مرنا إنتيراكتوم التقاط من بروتوبلاستس النبات

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

هنا، نقدم بروتوكول الالتقاط إنتيراكتوم تطبيقها على أرابيدوبسيس ثاليانا أوراق ميسوفيل ورقة بروتوبلاستس. هذه الطريقة تعتمد بشكل حاسم على في الجسم الحي الأشعة فوق البنفسجية يشابك ويسمح لعزل وتحديد البروتينات مرنا مرتبط النبات من بيئة فسيولوجية.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

البروتينات ملزمة رنا (ربس) تحديد مصائر رنا. وهم يشاركون في جميع مسارات بيوانيسيس الحمض النووي الريبي ويساهم بشكل خاص في تنظيم الجينات بعد النسخي (بتغر) من رنا رسول (مرناس). في السنوات القليلة الماضية، تم عزل عدد من بروتيوم مرنا ملزمة من الخميرة وخلايا الثدييات خطوط بنجاح من خلال استخدام طريقة جديدة تسمى "مرنا التقاط إنتيراكتوم"، والذي يسمح لتحديد البروتينات مرنا ملزمة (مربس) مباشرة من بيئة فسيولوجية. وتتكون هذه الطريقة من في الجسم الحي فوق البنفسجية (أوف) يشابك، سحب إلى أسفل وتنقية المجمعات ريبونوكلوبروتين رسول (مرنبس) من قبل حبات صغيرة (دت)، وتحديد اللاحقة للبروتينات كروسلينكد بواسطة مطياف الكتلة (مس). في الآونة الأخيرة، من خلال تطبيق نفس الطريقة، وقد تم الإبلاغ عن العديد من النباتات مرنا مرتبط بروتيوم في وقت واحد من مختلف مصادر الأنسجة أرابيدوبسيس : شتلات عتيقة،أوراق بروتينات الميزوفيل الورقية، والخلايا الجذرية المستزرعة. هنا، نقدم الأمثل مرنا طريقة التفاعل إنتيراكوموم ل أرابيدوبسيس ثاليانا أوراق بروتوبلاستس ميسوفيل ورقة، وهو نوع الخلية التي تعمل كأداة تنوعا للتجارب التي تشمل المقايسات الخلوية المختلفة. الشروط للحصول على أفضل محصول البروتين تشمل كمية من الأنسجة بدءا ومدة أشعة فوق البنفسجية. في بروتيوم مرنا ملزمة التي تم الحصول عليها من تجربة متوسطة النطاق (10 7 خلايا)، لاحظت ربس أن تم العثور على قدرة ملزم رنا أن تكون ممثلة تمثيلا زائدا، وتم تحديد العديد من الممارسات التجارية التقييدية الجديدة. ويمكن توسيع نطاق التجربة (10 9 خلايا)، ويمكن تطبيق الطريقة المثلى على أنواع الخلايا النباتية الأخرى والأنواع لعزل واسع، الكتالوج، ومقارنة بروتيوم مرنا المرتبطة في النباتات.

Introduction

تستخدم اليوكاريوتس مسارات تنظيمية متعددة ل رنا بيوجينيسيس للحفاظ على العمليات البيولوجية الخلوية. من بين الأنواع المعروفة من الحمض النووي الريبي، مرنا متنوعة جدا ويحمل القدرة على الترميز من البروتينات و إسوفورمز 1 .The بتغر مسار يوجه مصير ما قبل مرناس 2 ، 3 . الممارسات التجارية التقييدية من مختلف الأسر الجينات السيطرة على تنظيم الحمض النووي الريبي، وفي بتغر، مربس محددة دليل مرناس من خلال التفاعلات المادية المباشرة، تشكيل مرنبس وظيفية. لذلك، تحديد و مربس وصفها و مرنبس أمر بالغ الأهمية لفهم تنظيم استقلاب مرنا الخلوي 2. على مدى العقود الثلاثة الماضية، ومختلف في الطرق المختبرية - بما في ذلك الحمض النووي الريبي التحولات التحول (ريمزا) المقايسات، والتطور المنهجي للروابط بواسطة المقايسات الإثراء الأسي (سيليكس) استنادا إلى البنى المستمدة من المكتبة، رنا بيند-n-سيق (ربنز)، راديولبلد أو الكميةومضامين ملزمة الحمض النووي الريبي مضان، والبلورات بالأشعة السينية، وطيفي الرنين المغناطيسي النووي 4 ، 5 ، 6 ، 7 ، 8 ، 9 - تم تطبيقها على نطاق واسع لدراسات الممارسات التجارية التقييدية، وذلك أساسا من خلايا الثدييات. ويمكن البحث عن نتائج هذه الدراسات من الممارسات التجارية التقييدية الثدييات عن طريق قاعدة بيانات البروتين ملزم رنا (رببدب)، الذي يجمع الملاحظات المنشورة 10 .

على الرغم من أن هذه النهج في المختبر هي أدوات قوية، فإنها تحدد الحواف الحمض النووي الريبي ملزمة من تجمع الحمض النووي الريبي معين من تسلسل، وبالتالي فهي محدودة في قدرتها على اكتشاف رنا المستهدفة الجديدة. وينطبق الشيء نفسه على الاستراتيجيات الحسابية للتنبؤ بالممارسات التجارية التقييدية على نطاق الجينوم، والتي تقوم على حفظ تسلسل البروتين والبنية 15 . للتغلب على هذا، طريقة تجريبية جديدة هاتم تأسيسها التي تسمح لتحديد زخارف الحمض النووي الريبي أن تتفاعل ربب الفائدة مع، وكذلك لتحديد الموقع الدقيق للالتزام. هذه الطريقة، ودعا "يشابك ومناعي" (كليب)، ويتألف من في الجسم الحي الأشعة فوق البنفسجية يشابها تليها مناعي 11 . وقد أظهرت الدراسات المبكرة أن فوتواكتيفاتيون من الحمض النووي والنيوكليوتيدات الحمض النووي الريبي يمكن أن تحدث في موجات الأشعة فوق البنفسجية الإثارة أكبر من 245 نانومتر. التفاعل من خلال ثيميدين يبدو أن يفضل (رتبة في الترتيب من انخفاض النشاط الضوئي: دت ≥ دك> رو> رك، دا، دغ) 12 . باستخدام ضوء الأشعة فوق البنفسجية مع طول موجة من 254 نانومتر (أوف-C)، لوحظ أن الروابط التساهمية بين النيوكليوتيدات الحمض النووي الريبي ومخلفات البروتين يتم إنشاؤها عندما يكون في مجموعة من عدد قليل من أنغسترومز (Å). وبالتالي تسمى هذه الظاهرة "الصفر طول" تشابك رنا و ربب. هذا يمكن أن يتبعها بروسيس التنقية الصارمة ديور ويث ليتل باكغروند 13 ، 14 .

وهناك استراتيجية مكملة ل كليب هو الجمع بين في الجسم الحي الأشعة فوق البنفسجية يشابك مع تحديد البروتين لوصف المشهد من الممارسات التجارية التقييدية. وقد تم عزل عدد من هذه البروتينات المرتبطة مرنا الجينوم على نطاق واسع من خلايا الخميرة والخلايا الجذعية الجنينية (إيسس)، وخلايا الخلايا البشرية ( أي HEK293 و هيلا) باستخدام هذا النهج التجريبي الرواية، ودعا "مرنا إنتيراكتوم التقاط" 18 ، 19 ، 20 ، 21 . وتتكون هذه الطريقة من في الجسم الحي الأشعة فوق البنفسجية يشابها تليها تنقية مرنب والبروتيوميات المستندة إلى مس. من خلال تطبيق هذه الاستراتيجية، تم اكتشاف العديد من رواية "مونلايتينغ" ربس التي تحتوي على ربد غير متعارف عليها، وأصبح من الواضح أن المزيد من البروتينات لديها قدرات ملزمة رنا مما كان مفترضا سابقا"> 15 ، 16 ، 17. استخدام هذا الأسلوب يسمح للتطبيقات الجديدة والقدرة على الإجابة على الأسئلة البيولوجية الجديدة عند التحقيق الممارسات التجارية على سبيل المثال، على سبيل المثال، وقد بحثت دراسة حديثة لحفظ بروتيوم مرنا ملزمة (ربب الأساسية بروتيوم) بين الخميرة والخلايا البشرية 22 .

وقد وجد بالفعل أن الممارسات التجارية التقييدية النباتية تشارك في النمو والتنمية (على سبيل المثال ، في التنظيم اللاحق للوقت المزهر، والساعة البيولوجية، والتعبير الجيني في الميتوكوندريا والبلاستيك) 24 و 25 و 26 و 27 و 28 و 29 . وعلاوة على ذلك، يعتقد أنها تؤدي وظائف في العمليات الخلوية التي تستجيب للإجهاد اللاأحيائي (على سبيل المثال، البرد، الجفاف، سالينيتي، و أبسيسيك أسيد (أبا)) 31 ، 32 ، 33 ، 34 . هناك أكثر من 200 الجينات ربب المتوقع في الجينوم أرابيدوبسيس ثاليانا ، استنادا إلى رنا الاعتراف عزر (رم) و K التماثل (خ) تسلسل مجال المجال. في الأرز، لوحظ ما يقرب من 250 ، 35 ، 36 . ومن الجدير بالذكر أن العديد من التنبؤات المحتوية على البروتينات تبدو فريدة من نوعها للنباتات (على سبيل المثال، لا أورثولوغ ميتازوان إلى ما يقرب من 50٪ من اربيدوبسيس تنبؤات ربس التي تحتوي على مجال رم) 35 ، مما يشير إلى أن العديد قد تخدم وظائف جديدة. ولا تزال وظائف معظم الممارسات التجارية التقييدية المتوقعة غير معهودة 23 .

عزل بروتيوم مرنا المرتبطة من شتلات أرابيدوبسيس أتيولاتد، الأنسجة ورقة، الخلايا الجذرية مثقف، و بروتوبلاستس ورقة ميسوفيل من خلال استخداموقد تم الإبلاغ عن مرنا تفاعلية التقاط مؤخرا 38 ، 39 . وتدل هذه الدراسات على الإمكانية القوية للفهرسة المنهجية للممارسات التجارية التقييدية الوظيفية في النباتات في المستقبل القريب. هنا، نقدم بروتوكول لالتقاط مرنا التفاعلي من بروتوبلاستس النبات ( أي الخلايا دون جدران الخلايا). أرابيدوبسيس ثاليانا ليفس ميسوفيل بروتوبلاستس هي النوع الرئيسي من الخلايا الورقية. بروتوبلاستس معزولة تسمح الوصول الأمثل للضوء الأشعة فوق البنفسجية إلى الخلايا. ويمكن استخدام هذا النوع من الخلايا في المقايسات التي تعبر عن عابرة البروتينات لتوصيف وظيفي 40 ، 41 . وعلاوة على ذلك، تم تطبيق بروتوبلاستينغ على العديد من أنواع الخلايا النباتية الأخرى والأنواع 42 ، 43 ، 44 (على سبيل المثال، بيترسون وآخرون ، 2009؛ بارغمان وبيرنبوم، 2010؛ وهونغ وآخرون ، 2012).

<p كلاس = "jove_content"> تتضمن الطريقة ما مجموعه 11 خطوة ( الشكل 1A ). أرابيدوبسيس أوراق بروتوبلاستس ميسوفيل معزولة أولا (الخطوة 1)، وبالتالي الأشعة فوق البنفسجية المشع لتشكيل مرنبس كروسلينكد (الخطوة 2). عندما يتم تحلل بروتوبلاستس تحت ظروف تغيير طبيعة (الخطوة 3)، يتم الافراج عن مرنبس كروسلينكد في تحلل / العازلة ملزمة وسحبت من قبل أوليغو د (T) 25 الخرز (الخطوة 4). بعد عدة جولات من يغسل صارمة، يتم تنقية مرنبس وتحليلها. يتم هضم الببتيدات التشويه والتحريف من مربس بواسطة بروتين K قبل تنقية مرناس كروسلينكد ويتم التحقق من جودة الحمض النووي الريبي بواسطة كرت-ير (الخطوات 5 و 6). بعد العلاج ريبونوكلياز وتركيز البروتين (الخطوة 7)، يتم التحكم في جودة البروتين بواسطة سدز بولي أكريلاميد هلام الكهربائي (سدز-بادج) والفضة تلطيخ (الخطوة 8). الفرق في أنماط الفرقة البروتين يمكن بسهولة أن تصور بين عينة كروسلينكد (كل) وعينة غير كروسلينكد (غير كل؛عينة السيطرة السلبية من بروتوبلاستس التي لا تتعرض للأشعة فوق البنفسجية التشعيع). ويتحقق تحديد البروتينات من خلال البروتيوميات التي تستند إلى مس. يتم فصل البروتينات من عينة كل من هلام بولي أكريلاميد الكهربائي واحد الأبعاد (1D-بادج) لإزالة التلوث الخلفية المحتملة، هي "في هلام هضمها" إلى الببتيدات قصيرة باستخدام التربسين، وتنقيتها (الخطوة 9). نانو عكس المرحلة اللوني السائل إلى جانب مطياف الكتلة (نانو-لك-مس) يسمح لتحديد كمية من البروتينات نهائية في بروتيوم مرنا ملزمة (الخطوة 10). وأخيرا، يتم وصف المربس المحددة وفهرسة باستخدام التحليل المعلوماتية الحيوية (الخطوة 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. أرابيدوبسيس ليف ميسوفيل بروتوبلاست العزلة

ملاحظة: بروتوبلاستس نبات أرابيدوبسيس ميسوفيل معزولة أساسا كما وصفها يو وآخرون ، 2007، مع العديد من التعديلات 40 .

  1. نمو النباتات
    1. نقع ما يقرب من 200 أرابيدوبسيس ثاليانا كول-0 البذور النمط الايكولوجي في الماء المعقم لمدة 2 أيام عند 4 درجات مئوية في الظلام لطبقية.
      ملاحظة: هذا العدد من البذور يكفي لعينة واحدة غير كل عينة واحدة كل (انظر الخطوة 1.3).
    2. إعداد الأواني مع 50٪ ( الخامس / الخامس ) خليط من التربة والفيرميكوليت ونقع الأواني بالماء المقطر في علبة لترطيب التربة.
    3. زرع وتوزيع البذور الطبقية على التربة الرطبة. لا تغطي البذور مع التربة إضافية لأن بذور أرابيدوبسيس تحتاج إلى ضوء لإنبات.
      ملاحظة: ظروف نمو النبات هي 12 ساعة ضوء / 12 ساعة في الظلام دورة في 23 درجة مئوية،مع شدة الضوء من 100 ميكرومول م -2 ث -1 ، في غرفة نمو لمدة 5 أسابيع قبل المزهرة. ويمكن أيضا أن تستخدم النباتات 4 أسابيع من العمر 40 .
      ملاحظة: جميع المواد الموصوفة والكواشف من الخطوة 1.2.1 إلى الخطوة 3.2.3 هي لعينتين ( أي عينة واحدة غير كل (عينة السيطرة التي لا تتعرض للأشعة فوق البنفسجية-C التشعيع) وعينة واحدة كل (البحث العينة التي تتعرض للأشعة فوق البنفسجية- C التشعيع)).
  2. إعداد حل إنزيم متساوي التوتر
    1. جعل 80 مل من محلول انزيم متساوي التوتر الأساسي (400 ملي مانيتول، 20 ملي بوكل، و 20 ملي العازلة ميس (الرقم الهيدروجيني 5.7)) وعلى الفور تسخين الحل في حاضنة 60 درجة مئوية لمدة 10 دقيقة.
    2. إضافة 1.2 غرام من سيلولاز R10 ( ث / V 1.5٪) و 0.32 غرام من ماكيروزيمي R10 ( ث / V 0.4٪) مسحوق إلى حل الإنزيم متساوي التوتر الأساسي الدافئ.
    3. تقديم بعناية مسحوق الانزيم إلى حل عن طريق تطبيق التحريك لطيف. موسيقى الرابتسخين الخمول الحل في حاضنة 60 درجة مئوية لمدة 10 دقيقة حتى أن حل الإنزيم هو البني الفاتح واضحة.
    4. تبريد الحل على الجليد لمدة 3 دقائق وإضافة 800 ميكرولتر من 1 M كاكل 2 و 800 ميكرولتر من 10٪ ( ث / ت ) بسا إلى الحل.
    5. تجانس الحل عن طريق بيبتينغ والتصفية من خلال مرشح 0.22 ميكرون. قسامة هذا الحل انزيم متساوي التوتر النهائي إلى اثنين من أطباق بتري على نطاق واسع (150 ملم × 20 ملم).
  3. إعداد أرابيدوبسيس شرائط ورقة روزيت
    ملاحظة: ينصح 150 أوراق لكل طبق بتري لعينة واحدة غير كل أو عينة كل واحد.
    1. اختيار وخفض ما مجموعه 300 توسعت بشكل كامل 2 ند - أو 3 أردي -pair صحيح يترك (متوسط: 3 - 4 في روزيت) إلى 0.5- إلى 1 ملم شرائط ورقة باستخدام رازوربليد جديدة وحادة.
    2. نقل وغمر شرائط على الفور في حل انزيم متساوي التوتر.
      ملاحظة: لتجنب أي اتصال مع الضوء، دائما تغطية رانه أطباق بتري مع رقائق الألومنيوم. لا سحق الأوراق. تأكد من أن جميع الشرائط مغمورة في الحل ولا تطفو على السطح.
  4. عزل أرابيدوبسيس ورقة الأوراق ميسوفيل
    1. وضع رقائق الألومنيوم بتري المغطاة أطباق في فراغ ديسيكاتورس والتسلل شرائط ورقة تحت فراغ لمدة 30 دقيقة. وفي وقت لاحق، احتضان أطباق بتري في الظلام دون اهتزاز في درجة حرارة الغرفة لمدة 2.5 ساعة.
    2. بلطف وإيجاز يهز الأطباق أفقيا باليد، في محاولة للافراج عن بروتوبلاستس تماما في حل الانزيم.
  5. حصاد و عد بروتوبلاستس
    1. تصفية تعليق بروتوبلاست من خلال شبكة 35 إلى 75 ميكرون النايلون. قسامة الترشيح من كل عينة إلى اثنين من 50 مل أنابيب جولة القاع (حوالي 20 مل من الترشيح في كل أنبوب).
    2. شطف كل طبق بتري مع 10 مل من العازلة W5 (154 ملي كلوريد الصوديوم، 125 ملي كاكل
    3. تدور جميع الأنابيب الأربعة لمدة 5 دقائق في 100 x ج إلى بيليه بروتوبلاستس. تجاهل طاف و ريسوسبيند بلطف الكريات بروتوبلاست في كل أنبوب مع 10 مل من W5 العازلة.
      ملاحظة: عند إعادة تعليق الكريات بروتوبلاست، عكس بلطف أنبوب رأسا على عقب وتدور بلطف الأنبوب باليد حتى الكريات قد اختفت. لا ماصة بيليه مباشرة لتجنب إتلاف الخلايا.
    4. كرر الخطوة 1.5.3 مرة واحدة والجمع بين تعليق بروتوبلاست من أنبوبين من كل عينة في أنبوب 50-مل جولة القاع. إبقاء الأنابيب على الجليد.
    5. عد بروتوبلاستس باستخدام عدادة الكريات.
      ملاحظة: كل 20 خلايا داخل 25 مكعبات يساوي 2 × 10 5 بروتوبلاستس / مل. يجب أن يترك 150 أوراق ما يقرب من 1 × 10 7 خلايا.تعديل للحصول على عدد إجمالي متساوية من بروتوبلاستس في عينات غير كل و كل.
    6. الحفاظ على بروتوبلاستس على الجليد لمدة 30 دقيقة. بعد ذلك، تدور الأنابيب لمدة 5 دقائق في 100 × ز. تجاهل طاف و ريسوسبيند بروتوبلاستس في كل أنبوب مع 20 مل من محلول مغ (400 ملي مانيتول، 15 ملي مغكل 2 ، و 4 ملي ميس العازلة (درجة الحموضة 5.7)).

2. في فيفو مرنا البروتين كروسلينكينغ بواسطة الأشعة فوق البنفسجية التشعيع

ملاحظة: الحفاظ على أنبوب العينة غير كل على الجليد. يجب أن تكون العينة كل على الفور الأشعة فوق البنفسجية المشع.

  1. نقل تعليق بروتوبلاست تحتوي على 1 × 10 7 خلايا من أنبوب عينة كل إلى طبق بتري جديد على نطاق واسع (150 مم × 20 مم) وإضافة 30 مل من محلول مغ الباردة الجليد لتغطية سطح اللوحة. نشر الخلايا في المخزن المؤقت مغ كله عن طريق بيبتينغ لطيف. وضع على الفور طبق بتري دون الغطاء العلوي في جهاز يشابك الأشعة فوق البنفسجية.
    ملاحظة: الارتفاع بين مصباح الأشعة فوق البنفسجيةوطبق بتري هو 8 سم.
  2. إشعاع العينة مع 254 نانومتر الطول الموجي ضوء الأشعة فوق البنفسجية و 0.00875 W / سم 2 كثافة الأشعة فوق البنفسجية لمدة 1 دقيقة، 3 دقائق، أو 5 دقائق. بعد التشعيع، قسامة بسرعة تعليق بروتوبلاست إلى اثنين جديدة 50 مل أنابيب جولة القاع. غسل الجزء السفلي من الطبق مع 5 مل إضافية من محلول مغ الباردة الجليد لجمع ما تبقى من بروتوبلاستس وإضافة تعليق الخلية لهذه الأنابيب اثنين.
    ملاحظة: تم اختيار 1 دقيقة كشرط الأمثل. ويمكن الاطلاع على التفسير في النتائج ممثل .

3. تحلل بروتوبلاست تحت ظروف تغيير طبيعة

  1. إعداد الكريات بروتوبلاست لتحلل
    1. تدور أنبوب العينة غير كل جنبا إلى جنب مع اثنين من أنابيب عينة كل من الخطوة 2 في 100 x ج لمدة 5 دقائق وتجاهل طاف. وضع أنبوب من غير كل عينة بروتوبلاست بيليه مرة أخرى على الجليد.
    2. إضافة 10 مل من محلول مغ الباردة الجليد لكل أنبوب عينة كل، جينتلي ريسوسبيند الكريات، والجمع بينهما مرة أخرى في واحد 50 مل أنبوب جولة القاع. تدور الأنبوب في 100 x ج لمدة 5 دقائق. بعد إزالة طاف، والحفاظ على كل عينة أنبوب بروتوبلاست بيليه على الجليد.
  2. بروتوبلاست تحلل و التجانس بروتوبلاست المحللة
    1. إضافة 9 مل من الجليد تحلل الباردة / ملزمة عازلة (500 ملي ليكل، 0.5٪ ( ث / ت ) ليثيوم دوديسيل كبريتات (ليدز)، 5 ملي ديثيوثريتول (دت)، 20 ملي تريس هكل (درجة الحموضة 7.5)، و 1 ملم إدتا (الرقم الهيدروجيني 8.0)) إلى بيليه الخلية من كل عينة. تقريبا ليز بروتوبلاستس التي بيبتينغ صعودا وهبوطا حوالي 20 مرة حتى تعليق أخضر متجانس الضوء.
    2. تمرير المحللة بروتوبلاست مرتين من خلال حقنة الزجاج 50 مل مع إبرة ضيقة (0.9 × 25 مم 2 ) للتجانس. احتضان المحللة على الجليد لمدة 10 دقيقة. تجميد المحللات في النيتروجين السائل وتخزينها في -80 درجة مئوية لمدة تصل إلى 3 أسابيع.

4. مرنب سحب إلى أسفل وتنقيةمن قبل أوليغو-د (T) 25 الخرز

ملاحظة: جميع المواد الموصوفة التالية والكواشف، من الخطوة 4.1 إلى الخطوة 4.4، هي فقط لعينة واحدة ( أي عينة واحدة غير كل أو عينة كل واحد). يجب أن يضاف المحللة بروتوبلاست فورا إلى الأنابيب التي تحتوي على الخرز بعد تحلل طاف حبة / المخزن المؤقت ملزمة.

  1. إعداد أوليغو-د (T) 25 الخرز المغناطيسي لل أوليغو (دت) التقاط
    1. ذوبان الجليد المجمدة بروتبلاست المحللة في درجة حرارة الغرفة. عندما يتم ذوبان المحللة تماما، والحفاظ على أنبوب من المحللة على الجليد.
    2. قسامة 1.8 مل من أوليغو-د (T) 25 الخرز المغناطيسي (5 ملغ / مل) في 6 أنابيب 2-مل جولة ميكروسنتريفوج جديدة جولة على الجليد. في كل أنبوب، وغسل تعليق حبة متجانس مع 600 ميكرولتر من تحلل / العازلة ملزمة قبل بيبتينغ لفترة وجيزة صعودا وهبوطا وتدوير بلطف في 4 درجات مئوية لمدة 2 دقيقة. الحفاظ على الخرز على الجليد.
  2. ربط
    1. مكانكل 6 أنابيب تحتوي على الخرز في رف المغناطيسي في 4 درجات مئوية لمدة 3 دقائق، الأمر الذي سيؤدي إلى التقاط المغناطيسي من الخرز وتطهير التعليق.
      ملاحظة: عندما توضع الأنابيب في رف المغناطيسي، والانتظار حتى يتم القبض على الخرز تماما، على الأقل 3 دقائق.
    2. تجاهل طاف وعلى الفور قسامة 9 مل من المحللة بروتوبلاست في هذه الأنابيب 6. تخلط جيدا من قبل بيبتينغ حتى يظهر تعليق البني متجانسة واحتضان الخرز في المحللة بروتوبلاست في 4 درجات مئوية لمدة 1 ساعة عن طريق تطبيق دوران لطيف.
      ملاحظة: يوصى وقت الحضانة من 30 دقيقة إلى 1 ساعة.
  3. غسل
    1. وضع أنابيب مرة أخرى في الرف المغناطيسي في 4 درجات مئوية لمدة 3 دقائق. عندما يتم القبض على جميع الخرز على الجانب من الأنابيب، وجمع المحللة بروتوبلاست في 6 أنابيب 2-مل جولة ميكروسنتريفوج جديدة القاع وتخزينها مؤقتا في 4 درجات مئوية. لا تجاهل بروستوبلاست المحللة على الفور. والحفاظ على المحللةعند 4 درجات مئوية.
    2. إضافة 1.5 مل من العازلة غسل الجليد الباردة 1 (500 ملي ليكل، 0.1٪ ( ث / ت ) ليدس، 5 ملي دت، 20 ملي تريس هكل (درجة الحموضة 7.5)، و 1 ملي إدتا (الرقم الهيدروجيني 8.0)) إلى الخرز في كل أنبوب. ريسوسبيند الخرز وتطبيق دوران لطيف لمدة 1 دقيقة. وضع أنابيب مرة أخرى في الرف المغناطيسي في 4 درجات مئوية لمدة 3 دقائق وتجاهل طاف. كرر هذه الخطوة غسل مع غسل العازلة مرة واحدة.
    3. كرر نفس الإجراء من هذه الخطوة غسل مرتين باستخدام 1.5 مل من الجليد غسل الباردة العازلة 2 (500 ملي ليكل، 5 ملي دت، 20 ملي تريس-حمض الهيدروكلوريك (درجة الحموضة 7.5)، و 1 ملي إدتا (الرقم الهيدروجيني 8.0)) وبمجرد استخدام 1.5 مل من الجليد الباردة منخفضة الملح العازلة (200 ملي ليكل، 20 ملي تريس-حمض الهيدروكلوريك (الرقم الهيدروجيني 7.5)، و 1 ملي إدتا (الرقم الهيدروجيني 8.0)).
      ملاحظة: إذا تم عزل مرنبس بكفاءة من المحللة بروتوبلاست، يجب أن يكون هناك "هالة" مرئية حول بيليه حبة في العينة كل خلال خطوة غسل مع غسل العازلة 2 ( الشكل 1B ).
  4. شطف
    1. إضافة 500 ميكرولترمن العازلة شطف (20 ملي تريس-حمض الهيدروكلوريك (الرقم الهيدروجيني 7.5) و 1 ملي إدتا (الرقم الهيدروجيني 8.0)) إلى الخرز في كل أنبوب. ريسوسبيند بلطف الخرز واحتضان عند 50 درجة مئوية لمدة 3 دقائق للافراج عن بولي (A) رنا-تايليد. ريسوسبيند بلطف الخرز مرة واحدة بيبتينغ. وضع أنابيب مرة أخرى في الرف المغناطيسي في 4 درجات مئوية لمدة 5 دقائق.
    2. نقل والجمع بين جميع خيوط (حوالي 3 مل في المجموع) إلى نظيفة، معقم ريبونوكلياز الحرة، 15 مل أنبوب مخروطي القاع على الجليد.
      ملاحظة: يمكن تحديد نوعية وكمية من الحمض النووي الريبي على الفور باستخدام جهاز الطيف الضوئي.
      ملاحظة: تركيز الحمض النووي الريبي لكل عينة حوالي 10 نانوغرام / ميكرولتر، مع A 260 / A 280 نسبة 1.9. وينبغي أن تكون نسبة A 260 / A 280 بين 1.6 و 2.0 لأن رنا المعزولة بولي (A) -Tilted عادة ما تكون أكبر من 70٪ نقية. إذا كان تركيز الحمض النووي الريبي منخفض جدا، وزيادة عدد بروتوبلاستس بدءا إلى حد أقصى قدره 10 9 . عيناتيمكن تجميدها في النيتروجين السائل والاحتفاظ بها في 80 درجة مئوية للتخزين على المدى الطويل.
    3. كرر الخطوة 4.2 إلى الخطوة 4.4 لجولتين إضافية وإعادة استخدام حبات صغيرة (T) 25 لاستنفاد رنا من بولي (A) -Tilted من المحللة بروتوبلاست.
      ملاحظة: بعد ثلاث جولات من الإجراء المنسدلة، يجب أن يكون هناك ما مجموعه 9 مل من إلونت لكل عينة غير كل أو كل. أداء جميع الأعمال في 4 درجات مئوية لتجنب تدهور الحمض النووي الريبي. اتبع الخطوة 4.5 أو الخطوة 4.6 لإعادة استخدام أو تجديد الخرز.
  5. إعداد إعادة استخدامها أوليغو-د (T) 25 الخرز
    1. غسل الخرز مرتين مع 1 مل من العازلة شطف الجليد الباردة ومرة ​​واحدة مع 1 مل من الجليد الباردة تحلل / العازلة ملزمة لضبط تركيز الملح ليكل العودة إلى 500 ملم.
    2. اتبع الخطوة 4.1، تجاهل طاف، ونقل المحللة بروتوبلاست المخزنة في كل أنبوب، وكرر الإجراء برمته من الخطوة 4.2 إلى الخطوة 4.4 لجولتين إضافيتين.
  6. 25 الخرز
    ملاحظة: يمكن تخزين الخرز واستخدامها لتجربة أخرى (الحد الأقصى لإعادة استخدام ثلاث مرات).
    1. اتبع الخطوة 4.4، إضافة 1 مل من 0.1 M هيدروكسيد الصوديوم إلى الخرز، واحتضان عن طريق تناوب في درجة حرارة الغرفة لمدة 5 دقائق. لكل أنبوب، وغسل مرتين مع 1 مل من غسل العازلة 1 وثلاث مرات مع برنامج تلفزيوني 1X (الرقم الهيدروجيني 7.4) تحتوي على 0.1٪ توين 20 لموازنة. الحفاظ على الخرز من كل أنبوب في 300 ميكرولتر من المعقم ريبونوكلياز 1X بس (الرقم الهيدروجيني 7.4) تحتوي على 0.1٪ توين 20 في 4 درجات مئوية للتخزين على المدى الطويل.
      ملاحظة: الخرز المستخدمة ل أرابيدوبسيس كل عينات في هذه التجربة لا يمكن إلا أن تستخدم لنفس العينات النباتية في المرة القادمة.

5. بروتين K العلاج و مرنا تنقية

  1. بروتين K العلاج
    1. إضافة 8 ميكرولتر من محلول بروتين K (2 ميكروغرام / ميكرولتر) إلى 1 مل من إلوينت من كل عينة لهضم بروتينات الأشعة فوق البنفسجية كروسلينكد. رإيفي دوامة.
  2. مرنا تنقية
    1. احتضان شبح في 37 درجة مئوية لمدة 1 ساعة. تنقية الحمض النووي الريبي باستخدام مجموعة تنقية الحمض النووي الريبي لإزالة الملوثات المتبقية.
      ملاحظة: بعد تنقية، و رنا مستعدون لاختبار جودة الحمض النووي الريبي باستخدام فحص كرت-ير.
      ملاحظة: مجموعات أخرى، مثل رنا كيت مصغرة وكاشف تريزول، ويمكن أيضا أن تستخدم 14 .

6. كرت-ير الفحص

  1. النسخ العكسي
    1. تحقيق توليفة فعالة من أول حبلا [كدنا] باستخدام نظام النسخ العكسي، مع 1 ميكروغرام من الحمض النووي الريبي كنموذج. تمييع العينة إلى 5 نانوغرام / ميكرولتر مع المياه نوكليس خالية.
  2. [كدنا] كميا باستخدام [كرت-ير]
    1. تضخيم وقياس كدنا باستخدام مزيج الرئيسي قر وفي الوقت الحقيقي سيكلر ير، مع 10 نانوغرام من [كدنا] كقالب. استخدام برنامج ير التالية: 95 درجة مئوية لمدة 10 دقيقة(المرحلة 1، دورة واحدة) و 95 درجة مئوية لمدة 15 ثانية و 60 درجة مئوية لمدة 1 دقيقة (المرحلة 2، 40 دورات).
      ملاحظة: الجين المرجعي المستخدمة هنا كان الجين التحكم الداخلي الذاتية، UBQ10 (AT4G05320). تم وصف الاشعال كرت -ير ل UBQ10 و 18S الريباسي في لي وآخرون ، 2014 ودوروت وآخرون ، 2014، على التوالي 45 ، 46 . يتم سرد متواليات التمهيدي في جدول المواد .

7. ريبونوكلياز العلاج و مرب تركيز

  1. العلاج ريبونوكلياز
    1. إضافة ما يقرب من 100 U من الكوكتيل ريبونوكلياز التي تحتوي على رناس A و T1 رنيس في 8 مل من إلوينت. وتشمل عينة السيطرة السلبية مع كوكتيل ريبونوكلياز التي يتم استبدالها بخيوط من قبل نوكليس خالية من المياه. دوامة لفترة وجيزة واحتضان عند 37 درجة مئوية لمدة 1 ساعة.
  2. تركيز مرب
    1. بعد ريبونوكلياز الهضم، والتركيز ونسين وفيرةg وحدات تصفية الطرد المركزي. حجم النهاية هو 75 ميكرولتر، مع العائد الكلي من البروتين ما يقرب من 2 ميكروغرام من كل عينة بعد التركيز. وضع العينات في -80 درجة مئوية للتخزين على المدى الطويل.

8. سدز-بادج وفضية تلطيخ

  1. SDS-PAGE
    1. مزيج 25 ميكرولتر من خبيرة مركزة (عينة كل) أو عينة السيطرة (عينة غير كل) مع 15 ميكرولتر من 2X صبغ التحميل. تسخين العينة في 95 درجة مئوية لمدة 5 دقائق وتحميله على هلام سدز-بادج تحتوي على 5٪ التراص هلام و 12٪ حل هلام، بما في ذلك علامة البروتين.
    2. تكثيف البروتينات في 60 V لمدة 40 دقيقة وفصل في 160 V لمدة 1 ساعة تقريبا حتى تصل صبغ التحميل نهاية هلام حل.
  2. الفضة تلطيخ الفحص
    1. غسل هلام سدز-بادج مرتين مع الماء عالى النقاء لمدة 5 دقائق في كل مرة. إجراء تلطيخ الفضة من البروتينات باستخدام مجموعة فضية فضية التجارية.
      ملاحظة: يجب أن تظهر العصابات البروتين في غضون 5 دقائق. إذا كانت العصابات مرئية بعد 5 دقائق مع لون خفيف جدا، ويقترح لزيادة عدد بروتوبلاستس بدءا تصل إلى الحد الأقصى من 10 9 .

9. التربسين ديجيست من بروتين العصابات وتنقية الببتيد

  1. تريبسين هضم
    ملاحظة: تشغيل هلام 1D-بادج الثاني عن طريق اتخاذ 25 ميكرولتر آخر من محلول مرب المركزة من كل عينة لتحديد مرب؛ لا يمكن استخدام المواد الهلامية الملطخة بالفضة لأنها غير متوافقة مع تحليل مس.
    1. بعد تشغيل هلام 1D-بادج، إصلاح هلام في حل التثبيت (50٪ ( V / V ) الميثانول و 10٪ ( الخامس / الخامس ) حمض الخليك) لمدة 1 ساعة. وصمة عار هلام في محلول وصمة عار (0.1٪ ( ث / ت ) كوماسي بريليانت الأزرق R-250، 50٪ ( V / V ) الميثانول، و 10٪ ( V / V ) حمض الخليك) لمدة 20 دقيقة مع الهز لطيف. إزالة الجل في محلول ديستين (40٪ ( v / v ) الميثانول و 10٪ ( v/ v) حمض الخليك) لمدة 1 ساعة. بعد ديستينينغ، والحفاظ على هلام في 5٪ ( الخامس / الخامس ) حمض الخليك.
      ملاحظة: خلال ديستينينغ، ديستين الحل الجديد يمكن استبدالها حتى الخلفية تماما.
    2. قطع العصابات من الفائدة من هلام. قطع العصابات أبعد من ذلك إلى قطع من حوالي 1 ملم 3 لالاحقة التريبسين الأمثل الهضم واستخراج الببتيدات. هيدرات قطع هلام مع 50 ميكرولتر من 100 ملي بيكربونات الأمونيوم (نه 4 هكو 3 ) لمدة 10 دقيقة. تغطية قطع هلام تماما.
      1. إزالة الحل مرطب بعناية وتجفيف قطع هلام مع أسيتونتريل (تش 3 ن) لمدة 10 دقيقة. إزالة بعناية حل أسيتونتريل.
      2. كرر العملية من الترطيب إلى الجفاف مرتين. أخيرا، إزالة الحل أسيتونتريل.
        ملاحظة: وقت تشغيل هلام يعتمد على الغرض من التجربة. على المدى الطويل مرات يسمح فصل جيد من البروتينات، وبالتالي فإن هلام محدد ملون الحظردس يمكن قطع لمزيد من التحليل. إذا كان الغرض هو الحفاظ على البروتينات وإزالة الملوثات، وقت قصير يكفي.
    3. إضافة 500 ميكرولتر من 6.6 ملي حل دت واحتضان قطع هلام لمدة 10 دقيقة. إزالة حل دت وغسل قطع هلام مرتين مع 500 ميكرولتر من 95٪ ( الخامس / الخامس ) حل أسيتونتريل.
      1. بعد الغسيل، وإزالة الحل أسيتونتريل واحتضان قطع هلام مع 500 ميكرولتر من 55 ملي حمض اليودواسيتيك (إيا) حل لمدة 10 دقيقة في الظلام.
      2. بعد الحضانة، وإزالة الحل وغسل قطع هلام مرة أخرى مع 500 ميكرولتر من 95٪ ( الخامس / الخامس ) حل أسيتونتريل. تجفيف قطع هلام.
    4. تضمين قطع هلام تماما مع 25 ميكرولتر من الهضم العازلة (50 ملي نه 4 هكو 3 ، 5 ملي كاكل 2 ، و 6 نانوغرام / ميكرولتر التربسين) والحفاظ على الجليد لمدة 45 دقيقة للسماح لل التربسين تتخلل في هلام. احتضان قطع هلام بين عشية وضحاها في 37 درجة مئوية ل أر الهضم الزماوي.
  2. تنقية الببتيد
    1. إضافة 80 ميكرولتر من 50 ملي نه 4 هكو 3 إلى قطع هلام في العازلة الهضم ودوامة مرارا لاستخراج الببتيدات التربرية. جمع استخراج. كرر هذه الخطوة استخراج مرتين مع 80 ميكرولتر من 50٪ ( الخامس / الخامس ) تش 3 ن و 5٪ ( ت / ت ) حمض الفورميك (فا).
      ملاحظة: يجب أن يكون مجموع استخراج النهائي حوالي 240 ميكرولتر.
    2. تجمع وتركيز مقتطفات إلى ما يقرب من 10 ميكرولتر من تركيز فراغ أو ليوفيليزاتيون وإضافة 25 ميكرولتر من 0.1٪ ( الخامس / الخامس ) محلول تريفلورواسيتيك مائي (تفا) الحل. ديسالت العينات مع أعمدة μ-C18، بعد بروتوكول الشركة المصنعة.
    3. أزل الببتيدات مع 4 - 10 ميكرولتر من 60٪ ( ث / ت ) تش 3 ن و 0.1٪ ( ت / ت ) فا. يجفد (تجميد الجافة) الببتيدات وتخزينها في -20 درجة مئوية حتى التحليل.
العنوان "> 10. نانو-لك-مس

  1. نانو عكس المرحلة اللوني السائل
    ملاحظة: إجراء تحليل لك-مس مع مطياف الكتلة التي هي على الانترنت إلى جانب أداة كروماتوغرافيا السائل. وينبغي أن تكون مجهزة هذا الصك مع عمود C18 (2 ميكرون الجسيمات، 100 Å حجم المسام، و 50 ميكرون × 15 سم في البعد).
    1. ريسوسبيند الببتيدات مجفف بالتجميد في 16 ميكرولتر من محلول (2٪ ( الخامس / الخامس ) تش 3 ن و 0.1٪ ( ت / ت ) فا). حقن وتحميل 5 ميكرولتر من محلول الببتيد بمعدل تدفق 5 ميكرولتر / دقيقة على بريكولومن C18 (3 ميكرون حجم الجسيمات، 100 Å حجم المسام، نانوفيبر، و 75 ميكرون × 2 سم في البعد).
    2. 10.1.2. فصل الببتيدات باستخدام التدرج 95 دقيقة مع معدل تدفق 300 نل / دقيقة. خلال هذا الفصل التدرج، وزيادة المرحلة المتنقلة B من 4٪ إلى 10٪، 10٪ إلى 25٪، و 25٪ إلى 45٪ في 5 دقائق و 50 دقيقة و 18 دقيقة، على التوالي. وأخيرا، زيادة حاد في المرحلة المتنقلة B إلى 95٪ في 1 دقيقة. بعدكل التدرج الانفصال 95 دقيقة، وتطبيق خطوة شطف المتأصلة التي تحتوي على التدرج 10 دقيقة من 4٪ إلى 95٪ في 5 دقائق.
      ملاحظة: المرحلة تليفون A هي 99.9٪ H 2 O و 0.1٪ (ت / ت) اتحاد كرة القدم، والمرحلة المحمول B هو 19.92٪ H 2 O، و 80٪ (ث / ت) CH 3 CN، و 0.08٪ (ت / ت ) فا.
  2. قياس الطيف الكتلي
    1. تشغيل مطياف الكتلة في وضع تعتمد على البيانات مع مجموعة واسعة من 400 إلى 1600 متر / ض.
    2. حدد ما يصل إلى عشرة من الأيونات الأكثر كثافة في MS1 لتوليد أطياف تجزؤ. تعيين القرار إلى 70،000 عرض كامل في نصف أقصى (فوهم) ل MS1 و 17،000 ل MS2، مع هدف التحكم التلقائي (أغك) من 3،000،000 و 1،000،000 الأيونات والحد الأقصى لوقت الحقن أيون (إيت) من 256 و 64 مللي ثانية ل MS1 و MS2، على التوالي.
    3. تعيين استبعاد الديناميكي إلى 10 ثانية لتجنب تكرار تجزئة الأيونات الأكثر وفرة.
      ملاحظة: هنا، الأيونات مع واحد أو أكثر من ست رسوم هي همستبعدة ل MS2.
  3. بروتيوميكس النوعي: الببتيد والبروتين تحديد الهوية
    1. تحليل أطياف تجزئة باستخدام البرمجيات مثل الذروة استوديو البرمجيات 47 ، 48 ، 49 .
      ملاحظة: حزم البرامج الأخرى وتتوفر أيضا لتحديد الببتيد، مثل نوفوهم 30 و بيبنوفو 37 للتسلسل دي نوفو و سيكست 54 و ماسكوت 55 للبحث قاعدة البيانات.
    2. الجمع بين الأطياف مع نفس الكتلة (<2 جزء في المليون الفرق) والاحتفاظ مرات (<2 دقيقة) والاحتفاظ فقط أطياف مع عتبة الجودة أعلى من 0.65 للبحث في قاعدة بيانات السويسري بروت (الإصدار: ديسمبر 2013) لمجموعة التصنيف إلى نموذج نبات أرابيدوبسيس ثاليانا . استخدام معلمات البحث التالية: التسامح الشامل السلائف من 10 جزء في المليون من خلال استخدام مونكتلة النظائر. والتسامح الشامل جزء من 20 مليمو؛ التربسين كما انزيم الهضم، بحد أقصى 2 غاب الانقسامات. الكرباميدوميثيلين السيستين كما تعديل ثابت. الأكسدة الميثيونين كما تعديل متغير. و بحد أقصى 3 تعديلات متغيرة بعد الترجمة لكل الببتيد. بعد تحديد، تعيين يدويا عتبات النتيجة لتحديد موثوق بها الببتيد والبروتين بحيث يتم اكتشاف معدل اكتشاف كاذبة (فدر) <5٪.
  4. بروتيوميكس الكمية: التحليل الإحصائي لبيانات قياس الطيف الكتلي
    1. استخدام لك-مس (على سبيل المثال بروجينيسيس) للكمية خالية من التسمية من البيانات البروتينات.
      ملاحظة: ترتبط المناطق ذروة الببتيد MS1 (أو شدة) إلى الببتيدات التي حددها برنامج الاستوديو وفقا لكتلتها، مع الخطأ المسموح به في الحد الأقصى من 10 جزء في المليون.
      ملاحظة: هذا البرنامج بحساب وفرة من الببتيد من خلال دمج مناطق الذروة من جميع الدول تهمة بين 2 <سوب> + و 8 + . وترتبط البيانات الكمية لتحديد بيكس الببتيد من قبل النصي الداخل (مطابقة كتلة مع الخطأ المسموح به في الحد الأقصى من 10 جزء في المليون).
    2. حساب متوسط ​​التغييرات log2 أضعاف (كل / غير كل) لكل الببتيد. مجموعة طيات التغييرات من الببتيدات الفريدة من البروتين.
      ملاحظة: في كل مجموعة، والتغيير النهائي طية من البروتين يساوي متوسط ​​طيات التغييرات من الببتيدات لها.
    3. حساب قيمة p باستخدام t -test الطالب لكل مجموعة لتقييم الدلالة الإحصائية. تطبيق حزمة البرامج R (الإصدار 3.3.0) لتصحيح قيم p ل فدر لجميع المجموعات باستخدام طريقة بينجاميني-هوكبرغ (ب).
    4. رسم مؤامرة البركان باستخدام حزمة "معايرة" وظيفة (الإصدار 1.7.2) متوافقة مع حزمة البرمجيات R (الإصدار 3.3.0).
      ملاحظة: هنا، قيم-p10 المعدلة -log10 (-log10 (أدج p- قيمة)) هي وظيفة من التغييرات log2 أضعاف جميع البروتينات التي تم تحديدها. البروتينات هيتعامل كضربات إيجابية في بروتيوم مرنا ملزمة إذا كانت التغييرات log2 أضعاف أكبر من 2، مع أو بدون أهمية.

11. كتالوج بروتيوم مرنا محددة التي تم تحديدها

  1. تصنيف البروتينات المحددة من الخطوة 10 إلى ثلاث فئات على أساس عناصر "وظائف الجزيئية والعملية البيولوجية" عن طريق قاعدة بيانات الجينات أونتولوغي (غو) و "الأسرة والمجال" عبر قاعدة بيانات إنتيربرو.
  2. كما تحتوي الفئة الأولى، أو "البروتينات الريبوسومية"، على جميع البروتينات الريبوسومية الكشف عنها، وتحديد البروتينات من الفئة الثانية، أو "ربس الرئيسية"، كما تحتوي على المجالات البروتين المشروح التي تتفاعل مع رنا أو ربط رنا ملزمة مع وظائف معروفة أو غير معروفة في علم الأحياء الحمض النووي الريبي .
  3. كما البروتينات مع وظائف معروفة أو غير معروفة في علم الأحياء الحمض النووي الريبي دون مجالات مشحونة رنا ملزمة توضع في الفئة الثالثة، أو "المرشحين ربس"، تحديد الإنزيمات من الفئة الثالثة على أساس الشروح من Iقاعدة بيانات نتنز.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

لاحظنا هالة مميزة، الذي يحيط بيليه حبة في العينة كل، في غسل الخطوة 4.3 مع غسل العازلة 2 ( الشكل 1B ). على الرغم من أنه لم يتم التحقيق، ويمكن تفسير هذه الظاهرة ربما من خلال تدخل المجمعات مرنب كروسلينكد مع حبة التجميع خلال التقاط المغناطيسي، مما تسبب في أكثر انتشارا لتشكيل الكلي. وهو يشير إلى أن أوليغو-د (T) 25 التقاط حبة كانت فعالة 14 .

وترد أعلى بكثير مستويات مرجنا UBQ10 مرجعية من 18S الريباسي في كل من السيطرة غير كل و كل العينات في الشكل 1C . هذا يشير إلى أن المخصب مرناس في بلاغة بسبب التقاط من قبل أوليغو- د (T) 25 الخرز، والتي يمكن أن ترتبط فقط ل بولي (A) مرناس. كانت كفاءة أوليغو-د (T) 25 التقاط حبة إضافيةأورتد بواسطة سدز-بادج والفضة تلطيخ (الخطوة 8)، كما هو مبين في الشكل 1D بعد العلاج ريبونوكلياز وتركيز مرب (الخطوة 7). ويمكن ملاحظة الفرق في نمط الفرقة البروتين بين السيطرة غير كل والممرات عينة كل، ويمكن أن يفسر فرق البروتين الموجودة في غير كل السيطرة حارة عينة من وجود ريبونوكلياز. وهذا يوضح التخصيب القوي من مربس في عينة كل.

يمكن التحكم في كفاءة التشابك من خلال تغيير المدة الزمنية للأشعة فوق البنفسجية. كافية كروسلينكينغ ولكن تجنب الضرر بروتوبلاست وتدهور الحمض النووي الريبي هو الأمثل. في الشكل 1D ، تم الحصول على أنماط محددة الفرقة البروتين في جميع عينات كل عند مقارنة مختلف أشعة الأشعة فوق البنفسجية (1، 3، و 5 دقائق). تحت نفس كثافة الأشعة فوق البنفسجية (0.00875 W / سم 2 )، تم العثور على الظروف الأكثر مثالية لتكون 1 أو 3 دقائق، وذلك بسبب لا يمكن تمييزهابروتين الفرقة شدة. وقد لوحظت شدة الفرقة أضعف مع زمن كروسلينكينغ أطول (5 دقائق). اعتبرنا 1 دقيقة كالشرط الأمثل لأن مدة أقصر من كروسلينكينغ لديه ميزة إضافية لنقل أسهل وجمع بروتوبلاستس من طبق بتري. يمكن أن يعجل بروتوبلاستس بسرعة إلى الجزء السفلي من طبق بتري خلال أشعة فوق البنفسجية لأنها التمسك أسفل الطبق. وهذا يجعل من الصعب جمع ونقلها إلى الأنابيب بعد فترة أشعة فوق البنفسجية أطول.

استنادا إلى الظروف الأمثل، وتحديد البروتينات من ثلاثة مكررات البيولوجية تم تحقيقها في وقت لاحق من قبل البروتينات النوعية والكمية، التي تم وصفها في الخطوات 9 و 10. في التحليل من قبل البروتينات النوعية ( الشكل 1E ، والحق)، ما مجموعه 341 البروتينات تم تحديدها في عينات كل، منها 36 وجدت على حد سواء في غير كل السيطرة أد عينات، و تم الكشف عن 8 فقط من البروتينات في عينة التحكم غير كل. هذا الفرق الهائل في أعداد البروتين المحددة بين كلا العينات يتسق مع مختلف أنماط الفرقة البروتين ( الشكل 1D )، ودعم فكرة أن فحص سدز-بادج والفضة تلطيخ هي أدوات جيدة للتحقق من صحة أوليغو- د (T) 25 التقاط حبة. في تحليل البروتينات الكمية ( الشكل 1E ، يسار)، أظهر ما مجموعه 325 البروتينات (الأزرق والأخضر الملونة) تغيير log2 أضعاف أكبر من 2. من بين هذه البروتينات، وكان 100 البروتينات (الأزرق اللون) ص صغير -القيمة فوق مستوى الأهمية. ولذلك، تم تعريفها أيضا بأنها ضربات إيجابية. ومن الجدير بالملاحظة أن قيم P من 225 بروتينات أخرى (خضراء اللون) كانت أكبر من 0.05، أقل من مستوى الدلالة بسبب تناقص البيانات. وبعبارة أخرى، كانت هناك الببتيدات منخفضة وفيرة موجودة لكل بروتين، مع تباين عالية من إنتنتيتي الببتيدوفاق. ومع ذلك، لأن كل منهم تم الكشف عن نوعيا فقط في عينات كل، كانت تعتبر إيجابية.

استنادا إلى قواعد البيانات غو و إنتيربرو 50 (الخطوة 11)، تم تصنيف هذه البروتينات 325 إلى الفئة الأولى (البروتينات الريبوسومية)، والفئة الثانية (ربس الرئيسية)، والفئة الثالثة (ربس المرشح) ( الشكل 1F ). وكان هناك 123 بروتينا ريبوسوميا في الفئة الأولى، بينما لوحظ في الفئة الثانية 70 سببا تقليديا مشروحا. هاتين الفئتين التي تحتوي على معظم البروتينات المشروح ربط الارتباط الجزيئي رنا وبيولوجيا الحمض النووي الريبي ( الشكل 1F ، يمين) والتي تحتل ما يقرب من 38٪ و 22٪ من برمتي ملزمة مرتيوم كله، على التوالي، تشير إلى كفاءة عالية من مرنا الأمثل إنتيراكوم القبض. وتم تصنيف ال 40٪ الأخيرة (132 مرشحا تجاريا تجاريا للمرشحين) في الفئة الثالثة بسبب عدم وجود ربد التقليدية. وعلاوة على ذلك، فإن معظم منلم يتم التحقق من صحة الأدوار إير في ملزمة رنا والعمليات البيولوجية الحمض النووي الريبي ( الشكل 1F ، يسار). ونحن نفترض أن البروتينات من هذه الفئة يمكن أن تكشف عن وظائف جديدة في اللوائح رنا.

شكل 1
الشكل 1: مخطط انسيابي ونتائج الطريقة المثلى لاكتشاف بروتيوم مرنا ملزمة من أرابيدوبسيس ليف ميسوفيل بروتوبلاستس. ( A ) يتم سرد الخطوات الرئيسية من الأسلوب كله من 1 إلى 11. وتظهر العمليات الخلوية والجزيئية بوتاتيف من الصور والرسوم المتحركة. وقد تم وصف تفاصيل كل خطوة بشكل مكثف في البروتوكول. ( B ) لوحظ هالة المحيطة حبات بيليه في العينة كل، ولكن ليس في عينة التحكم غير كل، خلال غسل الخطوة 4.3. ( C ) مقارنة UBQ10 مرنا النسبية و 18 S الرنا الريباسي ليفلس في التحكم غير كل و كل العينات بواسطة كرت-ير (القيم هي يعني ± سد (ن = 3)؛ * و **: فروق ذات دلالة إحصائية مع p <0.05 و <0.01). ( D ) تتركز البروتين إلونت من غير كل عينة السيطرة مقارنة مع عينات كل المشع بواسطة مصدر الأشعة فوق البنفسجية المستمر الموجة لمدة 1 و 3 و 5 دقائق، مع كثافة الأشعة فوق البنفسجية في 0.00875 W / سم 2 . ( E ) تحديد بروتيوم مرنا ملزمة بروتيوميكس. في بروتيوميكس الكمية التي تقوم بها حزمة البرامج بروجينسيس (يسار)، يعرض مؤامرة البركان متوسط ​​التغييرات log2 أضعاف (كل / غير كل) والقيم p المعدلة ذات الصلة (-log10 (قيم p- أدج)) من جميع البروتينات. في البروتينات النوعية التي تقوم بها حزمة البرامج الذروة (يمين)، يتم توضيح البروتينات في العينات في المخططات فين. يتم سرد كمية من البروتينات في الأرقام. و روزفلت في مستويات الببتيد والبروتين أقل من 5٪. وتعتبر أعداد البروتينات داخل الأطر البني الفاتح ضربات إيجابية. ( وآخرون ، 2016. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

طبقنا بنجاح مرنا التقاط إنتيراكتوم، وضعت للخميرة والخلايا البشرية، لزراعة بروتوبلاستس ميسوفيل ورقة. خلايا ميسوفيل ليف هي النوع الرئيسي من الأنسجة الأرضية في أوراق النبات. الميزة الرئيسية لهذا الأسلوب هو أنه يستخدم في الجسم الحي كروسلينكينغ لاكتشاف البروتينات من بيئة فسيولوجية.

في هذا البروتوكول، ونحن أساسا تقديم عدد من الظروف التجريبية الأمثل (على سبيل المثال، وعدد من بروتوبلاستس لاستخدامها كمادة البدء ومدة أشعة فوق البنفسجية) 50 . يمكن الكشف عن البروتينات التي تم التقاطها في عينات كل فقط من قبل سدز-بادج والفضة تلطيخ عند استخدام الحد الأدنى من 10 7 بروتوبلاستس (على نطاق متوسط) (الخطوة 1.5.5). تركيزات أقل لا تسفر عن نمط مرب مراحظ على سدز-بادج، وربما لا يمكن استخدامها لمزيد من التحليل من قبل بروتيوميكس. في الواقع، وذلك باستخدام أكثر من 10 7 خلايا (على سبيل المثال، 10 9 فيتجربة واسعة النطاق) هو ممكن أيضا 20 . وتشير النتائج من المقايسات الفضة تلطيخ أن الأشعة فوق البنفسجية التشعيع لمدة 1 دقيقة مع 0.00875 W / سم 2 من كثافة الناتجة عن مصدر الأشعة فوق البنفسجية المستمر الموجة هو الأمثل ( الشكل 1D ). ويدعم كفاءة عالية في الخطوة الحرجة ( أي، مرنب المنسدلة وتنقية من قبل أوليغو د (T) 25 الخرز، الخطوة 4) من نتائج رت-قر، الفضة تلطيخ، وفحوص مس ( الشكل 1C ، 1D ؛ و 1E ، يمين). مزيج من البروتينات النوعية والكمية يمكن أن تساعد على تحديد الممارسات التجارية التقييدية الإيجابية في منطقة التداخل بين السيطرة غير كل والعينات كل ( الشكل 1E ). وكانت غالبية البروتينات التي تم تحديدها ربس لم مشروح سابقا في مجموعات البيانات ( الشكل 1F ). وقد قدمنا ​​هذه البروتينات الملزمة من الحمض الريبي النووي (رنا) غير المعروفة سابقا في الفئة الثالثة كملخصات تجارية تجارية مرشحة <سوب كلاس = "كريف"> 50 ( الشكل 1F ). يجب أن يتم استكشاف الخصائص الملزمة لهذه الممارسات التجارية التقييدية المرشحة باستخدام أساليب أخرى، مثل أساليب كليب المذكورة سابقا 23 . أحد الأمثلة التي تحقق في خصوصية ملزمة من ربب لتنظيم نص مرنا الهدف في أرابيدوبسيس من خلال استخدام كليب 51 يمكن العثور عليها في تشانغ وآخرون ، 2015. وبالإضافة إلى ذلك، طريقة بديلة تعديل من بار-كليب، ودعا فوكتيفاتابل- ريبونوكلأوسيد تعزيز كروسلينكينغ (بار-كل، 365 نانومتر الأشعة فوق البنفسجية- A) كما تم الموصى بها سابقا للتحقيق من بروتيوم مرنا ملزمة من الخميرة والخلايا البشرية 14 ، 23 . بار-كل يتطلب 4Su، والتي يتم تناولها من قبل الخلايا ودمجها في رنا الوليدة خلال عملية التمثيل الغذائي للحمض النووي الريبي ويمكن أن تكون عالية التفاعل، وتشكيل الروابط التساهمية مع الأحماض الأمينية 52 تحت الأشعة فوق البنفسجية- A (365 نانومتر) إراديأوجه. حاليا، لا توجد دراسات تركز على سمية 4sU إلى الخلايا النباتية وكفاءة امتصاص 4sU الخارجية إلى بروتوبلاستس ميسوفيل 53 . ومع ذلك، فإننا نعتقد أنه سيكون من الممكن استخدام كل التقليدية (254 نانومتر الأشعة فوق البنفسجية- C) و بار-كل (365 نانومتر الأشعة فوق البنفسجية- A) على النباتات، والتي سوف تسهم في اكتشاف والتحقق من الممارسات التجارية التقييدية المتنوعة من الفسيولوجية البيئة في المستقبل.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgements

ونحن نعترف مختبر البروفيسور جوريس ويندريككس، الذي قدم الأشعة فوق البنفسجية جهاز يشابك مجهزة مصباح الأشعة فوق البنفسجية التقليدية. ويدعم كغ من قبل صندوق أبحاث جامعة ليوفن ويوافق على الدعم من منحة فو G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics