Author Produced

Développement d’un Biocapteur électrochimique ADN pour détecter un pathogène d’origine alimentaire

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Un protocole pour le développement d’un Biocapteur électrochimique d’ADN comportant une électrode de carbone acide-stabilisé, or de nanoparticules modifiés, sérigraphié de polylactique pour détecter les Vibrio parahaemolyticus est présenté.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nordin, N., Yusof, N. A., Radu, S., Hushiarian, R. Development of an Electrochemical DNA Biosensor to Detect a Foodborne Pathogen. J. Vis. Exp. (136), e56585, doi:10.3791/56585 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vibrio parahaemolyticus (V. parahaemolyticus) est un pathogène d’origine alimentaire commune qui contribue à une grande partie des problèmes de santé publique dans le monde, affectant de manière notable le taux de morbidité et de mortalité humaine. Les méthodes conventionnelles pour la détection de V. parahaemolyticus tels que les méthodes axées sur la culture, tests immunologiques et moléculaires des méthodes nécessitent la manipulation des échantillons complexes et sont long, fastidieux et coûteux. Récemment, les biocapteurs ont prouvé être une méthode de détection prometteurs et complet avec les avantages d’une détection rapide, coût-efficacité et praticité. Cette recherche porte sur l’élaboration d’une méthode rapide de détection V. parahaemolyticus avec une sélectivité élevée et une sensibilité en utilisant les principes de l’hybridation de l’ADN. Dans le travail, caractérisation des nanoparticules or des stabilisés acide polylactique synthétisés (PLA-AuNPs) a été réalisée à l’aide de la Diffraction des rayons x (DRX), spectroscopie Ultraviolet-visible (UV-Vis), microscopie électronique à Transmission (TEM), émission de champ Microscopie électronique à balayage (FESEM) et la voltampérométrie cyclique (CV). Nous avons effectué également nouveaux essais de stabilité, la sensibilité et la reproductibilité de la PLA-AuNPs. Nous avons trouvé que le PLA-AuNPs forment une structure solide de nanoparticules stabilisées en solution aqueuse. Nous avons également observé que la sensibilité améliorée grâce à la plus petite valeur de la résistance (Rct) transfert de charge et une augmentation de la surface active (0,41 cm2). Le développement de notre biocapteur ADN reposait sur la modification d’une électrode de carbone sérigraphié (SPCE) avec PLA-AuNPs et à l’aide de bleu de méthylène (MB) comme indicateur rédox. Nous avons évalué les événements de l’immobilisation et l’hybridation par voltamétrie impulsionnelle différentielle (DPV). Nous avons constaté que complémentaires, non complémentaires et oligonucléotides dépareillées étaient particulièrement distingués par le biocapteur fabriqué. Elle a également montré fiable de sensibilité de détection dans les études de réactivité croisée contre divers pathogènes d’origine alimentaire et dans l’identification de V. parahaemolyticus dans les coques fraîches.

Introduction

Un important sujet de débat public et scientifique au cours des dernières années, l’intoxication alimentaire est principalement associée à 3 principes : microorganismes1, produits chimiques2et parasites3. Des aliments contaminés peuvent provoquer des conséquences graves pour la santé chez les humains, en particulier dans le groupe à risque plus élevé de ceux qui ont un système immunitaire faible, les personnes âgées, les femmes enceintes, bébés et jeunes enfants4. Avec plus de 1 million de cas de diarrhée aiguë survenant chaque année chez les enfants âgés de moins de 5 ans en Afrique, Asie et Amérique latine, l’intoxication alimentaire est une maladie mondiale majeure5,6 , et l’Organisation mondiale de la santé a mis en place microorganismes comme le plus important contributeur7. Vibrio parahaemolyticus se distingue parmi les souches virulentes les plus largement reconnues. Trouve généralement dans des environnements côtiers, estuariens et marins8, c’est une bactérie Gram-négative, qui devenue actif dans des environnements de sels élevées et provoque sérieuse gastro-entérite humaine lorsqu’ils sont consommés dans les marines mal cuit, mal ou cru produits9. En outre, les conditions médicales préexistantes chez certaines personnes rendent sujette à une infection, septicémie ou oreille infection résultant de V. parahaemolyticus10des plaies. Les facteurs de virulence de V. parahaemolyticus hémolysines sont divisés en deux types qui contribuent à la pathogenèse de la maladie : hémolysine directe thermostable (TDH) codées par des gènes de tdh et hémolysine TDH liées codées par des gènes de trh11. Les marqueurs de virulence (gènes tdh et trh) de V. parahaemolyticus sont surtout présents dans les échantillons cliniques plutôt que dans des échantillons environnementaux.

V. parahaemolyticus possède la capacité de survivre dans un large éventail de conditions, répondre rapidement aux changements environnementaux12. Son mécanisme de prolifération s’intensifie son potentiel de danger que sa toxicité augmente en parallèle avec la cellule masse13. Pire encore, le changement climatique offre ces bactéries avec des conditions suffisamment pour accélérer leur de croissance de population de cellule14. En raison de sa haute fréquence, V. parahaemolyticus doit être surveillée le long de la chaîne d’approvisionnement alimentaire, en particulier dans le commerce et la production de fruits de mer étant donné que ces produits sont où ils se trouvent en quantités énormes15,16 dans le monde entier. Actuellement, les bactéries sont identifiés et isolés à l’aide d’un éventail de méthodes, y compris les tests biochimiques, enrichissement et milieux sélectifs17, immunomagnetic-enzymatique sorbant assay (ELISA)18, électrophorèse en champ pulse (PFGE) 19, tests d’agglutination au latex et polymerase chain reaction (PCR) essais20. Ces méthodes exigent habituellement un personnel qualifié, des instruments sophistiqués et techniques laborieuses qui ne fournissent pas d’informations sur la contamination immédiatement. Cela limite fortement la probabilité de détecter promptement contamination nocive et applications sur place. Outils de détection rapide demeurent un défi exceptionnel.

Biodétection s’impose comme une solution prometteuse pour la détection des pathogènes d’origine alimentaire car il offre un gain de temps, économique, pratique et en temps réel analyse méthode21,22,23,24 . Cependant, bien qu’il y a eu de nombreux résultats positifs de l’analyte détection dans des échantillons enrichis et solution standard à l’aide de biocapteurs, il subsiste un manque de recherche appliquée à des échantillons réels dans des mélanges aqueux ou extraits organiques25. Récemment, des biocapteurs électrochimiques utilisant une détection directe et/ou indirecte l’acide désoxyribonucléique (ADN) ont reçu une attention accrue parmi les scientifiques, en raison de leur détection spécifique de la cible complémentaire via une hybridation événement26 , 27 , 28 , 29. ces approches uniques sont plus stables en comparaison de biocapteurs à base d’enzymes, offrant ainsi une technologie prometteuse pour la miniaturisation et de la commercialisation. L’objectif de l’étude ont signalé ici est de construire un outil rapide pouvant détecter V. parahaemolyticus avec haute sélectivité, la sensibilité et praticité, basée sur la spécificité de séquence d’ADN au cours de l’hybridation. Les stratégies d’identification impliquent la combinaison de polylactique acide-stabilisé nanoparticules d’or (PLA-AuNPs)30 et électrodes en carbone sérigraphié (SPCEs) en présence de l’indicateur de l’hybridation, le bleu de méthylène (MB). Le potentiel de la construction de détection avancés est approfondi en utilisant des échantillons de bactéries ADN cockle lysat et fraîche.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Remarque : Tous les réactifs chimiques et biochimiques à utiliser doivent être de qualité analytique et utilisés sans davantage de purification. Préparer toutes les solutions à l’aide de l’eau désionisée stérile. Autoclave toute la verrerie avant la stérilisation.

ATTENTION : S’il vous plaît utilisez toutes les pratiques de sécurité qui s’imposent lors de l’exécution des activités de laboratoire, y compris l’utilisation de contrôles (hotte aspirante, boîte à gants) d’ingénierie et des équipements de protection individuelle (lunettes, gants, blouse, pantalons pleine longueur, fermé-orteil chaussures).

1. fabrication et caractérisation d’électrode modifiée à l’aide de PLA-AuNPs

  1. Préparation et caractérisation des PLA-AuNPs
    1. Rapidement, ajouter 10 mL de solution de citrate de sodium (38,8 mM) à 100 mL de solution d’acide chloraurique aqueuse (1 mM) de bouillante et refroidir jusqu'à température ambiante. Observer les changements dans la couleur de la solution préparée de AuNPs qui commence comme jaune, changements à noirâtre et enfin se termine comme rouge rubis foncé.
    2. Placer les boulettes PLA dans un moule en acier inoxydable pour le processus de fusion et les réchauffer à une température de 190 ° C pendant 10 min. Suivez la procédure de pressage : mettez-les sous une pression de 2,2 MPa pendant 1 min dans le cadre de la préparation de feuille PLA. La feuille PLA sera prête à l’emploi après refroidissement pendant environ 3 h.
    3. En remuant vigoureusement, dissoudre 0,68 mg des feuilles PLA dans 5 mL de chloroforme à température ambiante. Mélanger le PLA dissous avec 10 mL de la solution de AuNPs préalablement préparée et remuez de façon homogène à la température ambiante. Les mélanges homogènes peuvent alors être notés comme PLA-AuNPs et caractérisent par UV-Vis, XRD, TEM et FESEM avec EDX.
  2. Préparation et caractérisation des électrodes de carbone sérigraphié mis à jour le
    Remarque : La SPCE utilisée dans cette étude comprend un système de trois électrodes : une électrode de référence Ag/AgCl, une électrode de travail carbone et une contre-électrode.
    1. Prélever 25 µL de la solution homogène de PLA-AuNPs sur la SPCE et puis l’air de sécher rapidement il pendant 24 h avant son utilisation.
    2. Électrochimiquement caractérisent les électrodes modifiées, SPCE/PLA-AuNPs, dans le cyanure de potassium ferro (K3[Fe(CN)6]3 -/4 -) pour mesurer la superficie active, spectroscopie d’impédance électrochimique, répétabilité, reproductibilité et30de la stabilité.

2. mise au point des biocapteurs électrochimiques ADN

  1. Préparation de la sonde
    Remarque : Les séquences de l’ADN simple brin sonde et ADN complémentaire ont été choisis selon les renseignements fournis par le National Center for database Biotechnology Information (NCBI).
    1. Acheter des oligonucléotides synthétiques (sonde ADN simple brin 20-mer, 20-mer ADN complémentaire, 20-mer mismatched ADN et ADN non-complémentaire 21-mer) sous forme de poudre lyophilisée de laboratoires commerciaux, basée sur les séquences suivantes :
      sonde d’ADN simple brin THIOLÉS : 5′ - / D/5ThioMC6-CGGATTATGCAGAAGCACTG - 3′
      l’ADN complémentaire : 5′ - CAGTGCTTCTGCATAATCCG - 3′
      une base ADN ne correspondent pas : 5′ - CAGTGCTTCTGC ṪTAATCCG - 3′
      trois-base ADN ne correspondent pas : 5′ - CAGTGCTTCT Ċ ṪṪTAATCCG - 3′
      ADN non-complémentaire : 5′ - CGCACAAGGCTCGACGGCTGA - 3′
    2. Préparer les solutions de tous les oligonucléotides (100 µM) en utilisant une solution stérile de TE (10 mM Tris-HCl, EDTA 1 mM, pH 7,5), divisée en sections analytiques. Gardez cela à-4 ° C et puis faire des dilutions appropriées juste avant leur utilisation.
  2. Optimisation de l’immobilisation et l’hybridation
    Remarque : Un SPCE modifié avec PLA-AuNPs, dénoté comme SPCE/PLA-AuNPs, a été utilisé pour cette étude et un procédé de coulage de chute a été utilisée pour l’immobilisation de l’ADN et l’hybridation.
    1. Tout d’abord, immobiliser 25 µL de sonde ADN simple brin THIOLÉS sur la SPCE/PLA-AuNPs et air sécher pendant 24 h à température ambiante, après quoi il sera finalement établie comme SPCE/PLA-AuNPs/ADN simple brin. Déterminer l’optimisation de la condition de l’immobilisation à l’aide de trois facteurs : la concentration d’ADN simple brin (allant de 0,2 à 1,4 µM), temps (allant de 30 à 210 min) et la température (variant de 25 à 75 ° C).
    2. Pipetter 25 µL de l’ADN complémentaire sur la surface de SPCE/PLA-AuNPs/ssDNA pour réaliser l’événement de l’hybridation, après quoi il peut être finalement désigné comme SPCE/PLA-AuNPs/ADN double brin. Déterminer l’optimisation de la condition de l’hybridation via les deux facteurs de température (variant de 25 à 75 ° C) et la durée (allant de 5 à 30 min).
    3. Immerger l’immobilisée et électrodes hybrides à 20 µM MB pendant 30 min. enlever l’ADN non spécifiquement adsorbée et excès MB en lavant avec 0,5 M ABS/20 mM NaCl (pH 4,5), puis rincer avec l’eau désionisée. Mesure du courant de crête de taux de réduction à l’aide de la technique de la DPV. Exécuter la mesure de DPV aide PBS à 0,1 M (pH 7) ne contenant aucun indicateur.
  3. Caractérisation du biocapteur ADN préfabriqué
    1. Immerger la SPCE/PLA-AuNPs à 20 µM MB pendant 30 min, laver avec 0,5 M ABS/20 mM NaCl (pH 4,5) et ensuite rincer à l’eau désionisée avant de mesurer. Suivre une procédure similaire pour toutes les interactions, y compris la sonde ADN, ADN complémentaire, ADN ne correspondent pas et des échantillons d’ADN non complémentaires.
    2. Mesurer la réduction électrochimique.
      NOTE : Nous avons mesuré la DPV utilisant un Autolab fabriqué commercialement avec le logiciel d’interface.
      Les mesures de DPV la réduction électrochimique MB effectué à un potentiel allant de -0,5 V à 0,25 V, avec une étape potentielle de 0,005 V, modulation d’amplitude de 0,05 V et une vitesse de balayage de 7,73 mVs-1 dans du PBS 0,1 M (pH 7), ne contenant aucun indicateur. La sélectivité, la sensibilité, reproductibilité et thermostabilité du biocapteur ADN fabriqué ont été ré-examinées. Résultats rapportés ont été présentés comme moyenne des mesures de valeur en trois répétitions.

3. valider le biocapteur ADN fabriquée à l’aide des échantillons réels

  1. Préparation des souches bactériennes
    1. Prélever des échantillons bactériens basés sur leur contamination importante de fruits de mer31,32 .
      NOTE : V. parahaemolyticus comme des souches de référence et 8 autres souches bactériennes (Campylobacter jejuni, Listeria monocytogenes, Salmonella typhimurium, entérite à Salmonella, pneumonie à Klebsiella de Escherichia coli O157 : H7, Bacillus cereuset Vibrio alginolyticus) de la commune d’origine alimentaire pathogène ont été employés pour la validation de biocapteurs électrochimique ADN dans cette étude.
    2. Mener une sous-culture systématique des souches bactériennes sur leur agar respectif toutes les deux semaines à maintenir leur viabilité, veuillez consulter le tableau 1 pour les conditions de culture.
    3. Maintenir la préservation à long terme des souches bactériennes dans leurs respectifs bouillons croissants contenant 20 % (v/v) de glycérol à-80 ° C comme le glycérol protège des bactéries en empêchant la formation de cristaux de glace qui peut les abîmer pendant le processus de congélation. Ensuite, une boucle de la culture de cellule bactérienne préservé dans les stocks de glycérol ensemencer les bouillons respectifs. Incuber les bouillons selon leur croissance respective le temps et la température lorsque nécessitant de faire revivre les bactéries.
    4. Déterminer la quantité de V. parahaemolyticus les cellules à l’aide d’une propagation plaque technique33, une norme et une méthode bien connue pour la numération des microorganismes dérivés d’une série de dilutions.
      1. La culture V. parahaemolyticus dans un bouillon Trypticase soja (TSB + 3 % NaCl) à 37 ° C dans un état d’agitation 140 tr/min. Ensuite, transférer 1 mL de la culture cellulaire de bactéries dans 9 mL de TSB + 3 % NaCl pour obtenir un facteur de dilution 10-1 .
    5. Répétez cette étape neuf fois pour obtenir une série complète de facteur de dilution de 10-10 . Répandre ensuite, 0,1 mL de chaque facteur de dilution (à partir de 10-1 à 10-10) sur gélose sélective d’un Vibrio pour colonie comptant, respectivement. Incuber les plaques incubés à 37 ° C pendant 24 h.
    6. Utiliser un compteur de colonies pour dénombrer les colonies individuelles et dos-Calculez (comte le montant CFU/éjectant x facteur de dilution) pour obtenir une unité formant colonie par millilitre densité (CFU mL-1). Calculer la concentration de la colonie formant des unités (UFC) dans les suspensions cellulaires de bactéries de la parcelle de calibrage de CFU mL-1 contre l’absorbance.
  2. Préparation de la PCR
    1. Extraire l’ADN génomique suite a mis à jour le bouilli lyse procédure34. Tout d’abord, strie un bactériennes individuelles souche sur milieux gélosés et il inoculer en bouillons, suivie de l’incubation à sa condition de croissance relative, un 140 tr/mn, secouant la condition.
    2. Pipeter une culture 1 mL de bouillon dans un tube à centrifuger micro. Cela centrifuger à 4830 x g et 4 ° C pendant 1 min obtenir des boulettes. Utiliser environ 500 µL de tampon TE stérile pour la remise en suspension avec le culot. Tenir la suspension qui en résulte pendant 10 min à 98 ± 2 ° C dans un bloc chauffant et le refroidir immédiatement à-18 ° C pendant 10 min lyser les cellules et de libérer l’ADN.
    3. Centrifuger l’ADN génomique à 4830 x g et 4 ° C pendant 3 min obtenir une suspension claire et garder le liquide surnageant à-20 ° C pour une utilisation ultérieure. Utiliser une mesure de biophotometer avec l’absorption UV à une longueur d’onde de 260 nm (comme les acides nucléiques absorption de longueur d’onde de la lumière) et aussi à une longueur d’onde de 280 nm (comme les protéines, absorption de longueur d’onde de la lumière) pour déterminer la concentration et la pureté de l’extrait l’ADN génomique puis identifiez toutes les souches à l’aide des épreuves biochimiques standard35 et leur vérification par 16 s rRNA gene séquençage36. Enfin, dénaturer l’ADN génomique à 92 ° C pendant 2 minutes et refroidir rapidement dans l’eau glacée avant l’application sur le biocapteur.
    4. Confirmer la présence de V. parahaemolyticus par PCR pour cibler le gène toxR. Exécutez cette procédure dans un thermocycleur à l’aide d’une paire d’amorces (5'-GTCTTCTGACGCAATCGTTG-3' et 5'-ATACGAGTGGTTGCTGTCATG-3'). Optimiser l’amplification par PCR dans un volume de réaction totale de 25 µL consistant en eau stérile (15,5 µL), tampon (5 µL), primer (1 µL, 10 µM), Mélange dNTP (1 µL), matrice d’ADN (2 µL) et l’ADN polymérase Taq (0.2 µL, 10 x).
    5. Bien mélanger les composants et organiser l’amplification par PCR de la séquence cible dans un thermocycleur programmé pour 30 cycles d’amplification. Dans notre étude, chaque cycle consistant en trois étapes des réactions, c’est à dire., dénaturation initiale (94 ° C, 3 min) suivie de 30 cycles de dénaturation (94 ° C, 1 min), recuit (63 ° C, 1,5 min) et extension (72 ° C, 1,5 min), suivi d’une extension finale (72 ° C, 7 min).
    6. Déterminer les produits amplifiés et leurs tailles par électrophorèse sur gel d’agarose de 1,5 %. Capturer les images de gel avec un système de gel-documentation disponible dans le commerce.
  3. Préparation des échantillons de cockle
    1. Obtenir des échantillons frais.
      NOTE : Nos coques fraîches (Anadara granosa) ont été obtenus à partir du marché humide dans Serdang, Selangor et apportés rapidement au laboratoire dans une boîte de refroidisseur de glace pour analyse. Diviser les échantillons en 2 groupes, à savoir le groupe traité et non-traités, en supposant que les coques ont été récoltés uniformément dès le début de la récolte jusqu'à ce que vous les placez dans l’entreposage au froid.
    2. Traiter les coques dans le groupe traité en les stockant à-20 ° C pendant 24 h, suivie d’une exposition aux rayons ultraviolets à 20 ° C pendant 4 h avant l’extraction de l’ADN.
      Remarque : La température de congélation et l’exposition aux ultraviolets utilisés pour les contrôlés groupe tue ou au moins limite l’accumulation naturellement V. parahaemolyticus dans les coques. Ne pas appliquer un régime supérieur de pasteurisation de 70 ° C car la condition contrôlée dans la présente étude vise à imiter la réalité des coques fraîches. Pendant ce temps, analyser des échantillons prélevés directement dans le groupe non traité sans aucun traitement préalable dès qu’ils arrivent au laboratoire.
    3. Repiquer une souche de V. parahaemolyticus ATCC 17802 au BST (3 % NaCl). Déterminer le niveau de cellules viables dans l’inoculum par électrodéposition des dilutions appropriées du BST (3 % NaCl) sur autorité de certification afin d’obtenir un inoculum de 10 mL UFC4 -1 de V. parahaemolyticus. Lavez chaque coque dans l’eau distillée et frottez-le pas d’impuretés avant d’utiliser une pince stérile dans une enceinte à flux laminaire pour enlever les tissus de la coquille.
    4. Homogénéiser les environ 10 g d’échantillons de tissus de cockle avec un homogénéisateur 90 ml de TSB stérile (3 % NaCl) pendant 60 s. Ajouter une quantité connue de V. parahaemolyticus dans 9 mL de bouillon échantillon homogénéisé pour les échantillons enrichis. Utilisez les échantillons enrichit comme témoin négatif. Estimer le nombre de cellules de V. parahaemolyticus dopés sur les échantillons de cockle par l’ensemencement de 0,1 mL des échantillons sur CA, et par la suite, pipette 1 mL d’échantillons dans un tube de microcentrifuge ADN goûter l’extraction, à utiliser dans le biocapteur et test de PCR.
    5. Extraire l’ADN génomique de la V. parahaemolyticus dans les échantillons enrichis et enrichit suite à une modification de bouillie lyse procédure36. Enfin, déterminer la concentration d’ADN et de la pureté à l’aide d’une mesure de photomètre bio avec absorption UV à une longueur d’onde de 260 nm (comme les acides nucléiques absorption de longueur d’onde de la lumière) et aussi à une longueur d’onde de 280 nm (comme les protéines, absorption de longueur d’onde de la lumière).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Formation de AuNPs a été révélée par le changement de couleur de la solution aqueuse avec du citrate de sodium présent. Cela a provoqué la couleur changer du jaune clair au rouge rubis profond. La génération de PLA-AuNPs a été confirmée dans les spectres UV-vis (Figure 1) où la croissance du pic surface plasmon resonance (SPR) a été trouvée à environ 540 nm. La formation et l’existence de PLA-AuNPs a été indiqué aux gammes de longueur d’onde 500-600 nm, selon la taille de particule37. Les patrons de DRX de AuNPs et PLA-AuNPs sont indiquées à la Figure 2. Tous les pics de cristallites ont été observés à la 2θ de 31,7 38,2, 44,4, 64,7 et 77,7 °. Ils ont été attribués à la (100) (111) (200) (220), et nanostructures (JCPDS dossier no-00-004-0783) (311) plans cristallographiques d’or cubique-FCC (cubique faces centrées) (en métal). Les intensités maximales de PLA-AuNPs cristallites a également augmenté en un pic de diffraction plus large centré à 31,7 °, ce qui implique que les AuNPs ont été incorporés dans le PLA et suggérant la formation de polyphasic nanostructures or38. En outre, tous les pics de diffraction AuNP montrés sur la PLA-AuNPs a indiqué que l’AuNPs avait une structure stable. La taille moyenne des PLA-AuNPs a été calculée en utilisant l’équation de Scherrer (L = kλ/βcosθ), de déterminer la largeur de la réflexion de la Bragg (100). De la FWHM et d-espacement (tableau 2), la taille de cristallites de PLA-AuNPs a été calculée que 27 nm.

Les dimensions de la PLA-AuNPs et sa morphologie ont été étudiées plus loin à l’aide de TEM. De la courbe de distribution des particules TEM et les images de PLA-AuNPs, il a été observé que les nanoparticules d’or sont presque sphériques en forme (Figure 3). La taille des nanoparticules se situait dans la fourchette d’environ 37 nm, légèrement plus grand qu’obtenu par formule de Scherrer, suggérant une nature polycristalline des nanoparticules synthétisées comme39. Petite taille résultant de DRX contrairement à TEM a aussi observé dans des recherches antérieures, très probablement parce que la structure de la particule est polycristallin dans la nature en raison de la quantité importante de petits cristaux qui sont plus petites (les particules)40 . La figure 4 montre l’image FESEM de PLA-AuNPs préparés comme sur SPCE. Il ressort clairement de la FESEM images et des spectres EDX que la SPCE/PLA-AuNPs avait le plus fort pourcentage de poids d’or, la plus grande densité et de plus grande surface de couverture de nanoparticules. On peut également noter, en particulier, que Figure 4(a) montre l’image FESEM d’un nu SPCE. L’image FESEM dans la Figure 4(b) montre bien réparties PLA-AuNPs. Pour affirmer la composition chimique des PLA-AuNPs synthétisés, EDX a été utilisée pour étudier la composition chimique de la production PLA-AuNPs, conformément à la Figure 4(a)et 4(b). Le spectre EDX a confirmé que les production PLA-AuNPs étaient composés de l’or (Au) seulement et n’affiché aucun autre élément sauf le pic correspondant en carbone (C) et oxygène (O). La présence du pic C résultait de l’électrode de carbone sur lequel l’échantillon a été baisse cast.

Le spectre EDX également a montré la présence d’O indiquant que l’oxygène est adsorbé sur l’électrode de carbone parce que le film a été exposé à l’air. Cela confirme que l’oxygène est adsorbé sur des nanotubes de carbone si elles sont exposées à l’air pour une longue période de41. Il existe différentes molécules de gaz dans l’air, l’oxygène était considéré comme la principale adsorbée sur les exposés à l’air carbon nanotubes42, probablement à cause de son adsorption plus rapide par rapport aux autres molécules43. Cela reposait sur la recherche que l’oxygène a été la principale adsorbée sur l’électrode de carbone au cours de l’exposition à l’air pendant la nuit dans la préparation des échantillons et renforcé la pureté chimique de la PLA-AuNPs. Le ratio du pic anodique et cathodique (j’aipa/ipc) a été presque 1, qui a donné à potentiel constant de pointe comme l’analyse taux accrus de44. En outre, les potentiels de pointe anodique et cathodique correspondaient à balayage différents taux45 suggérant que la réaction électrochimique réversible fondée sur la crête de séparation (Figure 5). La surface active de l’électrode modifiée a été calculée en utilisant l’équation de Randles-Sevick (j’aipc = (2,69 × 105) n3/2 AD1/2 Cv1/2. De la pente de la courbe j’aipc par rapport à v1/2 dans la Figure 5(a) et (b), la surface des électrodes correspondait à 0,26 cm2 et 0,41 cm2 pour le nu SPCE et PLA-AuNPs, respectivement. Ce résultat confirme que l’amélioration offerte par PLA-AuNPs sur la surface active a été relativement plus élevée comparée à SPCE nu. Le résultat dérivé était comparable à celle d’or enrobées polymère nanoparticules (matrice β-CD-EDAS(N-[3-(trimethoxysilyl)propyl]ethylene-diamine encapsulé de nanoparticules d’or), qui a révélé qu’une grande surface active amélioré le processus de transfert d’électron et a donc entraîné meilleure sensibilité46.

La réaction électrochimique SPCE modifiée était dans un processus de diffusion contrôlée, illustré par une réduction dans le K3[Fe(CN)6]3 -/4 - courant de crête, qui à son tour s’est appuyée sur le courant de la racine de square de taux de balayage (v 1/2). Pour obtenir une meilleure vue des propriétés électrode modifiée, une étude de spectroscopie (SIE) impédance électrochimique a été réalisée pour mettre en corrélation avec les performances de l’électrode modifiée présentée en termes de mesures de CV. La section de demi-cercle vue à hautes fréquences en corrélation avec le processus limitant le transfert d’électrons dans l’EIE. La résistance de transfert de charge (Rct) a été mesurée directement le diamètre du demi-cercle. Ce résultat a compilé avec la valeur de Rct de la SPCE nu, qui était Ω de 1932, et où la modification de SPCE/PLA-AuNPs diminué de 1444 Ω (Figure 6). La diminution de la valeur de REC SPCE/PLA-AuNPs ont pu une diminution constante diélectrique locale et/ou une augmentation de l’épaisseur de la double électrique couche47, ce qui laisse supposer que K3[Fe(CN)6]3 - /4 - fonction par adsorption à l’interface métal/solution. Ces sorties respecté celles dérivées de la mesure des CV (Figure 7). Les courants de pointe augmente progressivement avec la modification des SPCEs à l’aide de PLA-AuNPs, qui montrent qu’une sensibilité plus élevée est l’inverse de la basse Rct48. Ainsi, l’augmentation de la valeur du CV des électrodes modifiées et la diminution des valeurs dect R peut-être due à la substitution progressive des molécules d’eau (le volume des molécules d’eau est 27,19 Å3) par l’adsorption des K3 [Fe(CN)6] 3 -/4 - sur la surface du métal, réduisant l’ampleur de la réaction de dissolution49.

Le tableau 3 indique l’écart type relatif (RSD) de la répétabilité et la reproductibilité de l’électrode modifiée. Enregistrement de CV systématique de K3[Fe(CN)6]3 -/4- a été faite pour six jeux consécutifs enquêter sur la répétabilité des électrodes modifiées. Le RSD de SPCE/PLA-AuNPs a été dérivé comme 4,26 %. L’électrode avec PLA-AuNPs modification a donné RSD mieux après plusieurs mesures. En outre, en utilisant la même procédure, six électrodes modifiées ont été indépendamment fabriqués, qui a donné des valeurs de 4,05 % RSD pour SPCE/PLA-AuNPs, indiquant la meilleure reproductibilité de la fabrication d’électrodes pour PLA-AuNPs. Mis à jour le substrat selon PLA-AuNPs a été maintenu à 37 ° C pour une durée prolongée. Il était également utilisé pour l’enregistrement de 20 cycles et une diminution de 18 % qualité du signal. Afin d’atteindre le maximum de sortie du biocapteur, période d’immobilisation, de température, avec concentration d’ADN simple brin et les critères d’hybridation ont été examinés. Ces conditions requises pour être optimisé, puisqu’elles influencer le courant de crête de la DPV. Pour optimiser la concentration de l’ADN simple brin, SPCE/PLA-AuNPs a été reversé à différente concentration (0,2, 0,4, 0,6, 0,8 1,0, 1,2 et 1,4 µM) d’ADNsb pendant 60 min afin que la concentration optimale d’ADN simple brin a été déterminée. Basé sur la Figure 8, le courant de crête DPV augmenté que des concentrations plus élevées d’ADN ont été utilisées. L’étude a également révélé que la concentration optimisée de l’ADN était 1,2 µM ADN simple brin.

Afin d’optimiser la période d’immobilisation mettant en cause l’ADN monocaténaire SPCE/PLA-AuNPs, 25 µL d’ADN simple brin (1,2 µM) ont été testées sur des moments différents (30, 60, 90, 120, 150, 180 et 210 min). Dans la Figure 9, les résultats montrent une augmentation en période d’immobilisation ayant pour résultat l’augmentation continue de la courant de crête DPV. Ainsi, le temps d’immobilisation optimale de l’ADN simple brin a été choisi comme 180 min. Afin d’optimiser la température de l’immobilisation, la SPCE/PLA-AuNPs a été reversé à ADN simple brin (1,2 µM) à différentes températures (75, 65, 55, 45, 35 et 25 ° C) pendant 180 minutes. Nous avons constaté que lorsque la température de l’immobilisation a été augmentée à 55 ° C, le courant de crête DPV est aggravée au départ suivie d’une dépréciation ultérieure (Figure 10) ; ainsi, 55 ° C a été choisi comme la température d’immobilisation optimisé pour être utilisé dans des expériences ultérieures. Séparation de l’ADN simple brin qui est immobile à la surface de l’invalidité de l’électrode et l’hybridation a été causée par l’augmentation des températures. Il y a eu des autres rapports semblables résultats50. Plus vite le fractionnement et la dégénérescence de l’ADN de la surface des nanoparticules d’or est survenu plus élevée des températures51. Des recherches menées récemment signalé que le lien entre l’or et des thiols s’oxyde se dégrade rapidement et simplement dans une situation qui est ambiante, par exemple lorsqu’il est exposé à l’eau, l’air et lumière52,53,,54. L’effet du temps de l’hybridation a aussi examiné dans cette étude.

Le mécano SPCE/PLA-AuNPs/ADNsb était goutte-cast avec une solution d’ADN cible (0,2 µM) à une hybridation différente temps (5, 10, 15, 20, 25 et 30 min). La réponse de la DPV rose évidemment, avec une augmentation de 5 min de temps d’incubation (de 5 à 10 min) (Figure 11). Une fois que cette valeur a été obtenue, un modèle à la baisse de 10 à 30 min a été observé pour la durée souhaitée pour l’hybridation a été choisie comme 10 min. L’efficacité de l’hybridation augmente avec une augmentation de température de 25 ° C à 35 ° C (Figure 12). La forte intensité a semblé diminuer lentement à une température supérieure à 35 ° C. La raison de ceci a été attribuée à la dénaturation par la structure du "sandwich" réduire le signal de détection. Par conséquent, la température d’hybridation optimale sélectionnée a été 35 ° C. Le processus que nous avons utilisé dans la détection de que v. parahaemolyticus composé AuNPs pour améliorer la surface active de l’électrode de travail, PLA à la médiation de la modification de la surface et le redox complex, MB, à réduit à LB. Le résultat de ce processus d’oxydation était une meilleure affinité entre ADN simple brin et MB55. Le DPV actuel a été diminuée en raison de la diminution du nombre de molécules de MB attachés au cours de l’hybridation de l’ADN simple brin avec sa séquence complémentaire.

Nous avons effectué davantage enquêtes sur les performances du biocapteur développé. Les résultats DPV Figure 13 montrent qu’il était capable de distinguer sélectivement la sonde ADN, ADN complémentaire, celui-base ADN ne correspondent pas, trois-base ADN ne correspondent pas et l’ADN non complémentaires en présence de MB comme la détection étiquette56, 57. le courant de pointe le plus bas (0,73 µA) a été exposé par l’ADN complémentaire, qui a lentement augmenté celui-base ADN ne correspondent pas (0,94 µA), trois bases correspondent pas ADN (1,05 µA), ADN non complémentaires (3,25 µA) et sonde ADN (4,79 µA). L’ADN cible actuelle était la plus petite de tous les courants de séquences oligonucléotidiques permettant notre biocapteur à discriminer entre les séquences d’oligonucléotides avec sensibilité et plus précisément. Mo se lie fortement avec l’ADN simple brin de sonde immobilisée ADN produisant un courant de crête DPV grand. SPCE/PLA-AuNPs/non-ADN complémentaire réduit l’ADN de la sonde immobilisée actuel de près de la moitié en seulement une petite quantité de Mo monté sur la surface du SPCE/PLA-AuNPs/ADN double brin. Cela est susceptible d’être due à des interactions inaccessibles entre Mo et guanine bases. Les modes d’interaction de l’ADN et MB sont fortement dépendants des conditions expérimentales que pH, température, concentration d’ADN, force ionique et type de tampon58,59. MB Liens communément à ADN double brin par rainure et modes d’intercalation, aboutissant à l’accumulation de MB sur le dsDNA surface60. L’exposition de notre capture sonde ADN à celui-base ADN ne correspondent pas et trois-base ADN ne correspondent pas systématiquement réduit courants maxima DPV et l’ADN cible complémentaire a continué cette tendance. Le tableau 4 montre le pourcentage du taux de sélectivité pour MB pic actuel. Notre conclusion générale que hybridation du biocapteur ADN construit était hautement sélective via la sonde immobilisée ADN sur la surface de la SPCE/PLA-AuNPs.

La sensibilité du biocapteur ADN développé a été étudiée plus loin avec différentes concentrations d’oligonucléotides cibles. La figure 14 montre l’épuisement progressif du courant de crête DPV de Mo sur la SPCE/PLA-AuNPs comme la concentration d’ADN complémentaire a augmenté. Figure 15 présente un coefficient de régression linéaire de 0,96 qui a été généré entre le journal de courant de crête de MB réduit et le journal de plusieurs concentration cible ADN (12:02 à 0,02 mM). Un graphique des changements actuels PIC (ΔP) a été tracé à l’aide de la formule 3σ/m (σ est l’écart-type de solution vide et m est la pente de la courbe linéaire)61,62,63. La limite de détection du biocapteur ADN fabriquée a été calculée à 16:43 qui était plus grande que notre plus petit en fait mesurer l’échantillon. Ce résultat est en accord avec le fait que ΔP à 12:02 et 14:00 (2,65 × 10-6 A et 2,81 × 10-6 A) avec un écart de 1,19 × 10-7 A et 1,06 × 10-7 A, respectivement, se chevauchent.

Pour calculer la limite de dosage pour le biocapteur ADN fabriqué, nous avons utilisé la formule de 10σ/m dans laquelle (σ est l’écart-type de solution vide et m est la pente de la courbe linéaire) et trouvé le résultat comme un gain de 14:08. Répétées de dénaturation de l’ADN complémentaire a été réalisée afin d’évaluer le biocapteur d’ADN en fonction de sa capacité de régénération. Nous l’avons fait incubation électrode de modifiée ADN complémentaire de 0,2 µM dans l’eau chaude à 86 ° C pendant 8 min pour dénaturer l’ADN double-brin, suivie d’un refroidissement rapide dans un bain de glace pour maintenir le dénaturé d’ADN monocaténaire64.

L’activité de l’hybridation a été maintenue à 91 % de sa réponse initiale après 8 tentatives de régénération (n = 5, RSD = 4,05 %). Le biocapteur ADN basé sur la méthode de SAM pour l’immobilisation de sonde ADN sur SPCE/PLA-AuNPs a été très stable, parvenir à une bonne réponse dans la détection de l’ADN complémentaire après le processus de dénaturation répétées. La stabilité de notre biocapteur ADN concernant la chaleur a été étudiée plus avant. Pour ce faire, nous avons stocké l’électrode PLA-AuNPs/SPCE/ADNsb à une température de 4 ° C, 25 ° C et 45 ° C dans un sachet aluminium hermétique contenant des gels de silice. Au bout de 6 mois, nous avons évalué l’ADN complémentaire et estime le pourcentage de récupération de la production du signal. Figure 16 montre que la sonde SPCE/PLA-AuNPs/ADNsb était très stable avec plus de 80 % de son signal initial encore récupérable après mois 6. La forte réaction entre PLA-AuNPs et ADN simple brin s’est avérée pour avoir une stabilité à long terme à une température inférieure à 45 ° C.

Neuf espèces différentes de bactéries (b. cereus, L. monocytogenes, C. jejuni, e. coli O157 : H7, V. alginolyticus, Salmonella typhimurium, entérite S., K. pneumonie et V. parahaemolyticus) ont été examinés par la détection par PCR. Les produits d’amplification PCR pour la détection spécifique à l’espèce de V. parahaemolyticus de la culture de bactéries sont indiquées sur la Figure 17. Le gène toxR de V. parahaemolyticus a été utilisé comme amorce PCR pour V. parahaemolyticus identification en raison de sa présence dans les isolats pathogènes. De l’analyse PCR, V. parahaemolyticus a montré des résultats positifs en raison de la spécificité de l’amorce PCR du gène toxR vers V. parahaemolyticus. Aucun produit PCR d’autres souches bactériennes ont été détectés. Le DPV courant de crête obtenu après qu’une évaluation de la réactivité croisée ont montré très clairement détection de V. parahaemolyticus en comparaison avec d’autres espèces de bactéries, comme illustré à la Figure 18. Le signal DPV a augmenté le nombre de paires de base a diminué, en raison de la plus grande quantité de molécules MB lié pour les sondes. V. parahaemolyticus pouvaient clairement discriminés depuis les autres pathogènes d’origine alimentaire qui a reproduit l’environnement de l’échantillon d’aliment.

Coques ont été sélectionnés comme des échantillons réels pour la validation de biocapteur ADN dans cette étude, car ils sont des ingrédients populaires dans plusieurs types d’aliments locaux. Il est bien connu que des coques brutes portent souvent pathogène V. parahaemolyticus et peut transmettre ces bactéries à l’homme, surtout s’ils sont insuffisamment réfrigérées pendant le stockage après la récolte65. Le groupe traité d’échantillons de cockle était stocké à-20 ° C pendant 24 h et exposé à la lumière UV à 20 ° C pendant 4 h avant l’extraction de l’ADN au cours de notre étape de prétraitement. Figure 19 montre que l’analyse PCR V. parahaemolyticus dans les deux échantillons traités et non traités (pointes). Ceci est démontré dans voie 7, 8, 9, 10, 11 et 12 en corrélation avec la colonie compte dans la discussion précédente. Aucun V. parahaemolyticus apparaît dans les échantillons (enrichit) traités et non traités, comme dans Lane 1, 2, 3, 4, 5 et 6 dans les résultats PCR bien que le comptage des colonies a fait indiquer sa présence dans les échantillons. Une raison possible est la présence de contamination des métabolites comme protéine dans les extraits d’ADN66.

Figure 20 résume les résultats de détection utilisant le biocapteur ADN développé, qui ont conclu avec succès la présence de V. parahaemolyticus dans le groupe traité, consistant en des échantillons enrichis et enrichit. Ces résultats sont corrélés positivement avec les résultats PCR décrite précédemment. Tous les échantillons de la PCR qui a montré des résultats positifs a été découvert en utilisant la technique de biocapteurs électrochimiques PLA-stabilisé, qui est axée sur les AuNP, et la surface du pic DPV clairement correspondu avec les bandes d’intensité ACP qui en résulte (Figure 19 et Figure 20). Ces résultats indiquent que le capteur électrochimique-à base de nanoparticules suggéré dans cette étude détecté V. parahaemolyticus avec succès dans les échantillons réels, prouvant ainsi qu’il est supérieur à PCR sans effet sur l’authenticité des résultats.

Figure 1
Figure 1 : Absorbance de PLA-AuNPs S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Spectre de diffraction des rayons x de PLA-AuNPs. Adapté avec autorisation de Réf. [30]. Droit d’auteur (2016) Sociedade Brasileira de Química. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Distribution des diamètres fréquence TEM et images de PLA-AuNPs à une mesure à l’échelle de 50 nm. Réimprimé avec la permission de Réf. [30]. Droit d’auteur (2016) Sociedade Brasileira de Química. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : EDX spectres et images FESEM de (a) nus SPCE et b SPCE/PLA-AuNPs. Réimprimé avec la permission de Réf. [30]. Droit d’auteur (2016) Sociedade Brasileira de Química. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Le complot d’oxydation courant crête contre la racine carrée de balayage taux et les voltampérogrammes cycliques : (a) nus SPCE et b SPCE/PLA-AuNPs à 1,0 mmol L-1 K3[Fe(CN)6] (pH 7). Les taux de balayage étaient 300, 250, 200, 150, 100 et 50 mV s1. Adapté avec autorisation de Réf. [30]. Droit d’auteur (2016) Sociedade Brasileira de Química. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 6
Figure 6 : Spectres d’impédance des électrodes modifiées dans 1,0 mmol L-1 K 3 [Fe(CN)6] (pH 7). Amplitude : 5 mV et bande passante : 0,1-105 Hz. adapté avec la permission de Réf. [22]. Copyright Elsevier (2016). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 7
Figure 7 : Courant de crête anodique de modifiés électrodes à 1,0 mmol L-1 K 3 [Fe(CN)6] (pH 7) à une vitesse de balayage de 0,1 V s -1 à l’aide de mesures de voltampérométrie cyclique S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 8
Figure 8 : Effet de la concentration pour l’immobilisation de l’ADN simple brin sur SPCE/PLA-AuNPs à 0,1 mol L-1 PBS (pH 7) au taux de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 9
Figure 9 : Effet du temps d’immobilisation ADNsb sur SPCE/PLA-AuNPs à 0,1 mol L -1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 10
Figure 10 : Effet de la température d’immobilisation ADNsb sur SPCE/PLA-AuNPs à une vitesse de balayage de 0,1 V s -1 à 0,1 mol L -1 PBS (pH 7) après une période d’incubation de 30 min à 20 µM de Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 11
Figure 11 : Effet du temps de l’hybridation sur SPCE/PLA-AuNPs/ADNsb à 0,1 mol L -1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 12
Figure 12 : Effet de la température d’hybridation sur SPCE/PLA-AuNPs/ADNsb à 0,1 mol L -1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle. Réimprimé avec la permission de Réf. [22]. Copyright Elsevier (2016). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 13
Figure 13 : Histogramme du pic actuel à l’aide de différents types d’ADN à 0,1 mol L réduction MB 1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM MB. L’encart illustre voltampérogrammes d’impulsions différentielles dans les mêmes conditions. Réimprimé avec la permission de Réf. [22]. Copyright Elsevier (2016). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 14
Figure 14 : Histogramme du pic actuel à l’aide de différentes concentrations d’ADN à 0,1 mol L réduction MB 1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle. Réimprimé avec la permission de Réf. [22]. Copyright Elsevier (2016). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 15
Figure 15 : Un tracé linéaire de la réduction maximale actuelle de Mo contre le logarithme de la concentration d’ADN différents à 0,1 mol L -1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle. Réimprimé avec la permission de Réf. [22]. Copyright Elsevier (2016). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 16
Figure 16 : Effet de l’hybridation différentes températures sur SPCE/PLA-AuNPs/ADNsb à 6 mois d’intervalle de stockage (n = 3). Les mesures ont été effectuées dans 0,1 mol L-1 PBS (pH 7) à une vitesse de balayage de 0,1 V s-1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle. Réimprimé avec la permission de Réf. [22]. Copyright Elsevier (2016). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 17
Figure 17 : Gel d’Agarose électrophorèse-l’amplification d’à l’aide de produits de le séquençage des gènes d’ARNr 16 s de bactéries sélectionnées de la culture de bactéries. M: Lane échelle d’ADN de 1Ko, Lane C−: témoin (eau distillée stérile), Lane c + négatif : contrôle positif (l’ADN extrait des e. coli est utilisé en tant que modèle), Lane ce : e. coli O157 : H7, Lane CJ : c. jejuni , Lane BC : B. cereus, KP Lane : K. pneumonia, Lane ST : S. typhimurium, Lane LM : L. monocytogenes, Lane SE : entérite de S., Lane VP : V. parahaemolyticus et VV Lane : V. alginolyticus s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 18
Figure 18 : Histogramme du pic actuel pour l’étude de la réactivité croisée du biocapteur ADN contre divers pathogènes d’origine alimentaire à 0,1 mol L réduction MB -1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle. Réimprimé avec la permission de Réf. [23]. Droit d’auteur (2017) Springer. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 19
Figure 19 : Produits d’amplification de PCR-électrophorèse sur Agarose gel de V. parahaemolyticus d’échantillons de cockle fraîches. Lane M: 2ul d’échelle d’ADN PB 100, Lane 1-3 : non traitée enrichit échantillons, Lane 4-6 : échantillons enrichit, piste 7-9 traités : non traitées des échantillons enrichis, Lane 10-12 : traités échantillons fortifiés, Lane c + : contrôle positif (V. parahaemolyticus ATCC 17802), Lane C- : témoin (eau distillée stérile) négatif. Réimprimé avec la permission de Réf. [23]. Droit d’auteur (2017) Springer. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 20
Figure 20 : Histogramme du pic actuel pour la détection de réduction MB V. parahaemolyticus dans les échantillons de cockle frais en utilisant le biocapteur ADN à 0,1 mol L-1 PBS (pH 7) à une vitesse de balayage de 0,1 V s-1 après 30 min d’incubation à 20 µM Mo à l’aide de mesures de voltamétrie impulsionnelle différentielle. Réimprimé avec la permission de Réf. [23]. Droit d’auteur (2017) Springer. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Composition de l’électrode Temps d’incubation (h) Température (° C) Milieux de culture
Campylobacter jejuni 48 42 BA / BB
Listeria monocytogenes 48 30 TSA / TSB
Salmonella typhimurium 24 37 TSA / TSB
Salmonella enteritidis 24 37 TSA / TSB
Pneumonie de Klebsiella 24 37 EMBA / BST
Escherichia coli O157 : H7 24 37 MA / BST
Cereus Bacillus 24 37 MYPA / BST
Vibrio alginolyticus 24 37 TSA + NaCl NaCl/TSB+3% 3 %
Vibrio parahaemolyticus 24 37 CA/TSA+3% NaCl/TSB+3% NaCl

Tableau 1 : Culture conditions de bactéries sélectionnées.

Échantillon Pos. [° 2ème.] FWHM [° 2ÈME.] d-espacement [Å] Taille de cristallites (nm)
PLA-AuNPs 31.682 0.3149 2.8243 27

Tableau 2 : La taille des PLA-AuNP cristallites. Adapté avec la permission de Réf. [30]. Droit d’auteur (2016) Sociedade Brasileira de Química.

Électrode modifiée % RSD (n = 6) Réduction du signal (%) (n = 20)
Répétabilité Reproductibilité
SPCE/PLA-AuNPs 4.26 4.05 18

Tableau 3 : propriétés des électrodes modifiées relatives à la modification de AuNPs et PLA-AuNPs dans K 3 [Fe(CN)6] avec 1,0 mmol L -1 concentration à une vitesse de balayage de 0,1 V s -1 . Adapté avec autorisation de Réf. [30]. Droit d’auteur (2016) Sociedade Brasileira de Química.

Composition de l’électrode J’aipa (µA) Epa Taux de sélectivité (%)
(n = 3) (V)
SPCE/PLA-AuNP/sonde ADN 4.79 ± 0,10 -0,46 -
SPCE/PLA-AuNP/non-ADN complémentaire 3.25 ± 0,12 -0,44 67.85
SPCE/PLA-AuNP/3-bases ADN ne correspondent pas 1.05 ± 0,11 -0,45 21.92
SPCE/PLA-AuNP/1-base ADN ne correspondent pas 0.94 ± 0,12 -0,46 19.62
ADN SPCE/PLA-AuNP/complémentaire 0,73 ± 0,10 -0,45 15.24

Tableau 4 : sélectivité DPV de MB pic de courant à 0,1 mol L -1 PBS (pH 7) à une vitesse de balayage de 0,1 V s -1 après 30 min d’incubation à 20 µM MB

Composition des électrodes Méthode de détection Gamme de linéarité (M) Limite de détection (M) Références
AuNPs 3D DPV 1,5 × 10-6 - 7.0 × 10-9 2.0 × 10-10 69
(+) AuNPs DPV 1,0 × 10-9 - 1,5 × 10-12 2,6 × 10-12 70
AuNPs/GR DPV 1,3 × 10-9 - 2,5 × 10-11 8,3 × 10-12 71
AuNPs-ADH-GSs DPV 5,0 × 10-8 - 3.0 × 10-13  3.0 × 10-13 72
AuNPs-MPTS DPV 5,0 × 10-9 - 1,0 × 10-11  5,0 × 10-11 73
AuNPs – GO DPV 1,0 × 10-9 - 1,0 × 10-14 3,5 × 10-15 74
CoS / AuNPs DPV 1,0 × 10-9 - 1,0 × 10-12 7.0 × 10-13 75
PLA-AuNPs DPV 2.0 × 10-8 - 2.0 × 10-13 5.3 × 10-12 Ce travail

Tableau 5 : Comparaison de certains de la nanodétecteurs récemment mis au point des ADN électrochimique. Réimprimé avec la permission de Réf. [22]. Droit d’auteur (2016) Elsevier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Les étapes essentielles dans un cadre de mise au point de ce type de biocapteurs électrochimiques sont le choix des éléments de reconnaissance biologique approprié pour le transducteur (acide nucléique ou ADN ici) ; approche chimique pour la construction de la couche sensible du capteur ; matériel de transduction ; optimisation de l’immobilisation de l’ADN et l’hybridation ; et la validation de la biocapteur développé en utilisant des échantillons réels.

De base de la réussite d’un biocapteur ADN électrochimique sélectif et sensible, est l’optimisation de la condition de l’immobilisation et l’hybridation. Dans ce travail, nous avons utilisé MB comme le complexe de redox. Il existe différents principes des interactions ADN-MB : (i) par interaction électrostatique entre la charge cationique MB avec la charge anionique de phosphate épine dorsale fois ADN simple brin et ADN double brin ; (ii) par intercalation MB à travers l’insertion réussie de Mo entre alternance de paires de bases G-C en ADN double brin ; (iii) par liaison covalente à la fin de la cible ADN simple brin, qui produit une densité faible étiquette (une ou deux MB molécules par brin d’ADN) ; et (iv) par des interactions avec une base en ADN simple brin de guanine indépendant MB. Nous avons appliqué le quatrième principe, qui identifie avec précision les V. parahaemolyticus de croix la réactivité des bactéries et en coques fraîches. Après oxydation d’un intérêt particulier, il y a une forte affinité entre Mo et ADN simple brin. Hybridation de l’ADN simple brin avec sa séquence complémentaire remplace les molécules MB servile et réduit ainsi le signal.

La série de résultats expérimentaux présentés ci-dessus se concentre sur le développement d’une méthode rapide de détecter V. parahaemolyticus avec une sélectivité élevée et une sensibilité en utilisant les principes de l’hybridation de l’ADN. La première étape est la synthèse et la caractérisation de polylactique acide-stabilisé nanoparticules d’or (PLA-AuNPs) pour la modification de l’électrode (Figures 1 à 6 et tableau 2). La qualité des nanoparticules d’or a été évaluée à l’aide de la spectroscopie Ultraviolet-visible (UV-Vis), Diffraction des rayons x (DRX), émission de champ Scanning Electron Microscopy (FESEM), microscopie électronique à Transmission (TEM), voltamétrie cyclique (CV) et Analyse d’impédance. La deuxième partie du développement implique une caractérisation électrochimique de l’électrode modifiée (Figures 7-12 et tableau 3-4) qui a déterminé l’amélioration réussie de l’électrode modifiée par rapport à l’électrode nue dans termes de détecter les événements d’hybridation.

La troisième étape de l’élaboration du biocapteur fondés sur l’ADN était fondée sur l’optimisation des conditions expérimentales de l’événement de l’hybridation et l’application du biocapteur développé pour la détection de l’agent pathogène réelle (Figures 13 à 20). L’événement de l’hybridation qui a déterminé le succès de la détection de l’agent pathogène a été évaluée à l’aide de voltampérométrie d’impulsions différentielles (DPV). L’existence positive de l’agent pathogène ciblé a été indiqué par le biais de la réduction du courant. La sensibilité de la biocapteur développé a été évaluée par la construction d’un complot de l’étalonnage et le calcul de LOD (Figure 15). Le biocapteur fabriqué a pu distinguer spécifiquement V. parahaemolyticus d’autres pathogènes basés sur les différents niveaux de réduction actuelle (Figures 17 et 18). L’évaluation de la faisabilité du biocapteur développé pour la détection de V. parahaemolyticus dans l’échantillon d’aliment réel est présentée dans les Figures 19 et 20 , et l’existence positive de l’agent pathogène cible est indiquée par la réduction du courant . La mise au point des biocapteurs à base d’ADN est fortement tributaire de la sélection de sonde d’ADN, l’amélioration de l’électrode modifiée ainsi que l’optimisation des conditions expérimentales. La sonde ADN ici a été adaptée de l’ouvrage précédent de Nakano,67. Amélioration des électrodes modifiées a été réalisée en utilisant des nanoparticules d’or stabilisés avec de l’acide polylactique pour permettre la normalisation des nanoparticules. La fonction de nanoparticules d’or comme electro matériau catalytique68 et Loi visant à augmenter le taux de transfert de l’électron et également fournir une surface sur laquelle la sonde d’ADN d’ancrage. Les paramètres expérimentaux ont été optimisés en termes de température et incubation le temps qui est crucial pour l’ADN pour former recto verso. La température d’hybridation affecte la séparation entre l’adsorption non spécifique et cela augmente la sélectivité du capteur. Temps d’incubation de l’hybridation augmente les chances de la formation de duplex. La procédure d’immobilisation doit être optimisée afin de s’assurer que la sonde d’ADN sera dans l’orientation appropriée pour la formation duplex à forme.

Tableau 5 compare un échantillon de développé récemment électrochimique ADN biocapteurs69,70,71,72,73,,du7475 ,. Biocapteurs à base d’ADN est une méthode prometteuse pour le remplacement des techniques moléculaires de base bien qu’il y a quelques limitations qui doivent être traitées avant que la méthode peut être assez portable pour une utilisation sur place. La principale limitation est l’extraction d’ADN de traitement échantillon comme la pureté et la quantité d’ADN extrait sur le site n’est pas susceptible d’être aussi bonne que celle extraite par la méthode standard de laboratoire. Il est, cependant, une alternative prometteuse si la PCR et gel d’électrophorèse peut être remplacé par le système prétraitement de l’échantillon comme microfluidiques.

Biocapteurs à base d’ADN sont potentiellement utiles pour de nombreuses applications, y compris les diagnostics médicaux, surveillance de l’environnement et la surveillance de la nourriture. Cette technique permettra un suivi en ligne des processus de contrôle de la qualité ainsi que le point-of-care suivi des patients. La portabilité du système entier capteur va permettre la décentralisation des processus diagnostiques où le consommateur peut utiliser le système de détection dans le confort de leur foyer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Les auteurs tiennent à souligner l’appui de l’Universiti Putra Malaysia.

Materials

Name Company Catalog Number Comments
Acetic acid Merck 100056
Chloroform Merck 102445
Diaminoethane tetraacetic acid Promega E5134
Dibasic sodium phosphate  Sigma-Aldrich S9763
Disodium hydrogen phosphate Sigma-Aldrich 255793
Ethanol  Sigma-Aldrich 16368
Gold (III) chloride trihydrate Sigma-Aldrich 520918
Hydrochloric acid Merck 100317
Methylene blue Sigma-Aldrich M44907
Monobasic sodium phosphate, monohydrate Sigma-Aldrich S3522
Phosphate-buffered saline Sigma-Aldrich P5119
Poly(lactic acid) resin, commercial grade 4042D NatureWorks 4042D
Potassium chloride R&M Chemicals 59435
Potassium dihydrogen phosphate Sigma-Aldrich P9791
Potassium hexacyanoferrate III R&M Chemicals 208019
Sodium acetate anhydrous salt Sigma-Aldrich S2889
Sodium chloride Sigma-Aldrich S9888
Trisodium citrate Sigma-Aldrich S1804
Tris(hydroxymethyl) aminomethane Fisher Scientific T395-100
Tris-Base Fisher Scientific BP152-500
2X PCR Master Mix with Dual-Dye Norgen Biotek 28240
Agarose gel Merck 101236
Bolton Agar Merck 100079
Bolton Broth Merck 100079
CHROMagar Vibrio CHROMagar VB910
dNTPs Promega U1511
Nuclease-free water Thermo Scientific R0581
Eosin methylene blue agar  Merck 101347
GelRed Biotium 41001
Glycerol Merck 104092
Go Taq Buffer Promega M7911
Loading dye 100 bp DNA ladder Promega G2101
Loading dye 1kb DNA ladder Promega G5711
Magnesium chloride Promega 91176
Mannitol egg yolk polymyxin agar Merck 105267
McConkey Agar Merck 105465
Nutrient Broth Merck 105443
Taq polymerase Merck 71003
Trypticase Soy Broth Merck 105459
Trypticase Soy Agar Merck 105458

DOWNLOAD MATERIALS LIST

References

  1. Gould, L. H., Rosenblum, I., Nicholas, D., Phan, Q., Jones, T. F. Contributing factors in restaurant-associated foodborne disease outbreaks, FoodNet sites, 2006 and 2007. Journal of Food Protection. 76, 1824-1828 (2013).
  2. Arvanitoyannis, I. S., Kotsanopoulos, K. V., Papadopoulou, A. Rapid detection of chemical hazards (toxins, dioxins, and PCBs) in seafood. Critical Reviews in Food Science and Nutrition. 54, 1473-1528 (2014).
  3. Robertson, L. J., Sprong, H., Ortega, Y. R., van der Giessen, J. W. B., Fayer, R. Impacts of globalisation on foodborne parasites. Trends in Parasitology. 30, 37-52 (2014).
  4. Sandilands, E. A., Bateman, D. N. The epidemiology of poisoning. Medicine. 44, 76-79 (2016).
  5. Boschi-Pinto, C., Velebit, L., Shibuya, K. Estimating child mortality due to diarrhoea in developing countries. Bulletin of the World Health Organization. 86, 710-717 (2008).
  6. Farthing, M. J. G. Diarrhoea: A Significant Worldwide Problem. International Journal of Antimicrobial Agents. 14, 65-69 (2000).
  7. World Health Organization. WHO estimates of the global burden of foodborne diseases: foodborne disease burden epidemiology reference group 2007-2015. 1-255 (2015).
  8. Yeung, M., Boor, K. Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease. 1, 74-88 (2004).
  9. Sakazaki, R. Foodborne Diseases. Cliver, D. O., Riemann, H. P. Academic Press. 127-136 (2002).
  10. Grochowsky, J., Odom, S. R., Akuthota, P., Stead, W. Primary Septicemia and Abdominal Compartment Syndrome From Vibrio parahaemolyticus Infection in a 40-Year-Old Patient With No Known Immunocompromise. Infectious Disease in Clinical Practice. 22, (2013).
  11. Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Frontiers in Microbiology. 5, 805 (2014).
  12. Kalburge, S. S., Whitaker, W. B., Boyd, E. F. High-Salt Preadaptation of Vibrio parahaemolyticus Enhances Survival in Response to Lethal Environmental Stresses. Journal of Food Protection. 77, 246-253 (2014).
  13. Esteves, K., Hervio-Heath, D., Mosser, T., Rodier, C., Tournoud, M. G., Jumas-Bilak, E., Colwell, R. R., Monfort, P. Rapid proliferation of Vibrio parahaemolyticus, Vibrio vulnificus, and Vibrio cholerae during freshwater flash floods in French Mediterranean Coastal lagoons. Applied and Environmental Microbiology. 81, 7600-7609 (2015).
  14. Khandeparker, L., Anil, A. C., Naik, S. D., Gaonkar, C. C. Daily variations in pathogenic bacterial populations in a monsoon influenced tropical environment. Marine Pollution Bulletin. 96, 337-343 (2015).
  15. Caburlotto, G., Suffredini, E., Toson, M., Fasolato, L., Antonetti, P., Zambon, M., Manfrin, A. Occurrence and molecular characterization of Vibrio parahaemolyticus in crustaceans commercialised in Venice area, Italy. International Journal of Food Microbiology. 220, 39-49 (2016).
  16. Wong, H. C., Chen, M. C., Liu, S. H., Liu, D. P. Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries. International Journal of Food Microbiology. 52, 181-188 (1999).
  17. Rosec, J. P., Causse, V., Cruz, B., Rauzier, J., Carnat, L. The international standard ISO/TS 21872-1 to study the occurence of total and pathogenic Vibrio parahaemolyticus and Vibrio cholerae in seafood: ITS improvement by use of a chromogenic medium and PCR. International Journal of Food Microbiology. 157, 189-194 (2012).
  18. Maniyankode, R. A., Kingston, J. J., Murali, H. S., Batra, H. V. Specific identification of vibrio parahaemolyticus employing monoclonal antibody based immunoassay. International Journal of Pharmacy and Biological Sciences. 4, (2), B156-B164 (2013).
  19. Suffredini, E., Lopez-Joven, C., Maddalena, L., Croci, L., Roque, A. Pulsed-field gel electrophoresis and PCR characterization of environmental Vibrio parahaemolyticus strains of different origins. Applied and Environmental Microbiology. 77, 6301-6304 (2011).
  20. Bhattacharyya, N., Hou, A. A pentaplex PCR assay for detection and characterization of Vibrio vulnificus and Vibrio parahaemolyticus isolates. Letters in Applied Microbiology. 57, 233-240 (2013).
  21. da Silva, E. T. S. G., et al. Electrochemical Biosensors in Point-of-Care Devices: Recent Advances and Future Trends. ChemElectroChem. 4, (4), 778-794 (2017).
  22. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. Sensitive detection of multiple pathogens using a single DNA probe. Biosensors and Bioelectronics. 86, 398-405 (2016).
  23. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hushiarian, R. A simple, portable, electrochemical biosensor to screen shellfish for Vibrio parahaemolyticus. AMB Express. 7, (1), 41 (2017).
  24. Zhang, J., Li, Z., Zhang, H., Wang, J., Liu, Y., Chen, G. Rapid detection of several foodborne pathogens by F0F1-ATPase molecular motor biosensor. Journal of Microbiological Methods. 93, 37-41 (2013).
  25. Barsan, M. M., Ghica, E. M., Brett, C. M. A. Portable biosensing of food toxicants and environmental pollutants. Nikolelis, D. P., Varzakas , T., Erdem, A., Nikoleli, G. P. CRC Press, Taylor & Francis Group. Boca Raton. 33-69 (2014).
  26. Kwun, J., Yun, S., Park, L., Lee, J. H. Development of 1,1'-oxalyldiimidazole chemiluminescent biosensor using the combination of graphene oxide and hairpin aptamer and its application. Talanta. 119, 262-267 (2014).
  27. Thavanathan, J., Huang, N. M., Thong, K. L. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms. International Journal of Nanomedicine. 10, 2711-2722 (2015).
  28. Hushiarian, R., Yusof, N. A., Abdullah, A. H., Ahmad, S. A. A., Dutse, S. W. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase. Analytical Chemistry Research. 6, 17-25 (2015).
  29. Dutse, S. W., Yusof, N. A., Ahmad, H., Hussein, M. Z., Zainal, Z., Hushiarian, R., Hajian, R. An Electrochemical Biosensor for the Determination of Ganoderma boninense Pathogen Based on a Novel Modified Gold Nanocomposite Film Electrode. Analytical Letters. 47, (5), 819-832 (2014).
  30. Nordin, N., Yusof, N. A., Abdullah, J., Radu, S., Hajian, R. Characterization of Polylactide-Stabilized Gold Nanoparticles and Its Application in the Fabrication of Electrochemical DNA Biosensors. Journal of the Brazilian Chemical Society. 27, (9), 1679-1686 (2016).
  31. Vongkamjan, K., Wang, S., Moreno Switt, A. I. Rapid detection of foodborne bacterial pathogens in seafood. Handbook of Seafood: Quality and Safety Maintenance and Applications. 247-257 (2016).
  32. Wang, F., Jiang, L., Yang, Q., Han, F., Chen, S., Pu, S., Vance, A., Ge, B. Prevalence and antimicrobial susceptibility of major foodborne pathogens in imported seafood. Journal of Food Protection. 74, (9), 1451-1461 (2011).
  33. Szermer-Olearnik, B., Sochocka, M., Zwolinska, K., Ciekot, J., Czarny, A., Szydzik, J., Kowalski, K., Boratynski, J. Comparison of microbiological and physicochemical methods for enumeration of microorganisms. Postepy Higieny i Medycyny Doswiadczalnej. 68, 1392-1396 (2014).
  34. Ivanov, I. G., Bachvarov, D. R. Determination of plasmid copy number by the "boiling" method. Analytical Biochemistry. 165, (1), 137-141 (1987).
  35. Gopireddy, V. R. Biochemical tests for the identification of bacteria. International Journal of Pharmacy and Technology. 3, (4), 1536-1555 (2011).
  36. Böhme, K., Fernández-No, I. C., Pazos, M., Gallardo, J. M., Barros-Velázquez, J., Cañas, B., Calo-Mata, P. Identification and classification of seafood-borne pathogenic and spoilage bacteria: 16S rRNA sequencing versus MALDI-TOF MS fingerprinting. Electrophoresis. 34, (6), 877-887 (2013).
  37. Seoudi, R., Fouda, A. A., Elmenshawy, D. A. Synthesis, characterization and vibrational spectroscopic studies of different particle size of gold nanoparticle capped with polyvinylpyrrolidone. Physica B: Condensed Matter. 405, 906-911 (2010).
  38. Mishra, A., Harper, S., Yun, S. I. Interaction of biosynthesized gold nanoparticles with genomic DNA isolated from E. coli and S. aureus. Nanotechnology (IEEE-NANO). 1745-1750 (2011).
  39. Sugimoto, T. Formation of modoispersed nano- and micro-particles controlled in size, shape, and internal structure. Chemical Engineering and Technology. 26, 313-321 (2003).
  40. Rath, C., Sahu, K. K., Kulkarni, S. D., Anand, S., Date, S. K., Das, R. P., Mishra, N. C. Microstructure-dependent coercivity in monodispersed hematite particles. Applied Physics Letters. 75, 4171-4173 (1999).
  41. Abbas, M., Wu, Z. Y., Zhong, J., Ibrahim, K., Fiori, A., Orlanducci, S., Sessa, V., Terranova, M. L., Davoli, I. X-ray absorption and photoelectron spectroscopy studies on graphite and single-walled carbon nanotubes: Oxygen effect. Applied Physics Letters. 87, (5), 051923 (2005).
  42. Lim, S. C., Choi, Y. C., Jeong, H. J., Shin, Y. M., An, K. H., Bae, D. J., Lee, Y. H., Lee, N. S., Kim, J. M. Effect of gas exposure on field emission properties of carbon nanotubes arrays. Advanced Materials. 13, 1563-1567 (2001).
  43. Kim, B. H., Kim, B. R., Seo, Y. G. A study on adsorption equilibrium for oxygen and nitrogen into carbon nanotubes. Adsorption. 11, 207-212 (2005).
  44. Bard, A. J., Faulkner, L. R. Electrochemical methods: Fundamentals and applications. John Wiley & Sons Inc. (2000).
  45. Tan, Q., Wang, L., Ma, L., Yu, H., Ding, J., Liu, Q., Xiao, A., Ren, G. Study on anion electrochemical recognition based on a novel ferrocenyl compound with multiple binding sites. Journal of Physical Chemistry B. 112, 11171-11176 (2008).
  46. Manivannan, S., Ramaraj, R. Polymer-embedded gold and gold/silver nanoparticle-modified electrodes and their applications in catalysis and sensors. Pure and Applied Chemistry. 83, 2041-2053 (2011).
  47. Benali, O., Larabi, L., Traisnel, M., Gengembre, L., Hareka, Y. Electrochemical, theoretical and XPS studies of 2-mercapto-1-methylimidazole adsorption on carbon steel in 1 M HClO4. Applied Surface Science. 253, 6130-6139 (2007).
  48. Shi, Y., Wen, L., Li, F., Cheng, H. M. Nanosized Li4Ti5O12/graphene hybrid materials with low polarization for high rate lithium ion batteries. Journal of Power Sources. 196, 8610-8617 (2011).
  49. Bentiss, F., Traisnel, M., Lagrenee, M. The substituted 1,3,4-oxadiazoles: a new class of corrosion inhibitors of mild steel in acidic media. Corrosion Science. 42, 127-146 (2000).
  50. Wang, M., Gong, W., Meng, Q., Zhang, Y. Electrochemical DNA impedance biosensor for the detection of DNA hybridization with polymeric film, single walled carbon nanotubes modified glassy carbon electrode. Russian Journal of Electrochemistry. 47, 1368-1373 (2011).
  51. Herdt, A. R., Drawz, S. M., Kang, Y., Taton, T. A. DNA dissociation and degradation at gold nanoparticle surfaces. Colloids and Surfaces B: Biointerfaces. 51, (2), 130-139 (2006).
  52. Bhatt, N., Huang, P. J. J., Dave, N., Liu, J. Dissociation and degradation of thiol-modified DNA on gold nanoparticles in aqueous and organic solvents. Langmuir. 27, 6132-6137 (2011).
  53. Liu, X., Jang, C. H., Zheng, F., Jürgensen, A., Denlinger, J. D., Dickson, K. A., Raines, R. T., Abbott, N. L., Himpsel, F. J. Characterization of protein immobilisation at silver surfaces by near edge X-ray absorption fine structure spectroscopy. Langmuir. 22, 7719-7725 (2006).
  54. Willey, T. M., Andrew, L., Vance, T., Buuren, V., Bostedt, C., Terminello, L. J., Fadley, C. S. Rapid degradation of alkanethiol-based self-assembled monolayers on gold in ambient laboratory conditions. Surface Science. 576, (1), 188-196 (2005).
  55. Farjami, E., Clima, L., Gothelf, K., Ferapontova, E. E. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific. Analyst. 135, 1443-1448 (2010).
  56. Lin, X., Ni, Y., Kokot, S. An electrochemical DNA-sensor developed with the use of methylene blue as a redox indicator for the detection of DNA damage induced by endocrine-disrupting compounds. Analytica Chimica Acta. 867, 29-37 (2015).
  57. Zhang, F. T., Nie, J., Zhang, D. W., Chen, J. T., Zhou, Y. L., Zhang, X. X. Methylene Blue as a G-Quadruplex Binding Probe for Label-Free Homogeneous Electrochemical Biosensing. Analytical Chemistry. 86, 9489-9495 (2014).
  58. Ning, L., Li, X., Yang, D., Miao, P., Ye, Z., Li, G. Measurement of Intracellular pH Changes Based on DNA-Templated Capsid Protein Nanotubes. Analytical Chemistry. 86, 8042-8047 (2014).
  59. Sani, N. D. M., Heng, L. Y., Surif, S., Lazim, A. M., et al. AIP Conference Proceedings. Murad, A., et al. 1571, 636-640 (2013).
  60. Xu, P., Wang, J., Xu, Y., Chu, H., Shen, H., Zhang, D., Zhao, M., Liu, J., Li, G. Binding modes and interaction mechanism between different base pairs and methylene blue trihydrate: a quantum mechanics study. Advances in Experimental Medicine and Biology. 827, 187-203 (2015).
  61. Guo, Y., Chen, J., Chen, G. A label-free electrochemical biosensor for detection of HIV related gene based on interaction between DNA and protein. Sensors & Actuators, B: Chemical. 184, 113-117 (2013).
  62. Huang, K. J., Liu, Y. J., Wang, H. B., Wang, Y. Y., Liu, Y. M. Sub-femtomolar DNA detection based on layered molybdenum disulfide/multi-walled carbon nanotube composites, au nanoparticle and enzyme multiple signal amplification. Biosensors and Bioelectronics. 55, 195-202 (2014).
  63. Kong, R. M., Song, Z. L., Meng, H. M., Zhang, X. B., Shen, G. L., Yu, R. Q. A label-free electrochemical biosensor for highly sensitive and selective detection of DNA via a dual-amplified strategy. Biosensors and Bioelectronics. 54, 442-447 (2014).
  64. Rashid, J. I. A., Yusof, N. A., Abdullah, J., Hashim, U., Hajian, R. Novel Disposable Biosensor Based on SiNWs/AuNPs Modified-Screen Printed Electrode for Dengue Virus DNA Oligomer Detection. IEEE Sensors Journal. 15, 4420-4421 (2015).
  65. Yingkajorn, M., Sermwitayawong, N., Palittapongarnpimp, P., Nishibuchi, M., Robins, W. P., Mekalanos, J. J., Vuddhakul, V. Vibrio parahaemolyticus and its specific bacteriophages as an indicator in cockles (Anadara granosa) for the risk of V. parahaemolyticus infection in Southern Thailand. Microbial Ecology. 67, 849-856 (2014).
  66. Ahmad Ganaie, H., Ali, M. N. Short term protocol for the isolation and purification of DNA for molecular analysis. International Journal of Pharmaceutical Sciences Review and Research. 24, 266-270 (2014).
  67. Nakano, K., Kimura, T., Kitamura, Y., Ihara, T., Ishimatsu, R., Imato, T. Potentiometric DNA sensing platform using redox-active DNA probe pair for sandwich-type dual hybridization at indicator electrode surface. Journal of Electroanalytical Chemistry. 720-721, 71-75 (2014).
  68. Yang, J., Jim Yang, L., Heng-Phon, T., Gan-Moog, C. Inhibition of DNA hybridization by small metal nanoparticles. Biophysical Chemistry. 120, 87-95 (2006).
  69. Niu, L. M., Liu, F., Wang, W., Lian, K. Q., Ma, L., Shi, H. M., Kang, W. J. Electrochemical Behavior of Paraquat on a Highly Ordered Biosensor Based on an Unmodified DNA-3D Gold Nanoparticle Composite and Its Application. Electrochimica Acta. 153, 190-199 (2015).
  70. Li, Z., Miao, X., Xing, K., Zhu, A., Ling, L. Enhanced electrochemical recognition of double-stranded DNA by using hybridization chain reaction and positively charged gold nanoparticles. Biosensors and Bioelectronics. 74, 687-690 (2015).
  71. Niu, S., Sun, J., Nan, C., Lin, J. Sensitive DNA biosensor improved by 1,10-phenanthroline cobalt complex as indicator based on the electrode modified by gold nanoparticles and graphene. Sensors and Actuators B: Chemical. 176, 58-63 (2013).
  72. Yi, H., Xu, W., Yuan, Y., Bai, L., Wu, Y., Chai, Y., Yuan, R. A pseudo triple-enzyme cascade amplified aptasensor for thrombin detection based on hemin/G-quadruplex as signal label. Biosensors and Bioelectronics. 54, 415-420 (2014).
  73. Das, R., Sharma, M. K., Rao, V. K., Bhattacharya, B. K., Garg, I., Venkatesh, V., Upadhyay, S. An electrochemical genosensor for Salmonella typhi on gold nanoparticles-mercaptosilane modified screen printed electrode. Journal of Biotechnology. 188, 9-16 (2014).
  74. Han, X., Fang, X., Shi, A., Wang, J., Zhang, Y. An electrochemical DNA biosensor based on gold nanorods decorated graphene oxide sheets for sensing platform. Analytical Biochemistry. 443, (2), 117-123 (2013).
  75. Huang, K. J., Liu, Y. J., Zhang, J. Z., Cao, J. T., Liu, Y. M. Aptamer/Au nanoparticles/cobalt sulfide nanosheets biosensor for 17β-estradiol detection using a guanine-rich complementary DNA sequence for signal amplification. Biosensors and Bioelectronics. 67, 184-191 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics