक प्लेटें और पर पिपेट कोशिकाओं गिलास चढ़ाना मोती का उपयोग कोशिकाओं में फैल गया।
  13. 37 डिग्री सेल्सियस पर रात भर प्लेटें सेते हैं।
  14. अगली सुबह, डालने पॉजिटिव प्लेटों से कालोनियों लेने (यानी, 1: 1 और 3: 1 प्लेट)। 1 नकारात्मक नियंत्रण प्लेट कोई विकास नहीं चलता, या अगर 0 5-8 कालोनियों लेने: यदि 0 3 कालोनियों उठाओ 1 प्लेट कुछ वृद्धि की है। 5 मिलीलीटर लेग + एंटीबायोटिक टीका लगाना और आंदोलन के साथ 37 डिग्री सेल्सियस पर 8 घंटे के लिए विकसित करने के लिए उठाया कालोनियों का प्रयोग करें।
  15. एक minipr का उपयोग कोशिकाओं से डीएनए निकालनेईपी किट, निर्माता के निर्देशों का पालन। एक परीक्षण कटौती प्रतिबंध एंजाइमों का उपयोग कर प्रदर्शन करना (एक ही प्रक्रिया कदम 2.4.1 में विस्तृत निम्नलिखित।)।
  16. एक सही निर्माण से अपेक्षित परिणाम के साथ पचा डीएनए टुकड़े की लंबाई की तुलना द्वारा सफल निर्माणों के साथ कोशिकाओं को पहचानें। सफल प्लाज्मिड निर्माणों को ले जाने संस्कृति बाँझ फ़िल्टर, 40% ग्लिसरॉल का एक समाधान (डि पानी में) के साथ बराबर भागों संस्कृति मिश्रण और -80 डिग्री सेल्सियस पर मिश्रण ठंड से संरक्षित किया जा सकता है।
    नोट: अन्य कोलाई उपभेदों (यानी, MG1655WT) में plasmids के परिवर्तनों रासायनिक सक्षम कोशिकाओं को बनाने के लिए उपरोक्त प्रक्रिया का पालन करके पूरा किया जा सकता है।

3. सेल विशेषता: विकास की अवस्था और खुराक प्रतिक्रिया

  1. एक उचित एंटीबायोटिक के साथ रात भर लेग मीडिया में इंजीनियर उपभेदों के लिए आगे बढ़ें।
  2. विकास घटता के लिए, के साथ और IPTG (बिना एक 0.5 एम एस से कम से कम M9 मीडिया के 50 एमएल तैयारTock) और / या DTB (500 माइक्रोग्राम / एमएल स्टॉक से) इस प्रकार है:
    1. 0 एनजी / एमएल DTB (शेयर 0 μL) / 0 मिमी IPTG (शेयर 0 μL) तैयार करें।
    2. 200 एनजी / एमएल DTB (शेयर के 200 μL) / 0 मिमी IPTG (शेयर 0 μL) तैयार करें।
    3. 0 एनजी / एमएल DTB (शेयर 0 μL) / 0.5 मिमी IPTG (शेयर के 50 μL) तैयार करें।
    4. 200 एनजी / एमएल DTB (शेयर के 200 μL) / 0.5 मिमी IPTG (शेयर के 50 μL) तैयार करें।
    5. 1 में रात भर संस्कृति के साथ टीका लगाना: मीडिया ऊपर निर्दिष्ट में 100।
    6. एक 96 अच्छी तरह से थाली, विभाज्य संस्कृति के 200 μL, तीन प्रतियों में, प्रत्येक अच्छी तरह से करने के लिए।
    7. उपाय आयुध डिपो के 600 प्लेट रीडर में 37 डिग्री सेल्सियस पर निरंतर मिलाते और ऊष्मायन के साथ हर घंटे 5 मिनट 24 से अधिक।
  3. खुराक प्रतिक्रिया पढ़ाई के लिए, bioB वास्तविक समय ऑप्टिकल मात्रा का ठहराव के लिए mCherry साथ pKE1-Laci-bioB में जीन (एक लाल फ्लोरोसेंट प्रोटीन) की जगह।
  4. 0.1 मिमी से 5 मिमी अभिव्यक्ति के लिए प्रेरित करने को लेकर IPTG की मात्रा अलग जोड़ेलेग मीडिया में।
  5. 100: 1 के कमजोर पड़ने पर रातोंरात संस्कृति के साथ टीका लगाना।
  6. उपाय प्रतिदीप्ति 15 घंटे के लिए हर 30 मिनट।

4. इंजीनियर कोशिकाओं और सतह पर तैरनेवाला तैयारी से बायोटिन उत्पादन उत्प्रेरण

  1. लेग मीडिया में रात भर कोलाई MG1655 तनाव में pKE1-Laci-bioB आगे बढ़ें।
  2. DTB 30 से 200 एनजी / एमएल से लेकर के साथ अनुपूरक M9 मीडिया।
  3. 0.5 मिमी IPTG बायोटिन संश्लेषण के लिए प्रेरित करने के लिए जोड़ें।
  4. 1 में रात भर संस्कृति के साथ पूरक, बायोटिन मुक्त न्यूनतम M9 मीडिया टीका लगाना: 100 कमजोर पड़ने।
  5. विकास, सेंट्रीफ्यूज कोशिकाओं के 24 घंटे के बाद और बायोटिन समृद्ध सतह पर तैरनेवाला इकट्ठा।
  6. उपाय अप्रत्यक्ष नियंत्रण और प्रत्यक्ष नियंत्रण क्रियाशील सतहों के साथ बायोटिन समृद्ध सतह पर तैरनेवाला। कदम 5.23 और 6.12, क्रमशः में बायोटिन नमूने की जगह में सतह पर तैरनेवाला का प्रयोग करें।

5. अप्रत्यक्ष नियंत्रण योजना Functionalized भूतल तैयारी

  1. वें तैयारई समाधान के बाद।
    1. 20 मिलीग्राम से मिलकर एक SMCC समाधान तैयार / succinimidyl ट्रांस-4- (maleimidylmethyl) cyclohexane-1-कार्बोक्सिलेट एमएल डाइमिथाइल sulfoxide में (SMCC) (DMSO)।
    2. 20 मिलीग्राम से मिलकर एक SPDP समाधान तैयार / succinimidyl 3- (2-pyridyldithio) propionate DMSO में (SPDP) एमएल।
    3. DMSO में 20 मिलीग्राम / एमएल नियंत्रण रेखा नियंत्रण रेखा बायोटिन तैयार करें।
    4. फॉस्फेट बफर खारा (पीबीएस) में 10 मिलीग्राम / एमएल हॉर्सरैडिश peroxidase (एचआरपी) तैयार करें।
    5. 10 मिलीग्राम / एमएल पीबीएस में streptavidin (एसए) तैयार करें।
    6. पीबीएस में 10 मिलीग्राम / एमएल गोजातीय सीरम albumin (बीएसए) तैयार करें।
    7. डि पानी में 100 मिमी dithiothreitol (डीटीटी) तैयार करें।
    8. पीबीएस में 5 मिमी ethylenediaminetetaacetic एसिड (EDTA) तैयार करें।
    9. पीबीएस में 0.5% कैसिइन तैयार करें।
    10. डि पानी में 20% बीच 80 शेयर तैयार करें।
    11. पीबीएस में 0.05% के बीच 80 (20% से शेयर) तैयार करें।
    12. डि पानी में सोडियम एसीटेट के 50 मिमी तैयार करें।
    13. DMSO में 1% TMB तैयार करें।
    14. तैयार 3% एच 22 मैंn डि पानी।
    15. डि पानी में 2, महाराष्ट्र 2 अतः 4 तैयार करें।
  2. SPDP समाधान के 1.4 μL 20 μL एसए समाधान करने के लिए जोड़ें।
  3. आरटी पर 1.5 घंटे के लिए 5.2 से समाधान सेते हैं, एल्यूमीनियम पन्नी में लपेटा प्रकाश के संपर्क से बचने के लिए। यह कदम SPDP crosslinker एक एमिनो समूह pyridyldithio सक्रिय एसए के गठन के माध्यम से एसए करने के लिए बांड के लिए अनुमति देता है।
  4. समाधान के लिए डीडीटी समाधान के 2.4 μL कदम 5.3 से जोड़ें और आरटी पर 1 घंटे के लिए सेते हैं। यह एक sulfhydryl सक्रिय एसए, जिसके परिणामस्वरूप एक पिरिडीन 2-thione दरार के लिए अनुमति देता है।
  5. 72 μL एचआरपी समाधान के लिए 7.5 μL SMCC समाधान जोड़ें और आरटी पर 1.5 घंटे, एल्यूमीनियम पन्नी में लपेटा प्रकाश के संपर्क से बचने के लिए सेते हैं। यह एक maleimide सक्रिय एचआरपी एक एमिनो समूह से बंधे में यह परिणाम है।
  6. 200 μL बीएसए समाधान के साथ 17 μL नियंत्रण रेखा नियंत्रण रेखा बायोटिन समाधान मिक्स और आरटी पर 1.5 घंटे, एल्यूमीनियम पन्नी में लपेटा प्रकाश के संपर्क से बचने के लिए सेते हैं। यह कदम साधना टी करने के लिए अनुमति देता है बायोटिनएक एमाइड बांड के माध्यम से ओ बीएसए।
  7. कदम 5.4, 5.5 से समाधान स्थानांतरण और 5.6 स्पिन नलियों के भीतर केन्द्रापसारक concentrators अलग करने के लिए।
  8. 10,000 XG पर SA-SPDP युक्त कदम 5.4, सेंट्रीफ्यूज से ट्यूब मात्रा तक ट्यूबों के लिए 100 μL या 16 मिनट के लिए पहुंचता है। पीबीएस EDTA के साथ 500 μL के लिए स्पिन ट्यूब भरें।
    1. दोहराएँ कदम 5.8 पांच बार। 4 डिग्री सेल्सियस पर शेयर की दुकान।
  9. 10,000 XG पर एचआरपी-SMCC युक्त कदम 5.5, सेंट्रीफ्यूज से जब तक मात्रा 25 μL पहुंचता है या 16 मिनट के लिए ट्यूबों के लिए। पीबीएस के साथ 500 μL के लिए स्पिन ट्यूब भरें।
    1. दोहराएँ कदम 5.9 पांच बार। 4 डिग्री सेल्सियस पर शेयर की दुकान।
  10. 10,000 XG पर बीएसए बायोटिन युक्त, कदम 5.6, सेंट्रीफ्यूज से जब तक मात्रा 100 μL तक पहुँचता है या 12 मिनट के लिए ट्यूबों के लिए। पीबीएस के साथ 500 μL के लिए स्पिन ट्यूब भरें।
    1. दोहराएँ कदम 5.10 चार बार।
    2. 10,000 XG पर अपकेंद्रित्र जब तक मात्रा 100 μL पहुँचता हैया 12 मिनट के लिए। पीबीएस के 100 μL ट्यूब को जोड़ने। 4 डिग्री सेल्सियस पर शेयर की दुकान।
  11. रात भर 4 डिग्री सेल्सियस पर 10 मिलीग्राम / एमएल एसए समाधान और दुकान के 25 μL के साथ 10 मिलीग्राम / एमएल एचआरपी समाधान के 25 μL जोड़ें। इस एसए एक thioether बांड के माध्यम से एचआरपी साथ संयुग्मित बनने के लिए कारण बनता है।
    1. 4 डिग्री सेल्सियस फ्रिज में रात भर समाधान और दुकान के साथ 4 काम समाधान एक 1: तैयार करें। -20 डिग्री सेल्सियस पर स्टोर शेष समाधान।
  12. पीबीएस के 490 μL के लिए बीएसए बायोटिन शेयर (या 10 μL बीएसए शेयर) के 10 μL जोड़कर, पीबीएस में बीएसए बायोटिन (या बीएसए) से मिलकर दो समाधान तैयार करें।
  13. एक 96 अच्छी तरह polystyrene थाली के प्रत्येक अच्छी तरह से करने के लिए कदम 5.12 से समाधान के 100 μL जोड़ें।
  14. 1 घंटे के लिए 37 डिग्री सेल्सियस पर थाली, पन्नी में लपेटा सेते हैं।
  15. 0.05% के बीच 80 के साथ थाली के कुओं धो लें।
    1. 0.05% पीबीएस बीच 80 के 200 μL कुओं में जोड़े। आरटी पर 2 मिनट के लिए सेते हैं। तरल छानना।
    2. <li> दोहराएँ कदम 5.15.1 तीन बार।
  16. 0.5% कैसिइन समाधान के 200 μL 96 अच्छी तरह से थाली में कुओं में से प्रत्येक में जोड़े।
  17. 1 घंटे के लिए 37 डिग्री सेल्सियस पर थाली सेते हैं।
  18. दोहराएँ कदम 5.15 कुओं तीन बार धोने के लिए।
  19. 0.05% के बीच 80 का 7.5 μL के साथ 0.5% कैसिइन समाधान के 12 एमएल के मिश्रण से एक समाधान तैयार है।
  20. SA-एचआरपी शेयर 1 पतला: 10,000 समाधान कदम 5.19 में तैयार इस्तेमाल करते हैं।
  21. एक 96 अच्छी तरह से थाली के प्रत्येक अच्छी तरह से करने के लिए कदम 5.20 में तैयार समाधान के 80 μL जोड़ें।
  22. polystyrene थाली के प्रत्येक अच्छी तरह से करने के लिए तैयार बायोटिन नमूना के 20 μL जोड़ें। सतह पर तैरनेवाला 4.6 में तैयार इस चरण में बायोटिन नमूने के रूप में इस्तेमाल किया जा सकता है।
  23. 1 घंटे के लिए 37 डिग्री सेल्सियस पर थाली सेते हैं। यह कदम मुक्त बायोटिन के बीच प्रतियोगी बंधन और स्थिर SA-एचआरपी बाध्यकारी साइटों के लिए बीएसए बायोटिन के लिए अनुमति देता है।
  24. दोहराएँ कदम 5.15 कुओं तीन बार धोने के लिए।
  25. 50 मिमी सोडियम एसीटेट समाधान, 1% TMB समाधान मिश्रण,और एक 1000 में 3% एच 22 समाधान: 10: 1 अनुपात (20 एमएल की कुल मात्रा)।
  26. समाधान के 200 μL प्रत्येक अच्छी तरह से करने के लिए कदम 5.25 से जोड़ें और आरटी पर 15 मिनट, पन्नी के साथ कवर के लिए बैठने के लिए अनुमति देते हैं।
  27. 2 महाराष्ट्र 2 अतः 4 के 50 μL प्रत्येक कुएं में जोड़े प्रतिक्रिया को रोकने के। आयुध डिपो के 450 उपाय के एक प्लेट रीडर का उपयोग।

6. प्रत्यक्ष नियंत्रण योजना Functionalized भूतल तैयारी

  1. निम्नलिखित समाधान तैयार करें।
    1. DMSO में 20 मिलीग्राम / एमएल नियंत्रण रेखा नियंत्रण रेखा बायोटिन तैयार करें।
    2. 10 मिलीग्राम / एमएल पीबीएस में एचआरपी तैयार करें।
    3. पीबीएस में 0.17 माइक्रोग्राम / एमएल एसए तैयार करें।
    4. पीबीएस में 0.5% कैसिइन तैयार करें।
    5. डि पानी में 20% बीच 80 शेयर तैयार करें।
    6. पीबीएस में 0.05% के बीच 80 (20% से शेयर) तैयार करें।
    7. डि पानी में सोडियम एसीटेट के 50 मिमी तैयार करें।
    8. DMSO में 1% TMB तैयार करें।
    9. डि पानी में 3% एच 22 तैयार करें।
    10. तैयार 2 महाराष्ट्र 2 अतः 4 में।
  2. 72 μL एचआरपी को 7.5 μL नियंत्रण रेखा नियंत्रण रेखा बायोटिन जोड़ें और आरटी पर कम के लिए 1.5 घंटे सेते हैं, एल्यूमीनियम पन्नी में लपेटा प्रकाश के संपर्क से बचने के लिए। यह कदम एक एमाइड बांड के माध्यम से एचआरपी को साधना के लिए बायोटिन का कारण बनता है।
  3. एक स्पिन ट्यूब के भीतर एक केन्द्रापसारक concentrator के लिए 6.2 कदम से समाधान स्थानांतरण
    1. 10,000 XG पर समाधान अपकेंद्रित्र जब तक मात्रा 100 μL पहुंचता है या 12 मिनट के लिए। पीबीएस के साथ 500 μL के लिए स्पिन ट्यूब भरें और centrifugation और पीबीएस अलावा चार बार दोहराएँ। 4 डिग्री सेल्सियस पर शेयर की दुकान।
  4. एक 96 अच्छी तरह polystyrene प्लेट के भीतर प्रत्येक अच्छी तरह से करने के लिए 6.1.3 से एसए समाधान के 100 μL जोड़ें।
  5. 1 घंटे के लिए 37 डिग्री सेल्सियस पर थाली, पन्नी में लपेटा सेते हैं।
  6. 0.05% के बीच 80 के साथ थाली के कुओं धो लें।
    1. 0.05% की 200 μL बीच 80 कुओं में जोड़े। आरटी पर 2 मिनट के लिए सेते हैं। तरल छानना।
    2. 6.6.1 तीन बार दोहराएँ।
  7. 0.5% कैसिइन समाधान के 200 μL 96 अच्छी तरह से थाली में कुओं में से प्रत्येक में जोड़े।
  8. 1 घंटे के लिए 37 डिग्री सेल्सियस पर थाली सेते हैं।
  9. दोहराएँ कदम 6.6 तीन बार कुओं धोने के लिए।
  10. पतला बायोटिन एचआरपी शेयर 1: 10,000 समाधान कदम 6.3 में तैयार इस्तेमाल करते हैं।
  11. एक 96 अच्छी तरह से थाली के प्रत्येक अच्छी तरह से करने के लिए कदम 6.10 में तैयार समाधान के 80 μL जोड़ें।
  12. polystyrene थाली के प्रत्येक अच्छी तरह से करने के लिए तैयार बायोटिन नमूना के 20 μL जोड़ें। सतह पर तैरनेवाला 4.6 में तैयार इस चरण में बायोटिन नमूने के रूप में इस्तेमाल किया जा सकता है।
  13. 1 घंटे के लिए 37 डिग्री सेल्सियस पर थाली सेते हैं। यह कदम प्रतिस्पर्धी स्थिर SA बाध्यकारी साइटों के लिए मुफ्त बायोटिन और बायोटिन एचआरपी के बीच बाइंडिंग के लिए अनुमति देता है।
  14. दोहराएँ कदम 6.6 कुओं तीन बार धोने के लिए।
  15. 10: 1 अनुपात (20 एमएल की कुल मात्रा) एक 1000 में 50 मिमी सोडियम एसीटेट समाधान, 1% TMB समाधान, और 3% एच 22 समाधान मिक्स।
  16. समाधान के 200 μL चरण 6 से जोड़ें।15 प्रत्येक अच्छी तरह से और आरटी पर 15 मिनट, पन्नी के साथ कवर के लिए सेते हैं।
  17. 2 महाराष्ट्र 2 अतः 4 समाधान के 50 μL प्रत्येक कुएं में जोड़े प्रतिक्रिया को रोकने के। आयुध डिपो के 450 उपाय के एक प्लेट रीडर का उपयोग।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

प्रतिनिधि परिणाम साथ पांच आंकड़े में प्रस्तुत कर रहे हैं। सबसे पहले, हम क्लोनिंग की प्रक्रिया रेखांकन (चित्रा 1) पेश ताकि पाठक नेत्रहीन कृत्रिम इंजीनियर ई कोलाई तनाव पैदा करने के लिए महत्वपूर्ण कदम का अनुसरण कर सकते हैं। आदेश कोशिकाओं की जनसंख्या गतिशीलता को चिह्नित करने के लिए, हम एक विकास की अवस्था (चित्रा 2) जनसंख्या के 600 एनएम (600 आयुध डिपो) पर ऑप्टिकल घनत्व को मापने के द्वारा उत्पन्न प्रदान करते हैं। तो, हम बताएंगे कि कैसे नियामक जीन नेटवर्क सत्यापित है mCherry bioB के लिए एक प्रॉक्सी के रूप में प्रयोग (चित्रा 3), हमें ऑप्टिकली bioB के रिश्तेदार राशि है कि IPTG साथ प्रेरण पर सेल द्वारा उत्पादित किया जाएगा मापने के लिए अनुमति देकर। अगला, हम अप्रत्यक्ष नियंत्रण और प्रत्यक्ष नियंत्रण क्रियाशील सतहों के लिए प्रतिक्रिया डेटा प्रस्तुत करते हैं। इन आंकड़ों भूखंडों (चित्रा 4) मुक्त करने के मापा समाधान का उपयोग करके विकसित किए गएबायोटिन क्रियाशील सतहों की प्रतिक्रिया प्रोफाइल को चिह्नित करने के लिए। अंत में, हम कैसे इंजीनियर कोशिकाओं बायोटिन (चित्रा 5) का उत्पादन करने के लिए प्रेरित कर रहे हैं दिखा विशेषता डेटा मौजूद है, जिससे क्रियाशील सतहों को संशोधित।

आकृति 1
चित्रा 1: डिजाइन और inducible, इंजीनियर कोशिकाओं का निर्माण। (ए) प्राइमर ई कोलाई जीनोम, जो बायोटिन संश्लेषण मार्ग में एक महत्वपूर्ण एंजाइम को कूटबद्ध से bioB जीन को अलग-थलग करने के लिए डिजाइन किए गए थे। (बी) के पी एल, teto -1 -lacI और पी टीआरसी -2 दृश्यों एक प्लाज्मिड इसी प्राइमरों के साथ एक आनुवंशिक टॉगल स्विच युक्त से अलग किया जा सकता है। (सी) निकाले bioB जीन और टॉगल स्विच से दो टुकड़े तो जीन सर्किट को बनाने के लिए इस्तेमाल किया जा सकता है। IPTG के अलावा तो इंडस्ट्रीज़ कर सकते हैंbioB और इस तरह बायोटिन संश्लेषण की अभिव्यक्ति UCE जब DTB bioB के लिए एक सब्सट्रेट के रूप में जोड़ा जाता है। (डी) इकट्ठे प्लाज्मिड K-12 MG1655 ई कोलाई के रूप में तब्दील किया गया था। इस इंजीनियर सेल लाइन द्वारा bioB और इस तरह बायोटिन संश्लेषण की अभिव्यक्ति के लिए प्रेरित करने के लिए जब DTB एक सब्सट्रेट के रूप में प्रदान किया गया IPTG की उपस्थिति के कारण होता है। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2: इंजीनियर कोशिकाओं के लिए विकास घटता। इंजीनियर, inducible MG1655 जंगली प्रकार की कोशिकाओं हो गई है और कम से कम मीडिया (यानी, बायोटिन मुक्त M9 मीडिया), साथ ही कम से कम मीडिया DTB के साथ पूरक (200 एनजी / एमएल) और / या IPTG (0.5 मिमी) में निगरानी की गई। भूखंडों 600 आयुध डिपो पढ़ने, मापा हर 5 मील दिखाने 24 घंटे के लिए एन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3: इंजीनियर जीन नेटवर्क परीक्षण। फ्लोरोसेंट प्रोटीन mCherry के स्थान पर इस्तेमाल किया गया था bioB जीन ताकि हम ऑप्टिकली जब इंजीनियर कोशिकाओं IPTG साथ प्रेरित किया गया प्रेरण प्रोफ़ाइल उपाय कर सकता है। हम IPTG (नीले हीरे) के साथ प्रेरित नहीं कोशिकाओं के साथ कोशिकाओं IPTG (लाल हीरे) के साथ प्रेरित विपरीत। इन परिणामों के inducible जीन नेटवर्क की प्रभावकारिता का प्रदर्शन। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

/55300/55300fig4.jpg "/>
चित्रा 4: Functionalized सामग्री इंटरफ़ेस का सत्यापन। बायोटिन की सांद्रता में परिवर्तन के लिए हमारी क्रियाशील सतह को उजागर करके, हम आयुध डिपो को मापने के 450 absorbance के द्वारा ऑप्टिकल प्रतिक्रिया को मापने के लिए सक्षम हैं। इन परिणामों प्रतिक्रिया के ऑप्टिकल तीव्रता के बायोटिन की एकाग्रता को जोड़ने, हमें एक अंशांकन वक्र उत्पन्न करने के लिए अनुमति देते हैं। यहाँ, हम दोनों बनाम अप्रत्यक्ष (बाएं) और डायरेक्ट (दाएं) क्रियाशील सतह योजनाओं के लिए ऑप्टिकल संकेत घटता बायोटिन प्रस्तुत करते हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5: इंजीनियर कोशिकाओं को नियंत्रित सामग्री इंटरफ़ेस। प्रोटोकॉल वर्गों 5 या 6 का उपयोग करके, हम प्रेरित किया, इंजीनियर सी के उत्पादों का उपयोग करने में सक्षम हैंएल रासायनिक क्रियाशील सतह को संशोधित करने के लिए। हम आयुध डिपो 450 को मापने के द्वारा इन प्रतिक्रियाओं ऑप्टिकली निगरानी कर सकते हैं। इसके अलावा, चित्रा 4 में विकसित अंशांकन वक्र का उपयोग करके, हम एकाग्रता के भीतर बायोटिन के जवाब के ऑप्टिकल तीव्रता लिंक कर सकते हैं। हम यहाँ उपस्थित विभिन्न बायोटिन सांद्रता, हमारे अप्रत्यक्ष नियंत्रण योजना क्रियाशील सतह से मापा जाता है, जंगली प्रकार की कोशिकाओं (सफेद), uninduced pKE1-Laci-bioB प्लाज्मिड (नारंगी) युक्त कोशिकाओं के लिए, और प्रेरित कोशिकाओं pKE1-Laci-bioB युक्त प्लाज्मिड (ग्रे)। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

रासायनिक अंतिम एकाग्रता रकम
5x M9 लवण 1x 20 एमएल
1 एम MgSO 4 2 मिमी 200 μL
1 एम 2 CaCl 0.1 मिमी 10 μL
20% ग्लूकोज 0.40% 2 एमएल
2% बायोटिन मुक्त Casamino एसिड 0.02% 1 एमएल
डीआई पानी एन / ए 76.8 एमएल

तालिका 1: M9 मीडिया पकाने की विधि।

नाम प्राइमर अनुक्रम प्रयोग
1-च CCGCCGGAATTCTCCCTATCAGTGATAGAGATT Laci कैसेट निकासी
1-आर सीCGACGTCTCACTGCCCGCTTTCCAGTC Laci कैसेट निकासी
nBioB1-एफ CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT पी टीआरसी -2 निकासी
nBioB1-आर GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT पी टीआरसी -2 निकासी
nBioB2-F1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB निकासी
nBioB2-आर TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB निकासी
nBioB2-F2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC सिंथेटिक आरबीएस अलावा

तालिका 2: प्राइमर की सूची।

चरण 1
चरण 2 चरण 3 चरण 4 चरण 5 चरण 6 चरण 7 चरण 8 9 कदम
98 डिग्री सेल्सियस 98 डिग्री सेल्सियस 70 डिग्री सेल्सियस 72 डिग्री सेल्सियस 98 डिग्री सेल्सियस 60 डिग्री सेल्सियस 72 डिग्री सेल्सियस 72 डिग्री सेल्सियस 4 डिग्री सेल्सियस
0:30 0:10 0:30 01: 00 / केबी 0:10 0:30 01: 00 / केबी 2:00
12 बार दोहराएँ 25 बार दोहराएँ
-1 डिग्री सेल्सियस / चक्र

तालिका 3: पीसीआर कार्यक्रम।

नाम आयतन
सेल lysate (टेम्पलेट) 10 μL
प्राइमर (प्रत्येक) 0.625 μL (प्रत्येक)
5x Q5 बफर 5 μL
Q5 पोलीमरेज़ 0.25 μL
dNTP मिक्स 0.5 μL
डीआई पानी 6.75 μL

सारणी 4: पूरे सेल पीसीआर प्रतिक्रिया (25 μL)।

नाम आयतन
10एक्स प्रतिक्रिया बफर 5 μL
एनजाइम 1 1 μL
एनजाइम 2 1 μL
टेम्पलेट डीएनए 1 माइक्रोग्राम
डीआई पानी 43 μL - डीएनए की मात्रा

तालिका 5: प्रतिबंध एंजाइम पाचन रिएक्शन (50 μL)।

नाम आयतन
डीएनए 50 ग्राम वेक्टर + एक्स माइक्रोग्राम डालने
10x ligase बफर 1 μL
टी -4 Ligase 1 μL
डीआई पानी 8 μL - डीएनए की मात्रा

टेबल 6: बंधाव प्रतिक्रिया (10 μL)।

नाम एकाग्रता टिप्पणियाँ
2 CaCl 100 मिमी
Carbeniccilin 50 मिलीग्राम / एमएल (1000x)
DTB 50 माइक्रोग्राम / एमएल
IPTG 0.5 एम
SMCC 20 मिलीग्राम / एमएल 100uL DMSO में 2 मिलीग्राम
SPDP 20 मिलीग्राम / एमएल 100uL DMSO में 2 मिलीग्राम
नियंत्रण रेखा नियंत्रण रेखा बायोटिन 20 मिलीग्राम / एमएल 100uL DMSO में 2 मिलीग्राम
एचआरपी 10 मिलीग्राम / एमएल पीबीएस में
एसए (अप्रत्यक्ष) 10 मिलीग्राम / एमएल पीबीएस में
एसए (प्रत्यक्ष) 0.17 माइक्रोग्राम / एमएल पीबीएस में
बीएसए 20 मिलीग्राम / एमएल पीबीएस में
डीटीटी 100mm डि पानी में
EDTA 5 मिमी 10 एमएल पीबीएस में 18.6 मिलीग्राम
कैसिइन 0.50% पीबीएस में
बीच 80 20% डि पानी में
पीबीएस में बीच 80 0.05%
नाजिया 50 मिमी डि पानी में, 5.1 3 एम एचसीएल का उपयोग कर पीएच को समायोजित करें
TMB 1% DMSO में
एच 22 3% डि पानी में
एच 2 अतः 4 2 एम डि पानी में

टेबल 7: अभिकर्मक समाधान की सूची।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

हम एक क्रियाशील सामग्री की सतह के साथ रहने वाले इंजीनियर कोशिकाओं interfacing के लिए एक नई रणनीति प्रस्तुत किया है। यह एक सेल लाइन बायोटिन का ऊंचा स्तर synthesizing जब IPTG साथ प्रेरित करने में सक्षम विकसित करके पूरा किया गया। बायोटिन का ऊंचा स्तर तो क्रियाशील सतह को संशोधित करने के लिए इस्तेमाल किया जा सकता है। प्रोटोकॉल ई कोलाई सेल लाइन इंजीनियर के लिए और दो अलग अलग क्रियाशील सतहों बनाने के लिए विस्तृत जानकारी दी।

इस प्रोटोकॉल में महत्वपूर्ण कदम इंजीनियर सेल लाइन के निर्माण के दौरान होते हैं। बहाव के मुद्दों, दोनों विकास घटता के साथ इंजीनियर सेल उपभेदों निस्र्पक (चित्रा 2) और फ्लोरोसेंट प्रतिक्रिया (चित्रा 3) से बचने के लिए प्रोत्साहित किया जाता है। प्रक्रियात्मक मुद्दों पैदा होना चाहिए, जैसे कि पीसीआर निकासी और गिब्सन विधानसभा 14 के रूप में अन्य आणविक क्लोनिंग रणनीतियों, जहां कदम के लिए प्रतिस्थापित किया जा सकता उचित। बायोटिन Yie के अनुकूलन के लिएइंजीनियर सेल लाइन के एलडी, यह सुनिश्चित करने के लिए कि DTB के लिए पर्याप्त मात्रा में कोशिकाओं के लिए प्रदान की जाती है महत्वपूर्ण है। हमारे अध्ययन में हमने पाया कि 200 एनजी / एमएल DTB बायोटिन उत्पादन में पर्याप्त और सांख्यिकीय महत्वपूर्ण वृद्धि हुई जब कोशिकाओं IPTG साथ प्रेरित किया गया हासिल। इसके अतिरिक्त, बीएसए बायोटिन, एसए एचआरपी, और बायोटिन एचआरपी के सफल संयोजन प्रभावी ढंग से प्रदर्शन कर और अप्रत्यक्ष और प्रत्यक्ष नियंत्रण योजनाओं की निगरानी के लिए महत्वपूर्ण है। प्रकाश करने के लिए अनावश्यक जोखिम से बचने और conjugates 4 डिग्री सेल्सियस पर रातोंरात सेते को सुनिश्चित करने के लिए एक प्रभावी साधना का गठन किया है की अनुमति देने के लिए ध्यान रखना।

हमारी प्रोटोकॉल ऐसे 4'-hydroxyazobenzene-2-कार्बोक्जिलिक एसिड के आधार पर उन के रूप में व्यावसायिक रूप से उपलब्ध बायोटिन का पता लगाने किट, की तुलना में बायोटिन की छोटी मात्रा में है कि जैविक रूप से प्रासंगिक हैं (पीजी / एमएल पैमाने) का पता लगाने के लिए अपनी क्षमता की वजह से वैकल्पिक तरीकों 15 से अधिक लाभ प्रदान करता है प्रतिस्पर्धी बाध्यकारी रणनीतियों। streptavidin-जैव का उपयोग कर यद्यपिटिन प्रणाली जैव प्रौद्योगिकी 16, 17 में आम है, हमारी प्रणाली के बायोटिन की छोटी मात्रा में करने के लिए प्रतिक्रिया करने की क्षमता सीधे क्रियाशील सतह के साथ हमारे आनुवंशिक रूप से इंजीनियर सेल लाइन से जोड़ने के लिए अनुमति देता है।

हमारे प्रोटोकॉल का एक संभावित सीमा बायोटिन का पता लगाने के परिणामस्वरूप गतिशील रेंज है। अप्रत्यक्ष और प्रत्यक्ष नियंत्रण योजनाओं में, हम 10 2 और 4 -10 6 / एमएल, क्रमशः (चित्रा 4) के बीच -10 3 10 पीजी बायोटिन का पता लगाने में सक्षम हैं। सौभाग्य से, अप्रत्यक्ष नियंत्रण योजना की कम रेंज हमें आसानी से इंजीनियर कोशिकाओं से बायोटिन उत्पादन पता लगाने के लिए अनुमति देता है। हालांकि, अप्रत्यक्ष नियंत्रण गतिशील रेंज के तंग बैंड बायोटिन सांद्रता में बड़े परिवर्तन (100 गुना) को महसूस करने के लिए अपनी क्षमता की सीमा। दोनों अप्रत्यक्ष और प्रत्यक्ष नियंत्रण योजनाओं के लिए गतिशील रेंज बदलकर अतिरिक्त इंजीनियरिंग की आवश्यकता होगी। हालांकि, अगर का पता लगाने सेल का उत्पादनडी बायोटिन एक मुद्दा है, 4.6 कदम में बायोटिन सतह पर तैरनेवाला के dilutions तैयारी अप्रत्यक्ष नियंत्रण योजना (चित्रा 5) के गतिशील रेंज को लक्षित करने के शोधकर्ता अनुमति चाहिए। हमने पाया है कि एक 1: सतह पर तैरनेवाला के 5 कमजोर पड़ने हमें प्रभावी ढंग से अप्रत्यक्ष नियंत्रण योजना के गतिशील रेंज लक्षित करने की अनुमति दी। इस कमजोर पड़ने रणनीति सीधे गतिशील रेंज संशोधित करने की आवश्यकता को कम करना चाहिए।

दो भाग, सेल सामग्री यहाँ प्रस्तुत प्रणाली इंजीनियर की अनुमति देता कोशिकाओं को एक क्रियाशील सतह की संरचना को संशोधित करने के लिए। गतिशील, जीवित कोशिकाओं उनकी रासायनिक परिवेश की व्याख्या एक आनुवंशिक प्रतिक्रिया का उत्पादन कर सकते हैं। इस आनुवंशिक इंजीनियरिंग प्रतिक्रिया बायोटिन उत्पादन बढ़ाने के द्वारा, हम को नियंत्रित करने और एक क्रियाशील सतह हेरफेर करने की क्षमता के साथ इंजीनियर जीवित कोशिकाओं प्रदान कर सकते हैं। प्रस्तुत प्रोटोकॉल का पालन करके, इंजीनियर कोशिकाओं के रूप में गतिशील सेंसर, पढ़ने, प्रसंस्करण में सक्षम कार्य करने में सक्षम हैं, और वें के आसपास की स्थिति की रिकॉर्डिंगक्रियाशील इंटरफेस के माध्यम से उन्हें। इस प्रौद्योगिकी आणविक चिकित्सा से पर्यावरण remediation के लिए analyte का पता लगाने को लेकर क्षेत्र को प्रभावित कर सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

लेखकों कृतज्ञता संयुक्त राज्य अमेरिका के वैज्ञानिक अनुसंधान की वायु सेना के कार्यालय से पुरस्कार FA9550-13-1-0108 से समर्थन स्वीकार करते हैं। लेखकों इसके अतिरिक्त संयुक्त राज्य अमेरिका के नौसेना अनुसंधान के कार्यालय से पुरस्कार N00014-15-1-2502 से समर्थन स्वीकार करते हैं, वर्जीनिया पॉलिटेक्निक संस्थान और राज्य विश्वविद्यालय, पर क्रिटिकल प्रौद्योगिकी और एप्लाइड साइंस के लिए संस्थान से और राष्ट्रीय विज्ञान फाउंडेशन ग्रेजुएट रिसर्च से धन फैलोशिप कार्यक्रम, पुरस्कार नंबर 1607310।

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics