De

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tarmen visar en arkitektur av repetitiva crypt strukturer som består av olika typer av epitelceller, lamina propria innehållande immunceller, och stroma. Alla dessa heterogena celler bidrar till tarm homeostas och delta i antimikrobiella värdförsvaret. Därför identifiera en ersättningsmodellen för att studera immunsvaret och antimikrobiell aktivitet av tarmen i en in vitro miljö är extremt utmanande. In vitro-studier med hjälp av odödliggjorda tarm epitel cellinjer eller ens primära kryptan organoida kultur inte representerar den exakta fysiologi normal tarmen och dess mikromiljö. Här, diskuterar vi en metod för odling mus kolonvävnad i en odlingsskål och hur detta ex vivo organkultursystem kan implementeras i studier relaterade till antimikrobiella värdförsvarssvar. I representativa experiment visade vi att kolon i organkultur uttrycka antimikrobiella peptider i response på exogent IL-1β och IL-18. Vidare, de antimikrobiella effektormolekyler som produceras av kolon vävnader i organodling döda effektivt Escherichia coli in vitro. Detta tillvägagångssätt kan därför användas för att dissekera den roll som pathogen- och varnings-associerade molekylära mönster och deras cellulära receptorer i regleringen av intestinal medfödda immunresponser och antimikrobiella värdförsvarssvar.

Introduction

Tarmen representerar ett dynamiskt system som verkar som en barriär för kommensala mikroorganismer, kämpar mot invaderande patogener, och reglerar den mikrobiella kompositionen en. De intestinala epitelceller, som består av enterocyter, bägarceller, panethceller och enteroendocrine celler, är de stora cellpopulationer som ger värdförsvarssvar mot tarmfloran. Gobletceller producerar muciner som skapar en demilitariserad zon på toppen av epitelskiktet 2. De panethceller och enterocyter producera antimikrobiella peptider, cytokiner och reaktiva syre- och kväve arter som utgör antimikrobiella värdförsvars svaren och bidrar till att forma tarmmikrobiella sammansättningen 3, 4. I tillägg till epitelceller, immunceller inkluderande makrofager, dendritiska celler, neutrofiler, naturliga mördarceller, lymfocyter och inna te lymfoidceller i lamina propria och submucosa spela en avgörande roll i tarmantimikrobiella värdförsvars svar genom att producera cytokiner, kemokiner och andra mediatorer 5 - 7. För att förstå hur det mukosala immunsystemet reglerar mikrobiota och ger skydd mot mikrobiell infektion, är det viktigt att beakta det komplexa samspelet mellan de heterogena cellpopulationer i tarmen. Emellertid är inte tillgängligt en in vitro-modell som omfattar alla de funktioner i tarmen. Därför molekylära studier på värdpatogen interaktion i tarmen är mycket utmanande.

Under de senaste åren har flera modellsystem som efterliknar delar av tarmslemhinnan har utvecklats för att undersöka patofysiologiska processer involverade i inflammatoriska tarmsjukdomar (IBD) och andra gastrointestinala störningar 8 -= "xref"> 14. Odödliggjorda intestinala epiteliala cellinjer används ofta för att studera epitelceller specifika svar. Men på grund av differentiell genexpression och funktion i immortaliserade celler, de data som erhålls från användningen av dessa celler inte ofta matcha med de som observerats i in vivo-studier. Intestinal crypt organoida kultur har nyligen dykt upp som ett potentiellt verktyg för att utvärdera effekten av tarmepitelet till olika stimuli 13. I detta system är crypt stamceller tillåts växa och utveckla en 3D organoid struktur. Medan den organoid odlingssystemet är mycket användbart för att studera många aspekter av tarmepitelet, betyder inte härma den komplexa interaktionen av immunceller, epitelceller och mikrobiella produkter. Ex vivo kultur av tarmvävnaden erbjuder en bättre representation av in vivo-värdförsvarssvar. I denna metod odlas i en cellkulturplatta vett en del av tarmenh lämpliga medier gör det möjligt för olika typer av cellpopulationer i tarmen vara metaboliskt aktiva under åtminstone 48 timmar. Sålunda kan användas en ex vivo odling av organet för att mäta uttrycket av antimikrobiella gener och värdförsvars responser i tarmen till en särskild stimulus.

Undersökare har använt ex vivo organkultursystem för att studera värdförsvarssvar mot mikrobiell infektion i tarmen 15-21. Vi antog nyligen organkultursystem för att studera rollen av inflammasome i antimikrobiella värdförsvars svar i mus kolon 22. Den inflammasome är en molekylär plattform för aktivering av kaspas-1, som krävs för produktion av mognat IL-1β och IL-18. Vi visade att IL-1β och IL-18 inducerar antimikrobiella peptider som effektivt dödar commensal pathobionts såsom E. coli E. coli börda i inflammasome defekta mus kolon 22. Detta system kan därför användas för att studera rollen av mönsterigenkänningsreceptorer (PRRS) och andra medfödda immunmolekyler i intestinala antimikrobiella värdförsvarssvar samt patogenes av tarmstörningar såsom inflammatorisk tarmsjukdom (IBD) och kolorektal cancer (CRC). Det finns mer än 200 IBD känslighetsgener, och mutationer i många av dessa gener är associerade med förändrad mikrobiella kompositionen i tarmen. Det är av stor klinisk betydelse för att bestämma den exakta mekanismen genom vilken IBD-resistensgener reglerar tarmfloran. Det övergripande målet med denna metod är att införa en grundläggande protokoll för ex vivo kolon organkultur och visa hur denna kultur metod kan användas för att studera antimikrobiella värdförsvars svar i tarmen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla experiment som beskrivs här utfördes med användning av 6-8 veckor gamla manliga vildtypen (C57BL6 / J) möss hölls i en specifik patogen (SPF) anläggning på Animal Resource Center (ARC), UT Southwestern Medical Center. Alla studier har godkänts av Institutional Animal Care och användning kommittén (IACUC) och genomfördes i enlighet med IACUC riktlinjer och National Institutes of Health Guide för skötsel och användning av försöksdjur.

1. Insamling och Beredning av Colon

  1. Euthanize möss med CO 2 kvävning följt av cervikal dislokation.
  2. Spray möss med 70% etanol och stift lemmar till en pinning styrelse att hålla musen ryggsidan nedåt på bordet.
  3. Med hjälp av försteriliserade dissekera sax och pincett, gör en mittlinjen snitt i bukhinnan i buken. Öppna buken genom vikning av bukhinnan med pincett.
  4. Ta bort tarmen från bukhålan with dissekera pincett och sax. Separera kolon från tunntarmen genom att skära i botten av blindtarmen och den andra änden vid rektum.
  5. Placera kolon i en steril petriskål innehållande iskall PBS. Spola innehållet i lumen av kolonen med iskall PBS med användning av en 20 ml spruta som innehar en 20 G nål eller en oral sondmatning nålen tills pallen i lumen av kolonen tas fullständigt bort.
  6. Skär kolon med en sax i längdled. Tvätta kolon genom kraftig skakning i iskall PBS i en steril petriskål.
  7. Skär kolonvävnad i bitar ca 1 cm lång med användning av en steril skalpell eller sax.
  8. Notera vikten av kolon bitar.
    OBS: Alla steg i 1 § kan utföras antingen insidan eller utsidan av ett biologiskt säkerhetsskåp. När kolon är redo för kultur, måste alla steg utföras i ett biologiskt säkerhetsskåp för att upprätthålla sterilitet.

2. Colon Orgen kultur

  1. Placera ett cellfilter (100 | im) på en 6-brunnars cellodlingsplatta. Överföra alla kolon bitar som samlats in från en mus in i cellen sil.
  2. Tillsätt 5 ml DMEM / F12-medium innehållande 5% FBS, penicillin-streptomycin (1x), och Gentamycin (20 | j, g / ml). Helt täcka kolon bitar med medierna.
  3. Inkubera i 2 h vid 37 ° C i en inkubator med 5% CO2 och 95% luft.
  4. Lyft cellfilter och aspirera media.
  5. Placera cell sil tillbaka på brunnen och tillsätt 5 ml färskt medium utan antibiotika. Lyft cellfilter och aspirera media.
  6. Upprepa ovanstående tvättsteget (steg 2,5) två gånger till (totalt 3x) för att avlägsna alla de kvarvarande antibiotika.
  7. Överför kolon bitar från en enstaka cellfilter in i en enda brunn av en steril 12-brunnars cellodlingsplatta.
  8. Lägga DMEM / F12-medium innehållande 5% FBS (utan några antibiotika). Justera volymen av mediet med Weigsht av kolon bitar, t.ex., en ml medium under 100 mg vävnad. Inkubera i 12 h vid 37 ° C i en inkubator injicera 5% CO2 och 95% luft.
  9. Samla odlingssupernatanten i ett sterilt 1,5 ml rör.
  10. Centrifugera vid 12.000 xg vid 4 ° C under 5 min. Separera supematanten till ett nytt 1,5 ml rör för användning i de bakteriedödande analysen och / eller andra immunanalyser. Supernatanten kan lagras vid -80 ° C fram till analysen.
  11. Samla kolon bitar i ett rör för RNA-isolering.

3. E. coli Killing analysen

  1. Inokulera E. coli i 5 ml Luria-Bertani (LB) buljong i ett 15 ml rör och inkubera vid 37 ° C med skakning vid 200 rpm över natten. Hålla locket på odlingsrör något lös.
  2. Centrifugera bakteriekulturen röret vid 1200 xg under 10 min vid 4 ° C. Avlägsna supernatanten och suspendera den bakteriella pelleten i 5 ml iskall PBS.
  3. Överför 1 ml av bacterial suspension i en kyvett och mått OD vid 600 nm. Använd PBS som en blank.
  4. Beräkna kolonibildande enhet (CFU) med användning av en i förväg bestämd standardkurva. Här antar att en OD = 2 x 10 9 cfu / ml (ungefär).
  5. Späd bakteriesuspensionen för att göra mäldsuspensionen 1 x 10 5 cfu / ml.
  6. Överföra kolonorgankultur supernatant (500 | il / brunn) som insamlats i avsnitt 2,10 i duplikatbrunnar av en 24-brunnars cellodlingsplatta.
  7. Tillsätt 10 mikroliter E. coli kultur (1000 cfu) i en brunn innehållande 500 mikroliter kolon organ odlingssupernatant. Lämna den andra bra utan någon E. coli inokulering för att bekräfta att kolonorgankultur supernatant inte innehåller någon förorening.
  8. Inkubera samma antal bakterier (1000 cfu) i odlingsmediet (DMEM / F12 plus 5% FBS) utan några antibiotika som en kontroll.
  9. Inkubera vid 37 ° C under 1 h.
  10. Placera 50 mikroliter av varje prov drop-wise på MacConkey agarplattor. Inkubera MacConkey agarplattor vid 37 ° C över natten.
  11. Räkna antalet kolonier och beräkna cfu / ml.

4. Effekten av yttre och inre faktorer på Colonic Antimicrobial värdförsvar Responses

OBS: Den antimikrobiella dödande analysen som beskrivs här kan antas att undersöka effekten av patogener associerade molekylära mönster (PAMPs) och cytokiner på bakteriedödande aktivitet av organ odlingssupernatant. Ett exempel på sådant experiment med användning av IL-1β och IL-18 beskrivs nedan.

  1. Samla kolon från möss som beskrivs i avsnitt 1.
  2. Placera kolon på en steril pappershandduk. Skär kolon longitudinellt i tre delar med hjälp av en sax (Figur 2).
  3. Tvätta varje del av tjocktarmen i iskall PBS som beskrivs i avsnitt 1.
  4. Skär varje del av tjocktarmen i små bitar och väger aseptiskt. Överför bitar av varje delav tjocktarmen i tre separata cell silar (100 pm) placerade på tre brunnar i en 6-brunnars cellodlingsplatta (Figur 2).
  5. Tillsätt 2 ml DMEM / F12-medium innehållande 5% FBS, penicillin-streptomycin (1x), och Gentamycin (20 | j, g / ml).
  6. Inkubera i 2 h vid 37 ° C i en inkubator injicera 5% CO2 och 95% luft.
  7. Tvätta kolon bitar som beskrivs i 2,4-2,6. Överför kolon bitar av en enda cell sil i en enda brunn av en steril 12-brunnars cellodlingsplatta. De tre brunnar innehållande tre delar av tjocktarmen från en enda mus bör betecknas som obehandlade, IL-1β, och IL-18 (Figur 2).
  8. Lägga DMEM / F12-medium innehållande 5% FBS (utan några antibiotika). Justera volymen av mediet med vikten av kolon bitar, t.ex., en ml medium för 100 mg vävnad.
  9. Stimulera kolonorganodling med IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) under 12 h. Den obehandlade kolon organkultur tjänar som kontroll.
  10. Efter 12 h inkubation vid 37 ° C i en inkubator injicera 5% CO2 och 95% luft, samla odlingssupernatanten i ett sterilt 1,5 ml rör.
  11. Överföra 500 mikroliter odlingssupernatant i dubbla brunnar i en 24-brunnsplatta.
  12. Ympa E. coli (1000 cfu) i kolon organ odlingssupernatant som beskrivs i avsnitt 3. För varje tillstånd, ympa E. coli i en enda brunn. Den andra brunn innehållande samma organ odlingssupernatant utan E. coli kommer att fungera som en kontroll för bakteriell kontamination.
  13. Inkubera samma mängd bakterier i odlingsmedia utan några antibiotika som en kontroll.
  14. Inkubera vid 37 ° C under 1 h.
  15. Placera 50 mikroliter av varje prov droppvis på MacConkey agarplattor. Inkubera MacConkey agarplattor för över natt vid 37 ° C.
  16. Räkna antalet kolonier och beräkna cfu / ml (Figur 4).
e_title "> 5. Mätning av uttrycket av antimikrobiella gener

  1. Efter inkubation över natten (12 h) av kolon organkultur som beskrivs i avsnitt 2 och 4, tvätta kolon bitar med 2 ml iskall PBS (2x).
  2. Samla kolon bitar i en 2 ml RNas / DNas fria skruvkork rör. Placera rören på is.
  3. Tillsätt 1 ml kommersiell Trizol-reagens och lyserande matrispärlor in i röret.
  4. Lysera vävnaden med användning av en automatiserad vävnadshomogenisator.
  5. Samla vävnaden lysat till ett nytt mikrocentrifugrör.
  6. Isolera RNA genom att använda standardprotokoll.
  7. Mäta RNA-koncentration.
  8. Späd RNA på lämpligt sätt med avjoniserat vatten och använda 500 ng RNA för att syntetisera cDNA.
  9. Använda cDNA för realtids-RT-PCR-analys av målinriktade antimikrobiella gener, cytokiner, kemokiner och andra gener av intresse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En representativ bild av kolon i organodling visas i figur 1. Kolon bitar i kulturen fortfarande metaboliskt och fysiologiskt aktiv. De svarar effektivt exogena stimuli till odlingsmedia. En schematisk arbetsflöde av beredningen av kolon vävnad för ex vivo kultur och stimulering med exogena stimuli, t ex IL-1β och IL-18, visas i figur 2. De representativa data i figur 3 visar att kolon i organkultur uttrycka antimikrobiella peptider såsom β-defensin 2 (BD2), Reg3γ, S100a8, S100A9, och iNOS som svar på IL-1β och IL-18.

De mediatorer som frisätts av de kolon implantat uppvisar en antimikrobiell dödande effekt som demonstreras av signifikant minskad tillväxt av E. coli inkuberas med organkultur supernatant ( 4B). Såsom E. coli dödande aktivitet är vidare förstärkt av stimulering av IL-1β och IL-18 (fig 4A och 4B). Kolon organ odlingssupernatanter inkuberade utan E. coli visar ingen bakterietillväxt efter odling på MacConkey agar (figurerna 4C och 4D). Dessa resultat antyder vidare att inflammasome spelar en viktig roll i tarm antimikrobiell värdförsvaret.

Sammantaget de data som presenteras här tyder på att ex vivo kolon organodling är en mycket användbar teknik för att studera tarmantimikrobiella immunsvar in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
β-defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabell 1: Förteckning över mus primrar för realtids-PCR.


Figur 1: representativ bild av mus kolon bitar i odlingen. (A) Inkubation av kolon bitar på ett cellfilter (100 | im) placerades på en 6-brunnsplatta. Kolon bitar är nedsänkta i 2 ml odlingsmedia kompletterat med antibiotika. (B) Efter 2 h inkubation kolon bitar överförs i brunnen av en ny 12-brunnars cellkulturplatta innehållande antibiotika-free medium. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2: Schematisk presentation av stegen för beredning av kolon vävnader och ex vivo stimulering med IL-1β och IL-18. Kolon från en mus är längs långskepps dissekerades i tre delar. Varje del skars i små bitar och vägdes. Kolon bitar från varje sektion av tjocktarmen överförs till cell silar placerade på brunnarna i en 6-brunnars platta innehållande 2 ml DMEM / F12-medium plus 5% FBS och antibiotika. Efter en 2 h inkubation kolon bitar från en enstaka cellfilter överförs till en enda brunn i en 12-brunnars cellodlingsplatta. DMEM / F12 plus 5% FBS (inga antibiotika) tillsätts till varje brunn och volymen av mediet justeras i enlighet med vikten av vävnaden (1 ml media för 100 mg vävnad). Kolon vävnader stimuleras med IL-1β (20 ng / ml) och IL-18 (20 ng / ml) under 12 h. Odlingssupernatanter centrifugeras och används för E. coli dödande analysen och / eller andra immunanalyser. Kolon vävnad samlas i kommersiell trypsin reagens för RNA-isolering och efterföljande analyser av antimikrobiell genexpression genom realtids-PCR..jpg "target =" _ blank "> Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3: Mouse kolon vävnader uttrycker cytokiner och antimikrobiella peptider som svar på IL-1β eller IL-18 under ex vivo kultur. Kolon organkulturer stimulerades med IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) under 12 h. Uttrycket av BD2, Reg3γ, S100a8, S100A9, och iNOS mättes genom realtids-RT-PCR (tabell 1). Data representerar medelvärden ± SD; * P <0,05, ** p <0,01. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4: Supernatant av mus kolon organ kulture uppvisar bakteriedödande aktivitet. Kolon stycken odlades ex vivo i närvaro eller frånvaro av IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) under 12 h. 500 fil av kultursupernatanterna inkuberades med E. coli (1000 cfu) under 1 timme vid 37 ° C. Kolonorgankultur supernatant utan E. coli inkuberades också som en kontroll. Efter 1 h inkubation tillsattes 50 | il av varje prov placerades droppvis på MacConkey-agarplattor och inkuberades vid 37 ° C över natten. (A) Bild av E. coli kolonier på MacConkey agar visar antimikrobiell aktivitet av kolonorgankultur. (B) E. coli som visar dödande effektivitet av IL-1β- och IL-18-behandlade kolon organkultur supernatant. (C) Bild på MacConkey agarplatta visar ingen bakterietillväxt i kolon organkultur odlades utan E. coli. (D) Inga E. coli kolonier identifierades i kolon organ culture inkuberade utan E. coli, vilket tyder på avsaknad av kontaminerande bakterier i provet. Data representerar medelvärden ± SD; ** P <0,01, *** p <0,001. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tarmepitelceller är mycket känsliga när det gäller deras tillväxtkrav och därför svår att kulturen. Epitelcellerna isolerats av EDTA-behandling överlever inte i konventionella cellodlingsmedia såsom DMEM 8. Därför värd-patogen interaktionsstudier med hjälp av isolerade crypt eller primära epitelceller är mycket utmanande. Nyligen Sato et al. beskrev en krypta organoid kultursystem som är mycket lovande och användbar för studier relaterade till tarm patofysiologi 13. Medan organoids representerar många funktioner i tarmen kryptan, det finns farhågor om huruvida de immunsvar hos organoid celler, som odlas i en steril miljö, sammanfatta svaren från intestinala epitelceller in vivo. De exakta tekniker som krävs för isolering och odling av epitelceller stamceller och kravet på dyra reagens för odling av organoids förhindra maNY laboratorier från att dra nytta av detta system. Även om användningen av ex vivo organkultur är inte ett alternativ till organoid kultur, erbjuder detta system en enkel och billig metod för att studera de antimikrobiella svar tarmepitelet.

Den största fördelen med denna teknik är att den vävnadsarkitektur av tarmen bibehålls medan odling i rätter. Vi observerade att kolon vävnader är fysiologiskt aktiva under åtminstone 24 timmar efter deras kultur. Under odlingen i tjocktarmen, de colonic epithelial celler svarar på exogena stimuli såsom mätt genom uttryck av cytokiner och antimikrobiella peptider. Viabiliteten hos epitelceller i intakt vävnad kan förbättras ytterligare genom tillsats av lämpliga tillväxtfaktorer och inhibitorer av celldöd i odlingsmediet. Tidigare rapporter tyder på att normal human kolonvävnad organ kunde upprätthållas ex vivo i flera dagar 8 sup>, 23, 24.

Protokollet för ex vivo kultur av mus kolon organ kan ha många tillämpningar inom studier relaterade till antimikrobiella immunsvar i tarmepitelet. Patogener och deras PAMPs erkänns av PRRs såsom Toll-liknande receptorer (TLR) och NOD-liknande receptorer (NLRs) som förekommer i epitelceller och immunceller. Defekt uttryck och funktion av många TLR och NLRs förknippas med känslighet för IBD, kolorektal tumörbildning och bakterieinfektioner. Eftersom immortaliserade epitelcellinjer inte representerar alla funktioner i tarm nisch, är ex vivo kolon organkultur en mycket användbar experimentell verktyg. Med användning av detta system kan vi undersöka effekten av olika PAMPs eller stimuli på induktionen av antimikrobiella effektormolekyler i tarmepitelceller. I den representativa experiment visade vi att cytokiner gillarIL-1β och IL-18 trigger uttrycket av antimikrobiella peptider (Figur 3). Vi visar också här att antimikrobiella peptider som produceras av kolonvävnad effektivt kan döda E. coli (Figur 4). Dessa tekniker kan tillämpas för att testa påverkan av lipopolysackarid (LPS), peptidoglykan (PGN), muramyldipeptid (MDP), och andra PAMPs i antimikrobiella värdförsvars responser i tarmen.

Vi har något modifierad kolon organkultur protokoll som beskrivits tidigare 12, 16, 20, 25. Vi odlade kolon i två faser. Först, inkuberas vi kolon vävnad i antibiotika innehållande medium under 2 h. Vi tog bort då antibiotika med upprepad tvättning av kolon bitar följt av inkubation med antibiotika fria medier. Sålunda kultursupernatanten erhållen från övernattskultur av denkolon uppvisar endast effekten av utsöndrade antimikrobiella peptider när de inkuberas med E. coli. Detta tillvägagångssätt kan användas för att se den bakteriedödande effekten av tjocktarmen eller tarm härledda antimikrobiella peptider på eventuella bakterier av intresse. En lämplig selektiv agar medier bör användas för att odla bakterierna.

Liksom de flesta tekniker, finns det begränsningar i ex vivo organkultursystem. Första, till skillnad från cellodling eller organoid kultur, organen inte växa och proliferera och därför inte kan utvidgas. För det andra, intestinala epitelceller är mycket känsliga och de dör relativt snabbt utan ytterligare tillväxtfaktorer och apoptoshämmare, vilka används för crypt organoid kultur. För det tredje är immunsvaret observeras från organodling en kollektiv svaret hos olika typer av cellpopulationer. Därför kan inte bedömas roll individuell celltyp i uttrycket av antimikrobiella och effektor gener. additionally, till skillnad från i cellinjer och organoid kultur kan expressionen av antimikrobiella peptider och andra effektormolekyler i kolon varierar från mus till mus av samma genetiska bakgrund.

Sammanfattningsvis beskriver vi här ett enkelt protokoll för ex vivo colonic organkultur som är mycket användbart för att studera intestinala antimikrobiella immunsvar. Detta tillvägagångssätt kan användas för att testa rollen av olika medfödda immun gener i uttrycket av antimikrobiella peptider genom att odla kolon från genetiska muterade möss av intresse. Vidare kan detta protokoll anpassas för användning i kliniska studier för att undersöka tarmantimikrobiella svaren från IBD-patienter genom att utföra organodling av kolon biopsiprov.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Detta arbete stöddes av medel från Crohns och kolit Foundation of America (CCFA, 3711) Cancer Prevention och Forskningsinstitut Texas (CPRIT, RP160169), och UT Southwestern Medical Center ges till MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats