שיטה כדי להגדיר את ההשפעות של העשרה סביבתית על המגוון הביולוגי Microbiome המעי הגס במודל של עכברים המעי הגס גידול

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

העשרה סביבתית (EE) היא סביבת מגורים בעלי חיים המשמש כדי לחשוף את המנגנונים העומדים בבסיס את החיבורים בין אורח חיים, מתח, מחלה. פרוטוקול זה מתאר הליך שבאמצעותו משתמש במודל עכבר של המעי הגס tumorigenesis, EE במיוחד להגדיר שינויים microbiota המגוון הביולוגי עשוי להשפיע התמותה בעלי חיים.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

מחקרים שנעשו לאחרונה מספר יש מאויר ההשפעות המיטיבות של המתגוררים סביבה מועשרת על שיפור מחלות אנושיות. בעכברים, העשרה סביבתית (EE) מפחיתה את tumorigenesis על ידי הפעלת המערכת החיסונית העכבר, או משפיע על הגידול הנושאת הישרדות בעלי חיים על ידי גירוי התגובה תיקון הפצע, כולל microbiome משופרים המגוון, microenvironment הגידול. בתנאי הנה הליך מפורט כדי להעריך את ההשפעות של העשרת הסביבה על הביולוגי של microbiome במודל של עכברים המעי הגס גידול. אמצעי זהירות לגבי הרבייה בבעלי חיים ושיקולים לשילוב בעלי חיים גנוטיפ ועכבר המושבה מתוארים, אשר בסופו של דבר להשפיע על המגוון הביולוגי מיקרוביאלי. ההקשבה הזהירות עשוי לאפשר שידור microbiome אחיד יותר, כתוצאה מכך להקל על תופעות התלויים-טיפול זה יכול לבלבל את ממצאי המחקר. יתרה מזאת, בהליך זה, שינויים microbiota מאופיינים באמצעות מטוסי אף-16 rDNA רצף ה-DNA מבודד צואה שנאסף המעי הגס דיסטלי בעקבות העשרה סביבתית ארוכת טווח. חוסר איזון microbiota בטן קשורה בפתוגנזה של מחלת מעי דלקתיות וסרטן המעי הגס, אלא גם של השמנת יתר וסוכרת בין היתר. חשוב, פרוטוקול זה עבור הנדסת חשמל וניתוח microbiome יכול להיות מנוצל כדי ללמוד את התפקיד של microbiome פתוגנזה במגוון של מחלות שבו קיימים דגמים חזקים העכבר ניתן לסכם מחלות אנושיות.

Introduction

לימודי העשרה סביבתית (EE) לנצל את מתחם דיור פרמטרים כדי להשפיע על גירוי חברתי (דיור גדולים בכלובים, קבוצות גדולות של בעלי חיים), גירוי קוגניטיבי (בקתות, מנהרות, חומרי קינון, פלטפורמות), פעילות גופנית (ריצה גלגלים). הנדסת חשמל יש כבר מנוצל על ידי מעבדות רבות כדי להבין את ההשפעות של פעילות מוגברת ואינטראקציה חברתית, קוגניטיבית משופרת על המחלה החניכה, התקדמות באמצעות מגוון רחב של דגמים העכבר, כולל התקרחות המושרה barbering, מחלת אלצהיימר, תסמונת רט, מחלת סרטן, העיכול מספר מודלים1,2,3,4,5,6.

מספר מודלים העכבר פותחו כדי ללמוד tumorigenesis קולון בעכברים. אולי המודל הכי מוגדרים היטב הוא העכבר ApcMin . העכבר ApcMin פותחה במעבדתו של ויליאם יונה ב 19907, שימש כמודל העכבר של מוטציות בגן APC קשורים בדרך כלל עם סרטן המעי הגס האנושי. בניגוד לבני אדם מחסה APC מוטציות, עכברים Apcמין בעיקר לפתח גידולים קטנים במעיים, עם מופע נדיר מאוד של גידולים במעי הגס. עם זאת, אלל Tcf4הט עם מוטציה יחידה של משפחתית ולא משפחתית הטרוזיגוטיים knockin-נוק-אאוט ב Tcf4, במידה רבה מגדילה את המעי הגס tumorigenesis בשילוב עם אלל Apcמינימום 8. לאחרונה, מודל זה העכבר של המעי הגס tumorigenesis שימש כדי לקבוע את ההשפעות של הנדסת חשמל על המעי הגס tumorigenesis6. בייס ואח. ללמוד, את ההשפעות הפיזיולוגיות, פנוטיפי של הנדסת חשמל על זכרים ונקבות של ארבע שורות העכבר שונים (פראי-סוג (WT), Tcf4הט / + Apc+ +, Tcf4+ / + ApcMin / +, , Tcf4 הט / + ApcMin / +)) הוגדרו. אולי הממצא המעניין ביותר היה EE מגביר באופן משמעותי את תוחלת החיים של חיות נושאות המעי הגס גם זכר וגם נקבה. כך מבהירים כי הנדסת חשמל עשוי להפחית לפחות חלק מן התסמינים הקשורים tumorigenesis המעי הגס, ולשפר את בריאות בעלי חיים. למרבה הפלא, זו תוחלת חיים משופרת, זכרים אינה תוצאה ישירה של tumorigenesis מופחת, במקום זה היה קשור אתחול של פצע הגידול ריפוי תגובה, כולל microbiome משופרים המגוון הביולוגי6.

פורסמו מספר מחקרים ספציפיים הנדסת חשמל עם תוצאות מעניינות. עם זאת, מבחינה טכנית, חשוב התוצאות אינן קרובות לתרגום למעבדות אחרות. שמירה על מתודולוגיות הנדסת חשמל זהה בין מעבדות שונות הוא נושא מאוד מסובך, לא רק בשל העשרה התקנים והשיכון בשימוש, אבל גם מצעים, מזון, אוורור, הרבייה, גנטיקה, פעילות בחדר, ואת פרוטוקול בעלי חיים דרישות, בין היתר9,10,11. דוגמה אחת היא שילוב בעלי חיים, שבו חיות חייב להיות stably משולב לתוך המושבה העכבר, לכן נרמול גנטית ברקע, הרכב, כדי למנוע תופעות קשורות ללא טיפול. זה עוד רחוק, לימודי הנדסת חשמל רבים הושלמו לפני המימוש של החשיבות של microbiome המחלה, ואת הדרך המצויים גידול העכבר יכול להשפיע על ההרכב של הבטן microbiome10,12.

אסטרטגיית הרבייה והשמת חיה ב- EE יכול להגביר מתח אם לא ביצעה כראוי. מאז לימודי הנדסת חשמל לנצל מספר גדול של חיות זכר ונקבה והן מרובים אחרים, הגדרת הניסוי יכול להיות קשה נתן את הדרישה לבעלי מספר המלטות להיות משולבת. לכן, רבייה, הגמילה אסטרטגיה פותחה כדי לאפשר שילוב של חיות גמל של גנוטיפ נכונה מהמלטות שונות. הרציונל העיקרי לכך היה לנרמל את microbiota בין המלטות, כדי להפחית את הלחץ כאשר חיות הועברו אל סביבת ניסיוני. Microbiome הועבר מן הסכר10. כדי לספק מגוון חיידקים למושבה, הנקבות היו שנרכשו מחברת מעבדות ג'קסון, משולב לתוך המושבה למשך חודש אחד לפני הניסוי החל9,10,12. לנרמל נוסף microbiome ביולוגי בין חיות, הנקבות היו שיתוף housed לפני הרבייה. בעקבות גידול, דיור קהילתי במהלך גידול ואת היכולת לברוח סיעוד הגורים שיפור את רמות הלחץ של הטיפול האימהי13,14, ואולי לקדם נורמליזציה microbiome. כדי למנוע אי-EE הקשורים השפעות על microbiome, זה דיור קהילתי של חיות ניסוי כל למנוע מתח הלחימה ואת נוספים שהתרחשו כאשר שילוב של מספר זכרים מהמלטות שונות לכלוב אחד ניסיוני. בסופו של דבר, מספר שווה של בעלי חיים אחרים כל נכללו בתוך הכלובים. זה סיפק הזדמנות microbiota משופרים המגוון הביולוגי על פני אחרים, והסיר את התרומה של והמתת תינוקות (הנטייה של החיה לצרוך צואה) או הבדלים התנהגותיים אפשרי של גנוטיפ ספציפיות ללימוד הכוללת.

פרוטוקול זה מספק אסטרטגיה שמרחיבה לימודי הנדסת חשמל הקודם כדי לכלול היבטים הידוע של מחקר microbiome, כולל microbiota שידור, חיה מושבת שילוב של נורמליזציה microbiota, כדי לאפשר יותר אוכלוסיות microbiome אחיד בין חיות ניסוי. ההקשבה הזהירות חיוני בשל היכולת של הבדלים microbiota קשורים ללא-טיפול וחיסול ממצאי המחקר. ביטול ללא-EE הקשורים microbiota שינויים יאפשר לחוקרים במיוחד להגדיר את התפקיד של הנדסת חשמל microbiota הרכב במהלך המחלה התפתחות והתקדמות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל השיטות המתוארות כאן בוצעו על פי פרוטוקולים אושרה על ידי טיפול בעלי חיים מוסדיים שימוש הוועדה (IACUC) באוניברסיטת יוטה.

1. הנבחנים, EE וההתקנה כלוב שליטה

הערה: לעיון, מודגם מיתאר של הנבחנים (איור 1).

  1. להגדיר בקרה (NE), כלובים הנדסת חשמל (איור 2).
    1. כדי להגדיר את הכלובים NE, השתמש הכלובים בלוק בקרת קונבנציונאלי (טבלה 1) חסרי העשרה התקנים.
    2. עבור כלובים גדולים, לקדוח חור אחד לכל כלוב גדול מספיק כדי להכיל grommet ומנהרת (טבלה של חומרים).
    3. כדי להגדיר את הגור לגידול, EE הכלובים, לחבר שני כלובים בלוק גדול עם מנהרה מאובטחת grommet סטיריליים ופלטפורמות סטיריליים 2 כדי להגדיל את שטח רצפה (טבלה 1). לניסויים הנדסת חשמל, מספקים סטיריליים גלגלים, מנהרות, igloos, בקתות, זחילה כדורים, ובאחת קינון של החומר בתוך הכלובים הנדסת חשמל.
    4. מקום הכלובים הנדסת חשמל ו- NE מתלה מאוורר כדי לספק אוורור שווה.
      הערה: שני כלובים גדולים עם 2 פלטפורמות (טבלה 1) לאפשר לכל היותר 12 נשים בהריון לכל גור לגידול ההתקנה15 (ראה טבלה של חומרים, צעד 3.2 מסמך, ו לטבלה 2).
    5. הזנת עכברים ad libitum מוקרן תקן האוכל והמים בלוק אוסמוזה הפוכה.
    6. מספקים עכברים עם חומרים מצעים סטרילי.
      הערה: כל המניפולציות של הכלובים ריק, כלובי חיות חייב להיעשות בשכונה למניעת זיהום. כלוב תמרון של כלובים גדולים, לכסות את החור בכלוב עם סרט דביק.
  2. להכין חיות הרבייה. קבוצה הבית 15 2 - בת חודשים הנקבות בכלוב גדול יחיד (טבלה 1) עבור 2 שבועות לפני ההזדווגות. בנפרד בית 2 - בת חודשים זכרים littermate עבור 2 שבועות לפני ההזדווגות.
    הערה: מספר הנקבות הרבייה תלויה הניסוי ואת המספר של חיות הנדרש. במחקר זה, הנקבות 15 נוצלו להשיג נקבות פקוק 12, אשר היא מקסימלית המספר המותר הכלבלב לגידול ההתקנה שמתואר 1.1.2 (טבלה 2).
  3. לגידול, לשלב חיות אדוני, דאם, 1 זכר לכל 2 נקבות. הבדיקה הראשונה בבוקר צריך להיות על הנרתיק תקעים, אשר עשוי להיות סימן חזותי זה החיות שיש הזדווגו במהלך הלילה.
    הערה: הבית זכרים ונקבות יחד עד חיבר את כל נקבה. פקק בנרתיק ניתן לזהות באופן חזותי, אם זה חיצוני.
    1. כדי לזהות למביטה תקעים, מכשיר בדיקה מוכנס לתוך פתח הנרתיק, אם התקע הנרתיק, המכשיר לא הוכנס בקלות (16; ראו סעיף 4.3.6 ללא).
      הערה: שיא הבוקר שפקק מתגלה כמו יום ½, מאז ההזדווגות אירעה בלילה.
    2. פעם אחת הנקבות יש פקקים הנרתיק, להעביר אותם כדי גור גדול לגידול כלוב לדיור קבוצה עם נקבות אחרות ובסיומה (התקנה בשלב 1.1.2 ללא התקנים העשרה).
    3. החלף הזדווגו נקבות עם הנקבות קבוצה unmated שוכן חדש להזדווגות ולהמשיך ההזדווגות, כדי לקבל מספר מרבי של המלטות תוך תקופה 7 ימים.
      הערה: כל בעלי החיים צריך להיות תאריך משלוח תוך 7 ימים אחד מהשני.
  4. לאפשר נקבות הרות ללדת קבוצת הדיור כך המלטות כל מגודלים בתוך אחד גור גדול לגידול הכלוב (התקנה בשלב 1.1.2 ללא התקנים העשרה).
    1. לשמור על מעקב אחר של הגור המספרים ו- birthdates, ובו מתחילות genotyping הגורים ב 7 ימים של גיל.
      1. קעקוע הגורים על בהונות רגליהם ב 7 ימים של גיל עם קוד מספר כדי לזהות אותם13,17.
      2. לנקות את הבוהן עם 70% אתנול ולהוסיף בעדינות מכשיר מיקרו-קעקוע המכיל דיו לתוך פני העור במקביל הבוהן17 (ראה טבלה של חומרים).
      3. לאסוף רקמות עם מספריים עבור genotyping קצות הזנב מאת אם חתיכה קטנה של רקמה מתוך 7 - בן יום neonates.
    2. לבודד דנ א גנומי מרקמות ולבצע PCR בשיטה הקונבנציונלית שוויצר כמתואר ב- 18.
    3. נפרדים בעלי חיים על ידי סקס-14-21 יום לתוך כלובים גדולים עם האמהות.
      הערה: ודא כי הגורים בוגרים מסוגלים להיזון שלהם כי הגורים הצעירים להמשיך לינוק עד זקנה מספיק כדי להאכיל משלהם.
    4. ב 21-28 ימים, להפיץ חיות זכר ונקבה בנפרד על ידי גנוטיפ סביבות NE או הנדסת חשמל, מקפיד לשמור על יחסי שווה לכל גנוטיפ לכל כלוב (איור 2א).
      הערה: ודא כי המספר הכולל של בעלי חיים מותרים בכלוב כל אחת או הנדסת חשמל מבוסס על המספר המרבי המותר ע י IACUC (טבלה 2). הכלובים NE יש לכל היותר 5 חיות (טבלה 2). ב- EE כלובים, גירוי חברתי, לא פחות מ 20, ועם שטח הגבלות, חיות יותר מ 41 אסור בכלוב הנדסת חשמל (טבלה 2).

2. שרפרף מקולקציית בגיל 16 שבועות

  1. להתחיל אוסף צואה 1-2 ימים מראש להקריב, בנפרד אוסף צואה ביום של ההקרבה במהלך ניתוח בעזרת כלי סטרילי.
    הערה: איסוף צואה במקביל, 1-2 ימים לפני אוסף עשוי לעזור כדי להימנע מאובדן מדגם בשל האפשרות כי אין צואה קיים בזמנו של אוסף.
    1. כדי לאסוף שרפרף מבעלי חיים, בזהירות את העורף החיה על כלוב נקי. לאסוף את הצואה באמצעות מלקחיים סטרילי לתוך צינור microfuge סטרילי.
      הערה: חיות בדרך כלל יבטל צואה בעת הנשיכה, אשר מאפשר איסוף צואה מהיר ישירות לתוך צינור microfuge סטרילי. אם חיים לא מיד צרכיהם בעת הנשיכה, למקם אותו לתוך כלוב נקי ולחכות החיה צרכיהם (בדרך כלל עד 1h).
    2. לאסוף את הצואה ביום של הקרבה.
      1. עבור המתות חסד החיה, מקם את החיה בתוך צנצנת המכילה מיכל קטן עם כדור צמר גפן טבולים איזופלוריין. לאחר הפסקת נשימה נצפית (בדרך כלל לאחר 2 דקות), להניח את החיה על גבו כדי לאפשר ניתוח המעי הגס.
      2. 70% אתנול חלות על הבטן העכבר.
      3. . תרים את העור והשתרשה עמוק בלבה פתח השופכה עם מלקחיים, להשתמש במספריים לחתוך לאורך הקו האמצעי הגחון עד שהגיע קשת הצלעות ואני אחתוך מבסיס של החתך הראשוני כלפי כל רגל. מקפלים בחזרה את העור, להשתמש במספריים לחתוך דרך הקיר הצפק על אותו דפוס.
      4. להשתמש מלקחיים לתפוס את המעי הגס דיסטלי-פי הטבעת לנתח ולנתק המעי הגס דיסטלי של פי הטבעת. תוך משיכת המעי הגס אנכית עם מלקחיים, להשתמש במספריים לחתוך מצע המעי לשחרר את המעי הגס.
      5. חתך מתחת. המעי הגס ולהניח אותו על נייר סינון. להשתמש מלקחיים להרים את החלק העליון של הצינור קולון, פתיחת לומן כדי לאפשר צד אחד של מספריים פתוחים שיוכנס. פתחו longitudinally, דיסטלי proximal ולאחר splay המעי הגס לאורכו.
      6. לאסוף צואה במעי הגס דיסטלי לתוך צינור microfuge סטרילי באמצעות מלקחיים סטרילי.
  2. לאחסן צואה צינור microfuge ב-80 הלעפה תרוטרפמט עד הזמן של בידוד ה-DNA חיידקי.
    הערה: ביום של הקרבה, בנוסף השרפרף, לאסוף אחרים דגימות דם, סרום, פלזמה, רגיל, הגידול רקמת המעי הגס והמעי הדק, microsomes, רקמת שומן, וכו '. לשאלות הכתובת שהוגדרה במחקר.

3. הדנ א בידוד של צואה

הערה: לנצל את ערכת מסחרי לבודד חיידקים הדנ א בעקבות פרוטוקול זיהוי הפתוגן צואה צואה. להסיר דגימות ישירות על המקפיא הלעפה תרוטרפמט-80 ועל חנות קרח יבש תוך שקילה.

  1. להעביר עד 220 מ"ג של צואה אל צינור נקי microfuge המכיל 1.4 mL בטמפרטורת החדר (RT) צואה פירוק מאגר (ראה טבלה של חומרים).
  2. מערבולת דוגמת עבור 1 דקות עד ביסודיות homogenize מוצקים (איור 2B). מחממים את המתלה כדי הלעפה תרוטרפמט 95 במשך 5 דקות כדי lyse כל החיידקים (כולל חיידקים גראם חיוביים).
  3. מערבולת דגימות s 15 ואז צנטריפוגה-g 20,000 x עבור 1 דקות הצניפה מוצקים צואה. תגובת שיקוע להעביר צינור 2-mL microfuge. להוסיף טבליה אחת כל מדגם לקלוט PCR מעכבי, מערבולת עד הלוח היא התפרקה, וכן דגירה המדגם-RT עבור 1 דקות.
  4. Centrifuge המדגם-g x 20,000 עבור 3 דקות ולהעביר את תגובת שיקוע צינור microfuge. צנטריפוגה-g 20,000 x עבור 3 מינימלית Aliquot 15 μL של proteinase K (20 מ"ג/מ"ל מניות) לתוך צינור 1.5 מ ל microfuge. פיפטה μL 200 המדגם לתוך הצינור המכיל proteinase K.
  5. להוסיף 200 μL של guanidinium כלוריד פירוק מאגר לשפופרת הזו, מערבולת ביסודיות עבור 15 s (ראה טבלה של חומרים), דגירה המדגם-70 הלעפה תרוטרפמט במשך 10 דקות להוסיף 200 μL של אתנול (96-100%) את הצינורות, מערבבים היטב בעזרת vortexing.
  6. המקום סיליקה מבוסס ספין עמודה בשפופרת אוסף 2-mL ולהחיל את הדגימות לעמודה. סגור את המכסה. ואני צנטריפוגה למשך דקות 1 ב 20,000 x g.
  7. להעביר את העמודה צינור אוסף 2 מ"ל ולהוסיף 500 μL שטיפת מאגר 1 לעמודה, קאפ את העמודה ואת צנטריפוגה עבור 1 דקות ב- 20,000 g x. העברת העמודה צינור אוסף 2 מ"ל ולהוסיף 500 μL שטיפת מאגר 2 לעמודה , סגור את מכסה ואת צנטריפוגה ב 20,000 x g למשך 3 דקות.
  8. עם הפקק סגור, להעביר את העמודה צינור אוסף 2 מ"ל, צנטריפוגה עבור 1 דקות נוספות ב 20,000 g x כדי להסיר לשארי שטיפת מאגר. להעביר את העמודה mL 1.5 הנקרא צינור microfuge ו- elute לדוגמה על-ידי הוספת μL 200 • תנאי מאגר המכילה EDTA למוח (ראה טבלה של חומרים).
  9. סגור את הכובע, תקופת דגירה-RT של 1 מינימלית צנטריפוגה המדגם עבור 1 דקות ב- 20,000 g x. להשליך העמודה.

4. DNA ריכוז נחישות והכנה מדגם ה-PCR

הערה: לנצל את fluorometer ואת וזמינותו פלורסנט dsDNA זמינים מסחרית כדי לקבוע ריכוז ה-DNA גנומי בכל מדגם (ראה טבלה של חומרים). הפלורסנט עליך לאגד DNA נטושים זוגי במיוחד.

  1. להכין לדילול 1:200 כל דגימה (1 µL של כל מדגם בתמהיל 199 µL dsDNA מאסטר) ו- 1:50 דילול של סטנדרטים. ניתוח על fluorometer באמצעות הגדרת dsDNA.
    הערה: נפח גבוה של DNA ב- PCR ניתן מעכבות, ולכן, אמצעי האחסון של ה-DNA בשימוש לא חייב להיות יותר מ-10% של היקף הסופית ה-PCR. Fluorometer מאפשר מדידה מדויקת של ה-DNA במדגם, כפי רק דנ א חייב את הפלורסנט לזרוח, ומבטל את התרומה אפשרי של המזהמים ריכוז הדנ א הסופי מחושב. רמה זו של כימות מדויק חיוני עבור היישום רצף במורד הזרם.
  2. להכין תבניות ה-PCR מדולל כדי 5 ng/μL עם נפח מתאים של 10 מ מ טריס, pH 8.5 לעשות עבודה מניות תבנית של כל דגימה.
  3. מאגר דגימות ב-20 ° C.

5. עיצוב תחל מטוסי אף-16 הרצוי V אזורים

  1. עיצוב תחל להגביר באופן סלקטיבי את האזורים הרצויים של rRNA מטוסי אף-16 V.
  2. לנתח תחל עם בדיקה התאמה, בין Ribosomal מסד נתונים פרוייקט19, כדי לקבוע את אחוזי ההצלחה משוער של phyla שונים.
    הערה: עבור אזורים V1-V3, המחקר הנוכחי המשמש לאור תחל Bosshard קדימה20, אשר מאגד-מיקום 8 בתוך האזור V1 ו- 533 הפוכה21, אשר נקשר במיקום 533 בתוך אזור V3. תחל חייבת לכלול את הסככה רצפים מתאם לצורך יצירת אינדקס.
  3. בעת עיצוב תחל, לכלול מתאם רצפים בקצות 5' כל פריימר, המומלצים עבור מטוסי אף-16 metagenomics רצף ספריית הכנה22 (טבלה 3).
  4. לסנתז אלה תחל גדול בטהרה מחסנית. לשקם תחל מיובש, לדלל PCR עובד המניה 1 μM ב 10 מ מ. טריס, pH 8.5.

6. אמפליקון PCR כדי להגביר את Region(s) V עם הבליטה מתאם רצפי מצורף 22

  1. להגדיר אמפליקון תערובת התגובה PCR כפי שמתואר בטבלה 4.
  2. המקום של דבק ברור PCR צלחת חותם על הצלחת ולהפעיל את אמפליקון PCR באמצעות הפרמטרים ב טבלה 5.
  3. (אופציונלי) לפעול אמפליקון מוצרי ה-PCR של ג'ל agarose או assay הדנ א של רגישות גבוהה המאפשרת מדידה כמותית של גודל אמפליקון (ראה טבלה של חומרים).
    הערה: הגודל אמפליקון ממחקר זה הוא 550 bp (איור 3א).

7. PCR ניקוי באמצעות מגנטי חרוזים 22

  1. Centrifuge את הצלחת ה-PCR אמפליקון במהירות-1000 g x עבור 1 דקות לאסוף עיבוי.
    הערה: פסים התחתית PCR יכול לשמש במקום צלחות PCR כדי למזער את הזיהום. ביטול המכסים שפופרת, אף פעם לא חוזר.
  2. מערבולת החרוזים מגנטי אחיד לפזר אותם, ולהוסיף 20 μL מגנטיות חרוזים על כל אמפליקון PCR, ואז pipette האחסון כולו למעלה ולמטה לאט 10 פעמים.
  3. תקופת דגירה-RT של 5 דק המקום הצלחת ה-PCR על דוכן מגנטית למשך 2 דקות עד beads מגנטי נאספים תגובת שיקוע ברור. להסיר ולמחוק את תגובת שיקוע.
  4. חרוזים לשטוף עם 200 μL טריים 80% אתנול אמנם הצלחת ה-PCR על המגנטי לעמוד, תקופת דגירה של 30 s ב RT לדוכן מגנטי. הסר בזהירות את תגובת שיקוע.
  5. חזור על לשטוף את פעם השנייה. עכשיו, להשתמש טיפ פיפטה בסדר כדי להסיר כל אתנול שיורית מן הבארות ולאפשר אוויר ייבוש למשך 10 דקות.
  6. הסר את לוחית PCR של הדוכן מגנטי ולהוסיף 52.5 μL של 10 מ מ טריס pH 8.5 מכל קידוח. פיפטה למעלה ולמטה 10 פעמים להשעות חרוזים, דגירה בטמפרטורת החדר למשך 2 דקות.
  7. להעביר את הצלחת ה-PCR עומדים מגנטי כדי לאסוף beads מגנטי ולהעביר μL 50 של תגובת שיקוע צלחת PCR נקי. המקום של דבק ברור PCR צלחת חותם על הצלחת ולאחסן ב-20 הלעפה תרוטרפמט עד לשבוע אחד.

8. הכנת ערכת צלחת עבור אינדקס PCR

הערה: כדי ליצור ספריה V1-V3, ה-PCR השנייה בוצעה עם אינדקס קיט (ראה טבלה של חומרים). ערכת יצירת האינדקס כברירת מחדל שימש כדי למפות את השילובים אינדקס ייחודי כפול עבור כל דגימה (איור 3B ו- 23).

  1. להבטיח כי כל מדגם יש שילוב ייחודי של תחל אינדקס 2 (קרי, יצירת האינדקסים כפול).

9. לבצע את מדד ה-PCR לצרף רצפי מתאם ברקודים כמו שמתואר 22 .

  1. להעביר 2.5 μL של ה-PCR amplicons (נקי amplicons) צלחת טוב 96 חדש והמקום מתקן צלחת אינדקס כדי לסייע יצירת אינדקס.
  2. לארגן את האינדקס 1 וכן אינדקס תחל 2 כמו בדוגמה של הגרפיקה צלחת מוכנה (איור 3ב).
    הערה: רמזים חזותיים ניתנים כדי למנוע טעויות פריימר: אינדקס 2 פריימר צינורות צריך כובעים לבנים, פתרון ברור, ואילו מדד 1 פריימר צינורות צריך כובעים כתום, צהוב פתרון.
  3. להרכיב את האינדקס PCR תערובת התגובה כפי שמתואר טבלה 6. מערבבים על-ידי pipetting למעלה ולמטה 10 פעמים. מכסה בחותם צלחת דבק ברורה PCR, צנטריפוגה כדי לאסוף ב g 1,000 x בטמפרטורת החדר במשך 1 דקה.
  4. הפעל את מדד ה-PCR באמצעות הפרמטרים ב טבלה מס ' 7.

10. לטהר את ספריית ה-PCR הסופי

הערה: זה ה-PCR לנקות זהה עד שלב 7 לעיל, ומשתמש beads מגנטי כדי לבצע PCR הניקוי של מדד ה-PCR22.

  1. Centrifuge את הצלחת ה-PCR מ שלב 10 במהירות-1000 g x עבור 1 דקות לאסוף עיבוי.
  2. מערבולת beads מגנטי אחיד לפזר אותם, ואז להוסיף 20 μL מגנטיות חרוזים על כל אמפליקון PCR, ואז pipette האחסון כולו למעלה ולמטה לאט 10 פעמים כדי לערבב.
  3. דגירה-RT במשך 5 דקות.
  4. המקום PCR צלחת על דוכן מגנטית למשך 2 דקות עד beads מגנטי supernatant וערכו הוא ברור. להסיר ולמחוק את תגובת שיקוע.
  5. חרוזים לשטוף עם 200 μL טריים 80% אתנול אמנם הצלחת ה-PCR על המגנטי לעמוד, תקופת דגירה של 30 s בטמפרטורת החדר על הדוכן מגנטי. הסר בזהירות את תגובת שיקוע.
  6. חזור על לשטוף את פעם השנייה.
  7. בעקבות לשטוף את השני, השתמש טיפ פיפטה בסדר כדי להסיר כל אתנול שיורית מן הבארות ולאפשר אוויר ייבוש למשך 10 דקות.
  8. הסר את לוחית PCR של הדוכן מגנטי ולהוסיף 52.5 μL של 10 מ מ טריס pH 8.5 מכל קידוח. פיפטה למעלה ולמטה 10 פעמים להשעות חרוזים, דגירה בטמפרטורת החדר למשך 2 דקות.
  9. להעביר את הצלחת ה-PCR עומדים מגנטי כדי לאסוף beads מגנטי ולהעביר μL 50 של תגובת שיקוע צלחת PCR נקי. המקום של דבק ברור PCR צלחת חותם על הצלחת ולאחסן ב-20 הלעפה תרוטרפמט עד לשבוע אחד.
  10. (אופציונלי) לפעול מוצרי ה-PCR מדד של ג'ל agarose או assay הדנ א של רגישות גבוהה המאפשרת מדידה כמותית של גודל אמפליקון (ראה טבלה של חומרים).
    הערה: גודל הספרייה באינדקס הסופי של מחקר זה היתה 668 bp (איור 3C-D).

11. לכמת לנרמל, מאגר של ספריות אינדקס עבור רצף

  1. לקבוע את ריכוז הדנ א כל דגימה עם fluorometer וערכת dsDNA assay פלורסנט (ראה טבלה של חומרים).
    1. להכין 1:200 לדילול המדגם (1 µL של כל מדגם בתמהיל 199 µL dsDNA מאסטר, הכולל מאגר ריאגנט) עבור כל אחד אינדקס דוגמאות ותקנים (מיקס מאסטר dsDNA µL 190 ו- µL 10 של תקן). ניתוח על fluorometer באמצעות הגדרת dsDNA.
  2. בעקבות חישוב ריכוז ה-DNA, לנרמל את הספריות על-ידי חישוב גודל הספרייה הממוצע. תהליך זה על-ידי סיכום אורכי מתאם, מדד אורך וגודל אמפליקון V מ תחל, להציג מוצרים על-ידי agarose ג'ל כדי להיות בטוח שהגודל הממשי הוא דומה על הגודל מחושב (ראהאיור 3ג, 22).
    1. לחלופין, לנצל assay הדנ א של רגישות גבוהה המאפשרת מדידה כמותית של ה-DNA שלמות, אמפליקון בגודל ריכוז (טבלה של חומרים, איור 3ד').
      הערה: במחקר זה, היה גודל הספרייה הממוצע מחושב בהתבסס על סיכום אורכי מתאם, מדד אורך וגודל אמפליקון V1-V3 מ תחל. הגודל הממוצע היה 668 bp.
    2. ריכוזים של דגימות הן מנורמל באמצעות הנוסחה בטבלה8.
  3. לדלל דגימות 4 nM, בריכה 5 μL מן כל מדגם 4-nM לתוך צינור יחיד עבור רצף.

12. רצף הספרייה באמצעות מערכת רצף הדור הבא, לנתח את הנתונים

  1. רצף הספרייה.
    הערה: במחקר זה, ליבת גנומיקה אוניברסיטת יוטה תפוקה גבוהה הופיעה ספריית דנטורציה רצף הדגימה (כפי שמתואר 6,22).
  2. לנתח את הנתונים.
    הערה: כדי להפריד בין הנתונים לבין הדגימות במאגר, מדד קריאות היו מזוהה ומופרדת (כפי שמתואר 22).
  3. ליצור קבצי FASTQ, לנצל את זה לניתוח נתונים עוקבות.

13. ניתוח נתונים ברצף מהספריה אמפליקון מטוסי אף-16

הערה: שלב זה מתבצע כמתואר בייס et al., 20176.

  1. התקנת כלי ניתוח נתונים זמינים באופן חופשי (ראה טבלה של חומרים; 24).
  2. להרכיב demultiplexed fastq קבצים מתוך נתוני ברצף (כפי שמתואר25,26). למחוק את כל רצפי unassembled.
  3. לבצע ניתוח בעקבות דה נובו פתוח בטקסונומיה יחידה (OTU) בחירת פרוטוקול (כפי שמתואר 27).
    1. Bin רצפים לתוך קובץ בודד fastq על ידי sampleID ורצפים קבוצה עם 97% או דמיון גדול לתוך אוטוס, כמתואר ב- 28. יישור רצפים נציג של ליבה עם רצף מינימלי אורך 150 ו- 75% אחוז זהות29,30. להקצות טקסונומיה כמו שמתואר28.
      הערה: דוגמאות יכול להיות מנופה וניתח31, ואחריו הקצאה בטקסונומיה, בניית טבלה OTU32.
    2. צור קובץ מיפוי מזהה שמות תיאוריים ומאפיינים של דגימות כדי לקשר זיהוי הדגימה ולאמת את מיפוי קובץ33,34.
    3. להפוך את רשת OTU המקשרת אוטוס תיאורים מדגם באמצעות קובץ של מיפוי35.
    4. לחשב סיכומים טקסונומיה מבחינת שפע היחסי על-ידי סיכום taxa דרך חלקות36.
    5. לחקור את המגוון אלפא של דגימות בעומק רצף אחיד המתאים דגימות. כדי להגדיר את העומק המתאימה על גיוון אלפא, מסכמים סה כ ספירות שנצפו בכל מדגם באמצעות הפקודה טבלה לסכם biome, כמתואר ב- 37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

מספר מחקרים הראו כי הנוהג של רפואת גוף-נפש משפר תוצאות בריאותיות. באופן דומה, בעכברים, העשרה סביבתית משפר את התוצאות כולל תוחלת חיים משופרת גידול פצע תיקון6. לכן, שגרת EE פותחה במטרה להגדיר את התפקיד של microbiota פנוטיפ זה תוך נרמול הראשון את microbiome לפני אתחול של הניסוי (איור 1). חשוב, כל החיות רבייה משולבים המושבה העכבר למשך חודש אחד לפחות לפני תחילת ההתרבות, הגורים היילוד housed משותפת עם האמהות בכלוב אחד גדול לנרמל את שידור microbiota לפני הניסוי. כאשר בעלי חיים בין בן 21 ו- 28 ימים, מספר שווה של כל גנוטיפ נגמלים לתוך שלהם בהתאמה לדיור, הנדסת חשמל או סביבות NE (איור 2א). 16 שבועות, צואה של חיות כל הנאספים, הומוגני (איור 2B), ואחריו בידוד ה-DNA חיידקי. לבסוף, 16 amplicons הם מוגבר של שרפרף microbiome DNA ו ברקוד באינדקס כדי לאפשר את רצף כל הספריות microbiome בו זמנית (איור 3). רצפי ייחודי המזוהה ב WT ו הגידול הנושאת חיות בתנאים NE והן EE מוצגים באיור4. מעניין, הנדסת חשמל לא לשפר המגוון הביולוגי אצל בעלי חיים WT, אך במידה רבה מגדילה המגוון הביולוגי הגידול לה להתנהגות בעלי חיים (איור 4), הוכחת כי בשיטה זו מאפשר שיפורים המגוון הביולוגי. עלייה זו המגוון הביולוגי ניתן לייחס את הנוכחות המוגברת של שלקרוא פרוטאובקטריה, עם משמעותי עליות בכיתות Alphaproteobacteria ו- Betaproteobacteria, וירידות Gammaproteobacteria פתוגניים (איור 5 ; משלימה טבלה 1). העלייה הגדולה ביותר נמצאת Betaproteobacteria השיעור הוא הסוג של Sutterella, commensal סביר מעורב איגה המופרש השפלה (איור 6, ראה גם38).

Figure 1
איור 1 : ייצוג של ציר הזמן ניסיוני. הלהקות קצר מייצגים windows 7 ימים, כמו רוב הפרוטוקול מושגת במרווחים של 7 ימים. זה גם מסייע ויזואליזציה של טווח הגילאים הגור לאורך הניסוי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : הנדסת חשמל ו- NE הדיור ותנאים homogenates צואה (כמתואר בפרוטוקול). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : 16 Microbiome ספריית הכנה- (א) PCR ולזרימה אמפליקון המוצרים נגזר מ- DNA גנומי צואה. (B) יצירת אינדקס צלחת גרפי מעוצב לפי התוכנה ששימשה (טבלה של חומרים, 23). השילובים אינדקס כפול, I7 (אינדקס 1; שורה) ו I5 (אינדקס 2; עמודה), מוצגים עבור כל דגימה. כל אינדקס הוא 8 bp אורך. המספרים מדגם להפנות המספרים המתאימים העכבר לימודי הנדסת חשמל. (ג) PCR מדד ולזרימה מוצרים. (ד) ניתוח איכותי של האחרון לטהר, איחדו 16 ספריות. (A, C, D) חצים שחורים מציינות אמפליקון bp 550 ו- 668 bp ספריה באינדקס. חצים אדומים מציינות מוצרים שאינם ספציפיים מתבטלות בעקבות טיהור כמוצג ד העליון סמני התחתון הם סמני גודל נוסף לעיון גודל המדגם. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 : שינויים גיוון אלפא בעקבות הנדסת חשמל של Tcf4הט / + ApcMin / + חיות. אלפא המגוון של WT ו Tcf4הט / + ApcMin / + הגידול הנושאת חיות. -קוראת 20,000, NE, EE של WT, p= 0.64 ו- NE ו הנדסת חשמל של Tcf4הט / + ApcMin / +, p= 0.03 באמצעות שני-sample t-test עם וולש תיקון. מ בייס et al., 20176. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5 : שינויים בתיווך הנדסת חשמל בעקבות הנדסת חשמל של Tcf4הט / + ApcMin / + חיות. R-ggplot2 שנוצר חלקות תיבת-שפם שמשמעו שינויים בשפע של מערכה פרוטאובקטריה, מחלקות Alphaproteobacteria, Betaproteobacteria ו- Gammaproteobacteria. ליניאריים המונפשים כעיגולים. p= 0.005 באמצעות שני מדגמים t-בדיקות עם וולש תיקון. קווי שגיאה באמצעות שגיאת התקן של הממוצע (SEM). מ בייס et al., 20176. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6 : שינויים שפע יחסי של Sutterella בעקבות הנדסת חשמל של Tcf4הט / + ApcMin / + חיות. ליניאריים המונפשים כעיגולים. p= 0.005 באמצעות שני-sample t-test עם וולש תיקון. קווי שגיאה באמצעות Adapted ב- SEM של בייס ואח., 20176. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Supplemental Table 1
משלימה טבלה 1: סיווג של החיידקים שבודד צואה שנאסף עכברים NE, EE. סיווג על פני אחרים באותה רמת מערכה (א), (B), סדר (C), המשפחה (D) ו סוג (E). השוואות של NE, EE של גנוטיפ באותה או מאוד מקווה Tcf4הט / + ApcMin / +. P-ערכים מחושבים באמצעות מבחן t של שני מדגמים עם וולש תיקון. מ בייס et al., 20176. אנא לחץ כאן כדי להוריד את הקובץ.

פריט שטח כולל (2ס מ) שטח כולל (2ס מ) גודל הכלוב (אינץ ') L x W x H בכלוב בגודל (ס מ) L x W x H
פקד אחד הכלוב (NE) 68.25 440.32 10.5 x 6.5 x 5.5 26.67 x 16.51 x 13.97
כלוב אחד גדול (EE) 264.36 1706.32 13.87 x 19.06 x 7.75 35.24 x 48.42 x 19.69
שני כלובים גדולים (EE) 528.72 3412.64 2 @ 13.87 x 19.06 x 7.75 2 @ 35.24 x 48.42 x 19.69
שתי פלטפורמות (EE) 93 600 2 @ 11.8 x 3.94 x 2.95 2 @ 30 x 10 x 7.5
שני כלובים גדולים עם שתי פלטפורמות (EE) 621.72 4013 2 @ 13.87 x 19.06 x 7.75 + 2 @ 11.8 x 3.94 x 2.95 2 @ 35.24 x 48.42 x 19.69 + 2 @ 30 x 10 x 7.5

טבלה 1: הנדסת חשמל, לכלוב NE וגדלים שטח רצפה.

בעלי חיים מותרים בתוך כלוב נדרש סנטימטרים בריבוע לכל חיה שטח הכלוב הנדסת חשמל (2ס מ) חיות הכולל המותר
עד 25 12 6222 (4013 ס מ2) עד 25
25 + 15 6222 (4013 ס מ2) עד 41
הנקבה אשפה 51 6222 (4013 ס מ2) עד 12

בטבלה 2: מותר מספרים של בעלי חיים בכלובים בהתבסס על שטח רצפה 15 .

אמפליקון PCR תחל
קדימה 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3'
הפוך 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3'
רצפים ספציפיים לוקוס מוצגים בגופן מודגש, לא מודגשת הרצף מתאם הסככה.

טבלה 3: אמפליקון PCR תחל.

התגובה אמפליקון PCR להגדיר
נפח
DNA מיקרוביאלית (5ng/μl) 2.5 μl
קדימה פריימר (1 μM; מ. צעד 5.1.2) 5.0 μl
הפוך פריימר (1 μM; מ. צעד 5.1.2) 5.0 μl
2 X מיקס HotStart מוכן 12.5 μl
סה 25.0 μl

טבלה 4: אמפליקון PCR מיקס.

אמפליקון PCR להגדיר
95 מעלות צלזיוס במשך 3 דקות
25 מחזורי:
95 מעלות צלזיוס למשך 30 שניות
55 מעלות צלזיוס למשך 30 שניות
72 מעלות צלזיוס למשך 60 שניות
72 מעלות צלזיוס במשך 3 דקות
. תחזיק על 4 ° C

טבלה 5: תוכנית אמפליקון PCR להגדיר.

אינדקס ה-PCR ברקוד הרכבה
ה-DNA 2.5 μl
אינדקס פריימר 1 (N7XX) 2.5 μl
אינדקס פריימר 2 (S5XX) 2.5 μl
2 X מיקס HotStart מוכן 12.5 μl
PCR כיתה מים 5 μl
סה 25 μl

טבלה 6: אינדקס PCR מיקס.

אינדקס ה-PCR ההתקנה
95 מעלות צלזיוס במשך 3 דקות
8 מחזורי:
95 מעלות צלזיוס למשך 30 שניות
55 מעלות צלזיוס למשך 30 שניות
72 מעלות צלזיוס למשך 30 שניות
72 מעלות צלזיוס למשך 5 דקות
. תחזיק על 4 ° C
חנות ב-20 ° C

טבלה מס ' 7: מדד ה-PCR תוכנית הגדר למעלה

ריכוז נוסחה עבור איגוד
(ריכוז ה-DNA ב ng/μl) x 106 = ריכוז ב nM
(660 גר'/מול x גודל ממוצע הספרייה)
דוגמה ממחקר זה היא:
(85.2 ng/μl) x 10 ^ 6 = 193.3 nM
(660 גרם / מול x 668 bp)

טבלה 8: הנוסחה עבור נרמול לפני באגירת דגימות

Subscription Required. Please recommend JoVE to your librarian.

Discussion

הליך זה מאפשר הניתוח של microbiota מבודד צואה בעקבות העשרה סביבתית של רגילה או הגידול הנושאת חיות. כי אלו ניסויים גדולים בהם מעורבים הרבייה לקבל בעלי חיים רבים של המינים השונים, אחרים, נורמליזציה של microbiome בין בעלי חיים לפני תחילת הניסוי הוא חיוני כדי למנוע אי-EE הקשורים השפעות על microbiome המגוון הביולוגי.

עקביות בין תנאי NE, הנדסת חשמל, תהליך הרבייה מתבצעת על מנת להבטיח כי כל בתחילה יש חשיפה החיידקים באותו ועכברים, לכן, צפוי להיות דומה microbiome תוכן. זה אפשרי, סביר, גנוטיפ העכבר הזה משפיע על הרכב microbiome. מסיבה זו, העכבר מספרים לכל גנוטיפ נשמרות בין NE EE תנאים כדי להיות בטוח כי כל חיה זה מכלה את השרפרף תיתקל מגוון דומה של microbiome.

כמה קשיים ניכרים כאשר מעצב להנדסת חשמל ניסויים. ראשית, המספר הכולל של בעלי חיים לצורך הניסויים תלוי בפרטים ניסיוני, אבל המספר הכולל גם מוגבל על ידי מספר בעלי חיים מותרים בתוך הכלוב. לדוגמה, נתונים היסטוריים הישרדות העכבר שמסביב בניסוי הנדסת חשמל ראשוני שימשו כדי לחשב את מספר בעלי חיים כדי להגדיר את המנגנון הבסיסי ההישרדות השתפרו נצפתה בניסויים הקודמים. מנתוני זה, סך של 17 חיות בקבוצת ההשוואה נדרשו כוח 80% לזהות הבדל בהישרדות מבחן t דו צדדי שבו אלפא = 0.05. אז 4-5 חיות בקבוצת הביקורת נגד בעלי חיים 20-24 (או עד 41) לכל כלוב, קבוצת הניסוי חייב להכיל חישוב כוח. לכן, מספר כלובים קבוצת בקרה נדרשים יחד עם הכלוב ניסיוני. יתרה מזאת, מורכבים אחרים, זה קשה להשיג מספיק מספרים בעלי חיים של גנוטיפ בכל, אשר מחייבת את מספר רב של נקבות הרבייה נדרש. אולם, עם דגמים אחרים שבו קיימים הבדלים הטרנסגניים פחות, ניתן לנתח יותר חיות של גנוטיפ באותה במערכת זו, מגדלים פחות נחוצים. בארצות הברית, 12 נשים בהריון יכול להיות בבניין של 6332 של החלל (טבלה 2). הבעיה עם זה היא כי הגורים מזדקנים, הם תופסים יותר נפח. בהתחשב בכך גורים זכר מופרדים מן הגורים הנקבה ב- 14-21 יום, חריג מאושר לכלל שטח במדינות מסוימות עשויים להיות ריאלי. . אחרת, גורים זכר ונקבה יכול להיות genotyped, שנבחרו, ואז כשהם מופרדים בגיל צעיר יותר עם האמהות להישאר מתחת למספרים העכבר המרבי. זה חיוני כדי לקבל אישור עבור מחקרים אלה לדבוק כללים מקומיים על מגבלות החלל. לבסוף, עם microbiota, מספר החיות הדרושים כדי לזהות הבדלים קטנים אפילו בהרכב microbiota היא קשה לחשב א-פריורי. ואילו במחקר זה, הבדלים משמעותיים microbiota נמצאו בעלי 4 לכל קבוצה, זה אפשרי כי הגדלת מספר בעלי חיים ניתן לגלות microbiota עוד משתנה בין הנדסת חשמל עכברים או השתנו רק במעט על ידי הנדסת חשמל.

שיטת במאמר זה המסוימת מצעים זה וציוד המשמשים, אשר על פני השטח לא להופיע חיוני. עם זאת, מספר נושאים שאינם מובנים מאליהן, המשפיעות על עקביות שניתן נתקל ויש צורך להתייחס לפני היציאה האלה גדול מאוד, יקר, ומחקרים גוזלת זמן. אחד הנושא העיקרי הוא כלוב אוורור. עם מספר גדול של חיות בתוך כלוב, אוורור הופך להיות בעיה, נושא זה רוב החוקרים לא לקחת בחשבון כאשר מנסים לספק סביבות עקבית בין הכלובים ניסיוני ובקרה. כל הכלובים בכיוונון שתואר מוצבים בתוך ארון מאוורר כדי להשוות אוורור לרוחב ניסיוני ולשלוט כלובים. זה לא יכול להתבצע כאשר שימוש בכלובים מה לא מתאים בארון מאוורר. אמצעים נוספים לנרמל אוורור בין ניסיוני ולשלוט בעלי חיים יכול להיות נבדק ומוחלים באופן עקבי, אך שיטות אלה נידונות לא במחקר זה. מתעוררות בעיות עקביות דומה עם מצעים. במערכת המעי הגס סרטן דגם השתמשו במחקר זה, בעלי חיים שיש להם מחלות עיכול להבלע סוגים מסוימים של מצעים, במיוחד קלח תירס מצעים, המוביל חסימות במערכת העיכול ומחלות. חשוב לשמור את זה בחשבון אם החיות ידועים לבלוע מצעים כשהוא לא עסוק במשהו אחר, כמו בקרת איכות הסביבה. תופעה זו ואת ההשפעות הבריאותיות לא עקביים עוקבות תשפיע בודאות כל הנתונים.

הגן ribosomal מטוסי אף-16 שימש כאמצעי ללמוד אוכלוסיות חיידקים. הוא מכיל תשעה אזורים המבטאים השתנות גנטי, V1-V9 ואזורי וביניהם שנשמרת נותרו כמעט ללא שינוי בין חיידקים39. האזור V1-V3, מספק בפרט, ההסתברות הגבוהה ביותר של זיהוי ברמת המין39. דומה V1-V3 מחקרים על סרטן המעי הגס (CRC), מתקדם אדנומה המעי הגס נמצאו שינויים ב- phyla שלוש עניין: Bacteroidetes, Firmicutes ופרוטאובקטריה21,40,41. זה גם דווח כי התרגיל יכול להסיט את אוכלוסיית חיידקים, יוביל לעליה Firmicutes42. מסיבה זו, מחקר זה מזוהה microbiome אוכלוסיות באמצעות תחל V1-V3 בעקבות פרוטוקול הכנה22 ספריית metagenomic מטוסי אף-16 להגדרת פוטנציאל ההשפעות של העשרה סביבתית על אלה phyla ידוע להשתנות אדנומה ו- CRC. הליך זה יכול להיות שונה כדי להגביר את רצף אזורים אחרים משתנה של גנים rRNA מטוסי אף-16. דרך אחת היא להשתמש בדיקה התאמה כדי להבין את הסיווג פילוגנטי של microbiota נוכח המדגם כי יזוהו על ידי המכשיר. בדרך זו, ניתן לפלח הגששים במיוחד להגדיר ולאפיין phylogenetically חיידקים עניין. זה מאפשר אפיון שונה של microbiota נוכח דגימות צואה, וכן עלול לגלות שינויים תלויי-הנדסת חשמל נוספים ב microbiome הגידול הנושאת עכברים שעשויים להשפיע על התקדמות המחלה.

באמצעות הליך זה, הסוג של Sutterella זוהה סוג מסולף ביותר בעקבות EE של הגידול הנושאת חיות. הליך זה ניתן להתאים כדי להכיל את לימודי לנצל כל שיטה נועד לנתח את השפעות ההפרעות על הרכב microbiome מודלים מהונדס גנטית של מחלות אנושיות. לדוגמה, במקום EE, עכברים יכול להיות מחוסן עם Sutterella כדי להגדיר חיסון Sutterella מספיקה להגדיל את המגוון הביולוגי מיקרוביאלי, פצע תיקון בגידול זכר בן 16 בשבוע הנושאת חיות.

ללא ספק, ההיבט הייחודי ביותר של פרוטוקול זה הסתיים החשש נרמול microbiota לפני הנדסת חשמל ושמירה על המגוון microbiome במהלך לימודי הנדסת חשמל מאז microbiome מחקרים מוכיחה ללא הרף, סביר להניח כי עמידים יותר שיטות אפיון microbiome את יקום, אפיון microbiome ב פרוטוקול זה יהפוך למיושן. לדוגמה, עם המחקר הנוכחי, הגששים נהגו להגביר את rRNA 16 יש הטיה, בהתאם הגששים נבחרו ולאחר מאפיינת כל החיידקים המצויים microbiome. בעוד האמצעים שננקטו כדי לסקור לאפיין את microbiome ללא ספק ישפרו, היסוד הבסיסי של עיצוב והפעלת EE ניסויים בזמן נורמליזציה של microbiome במחשבה יישאר היבט חיוני של הנדסת חשמל ניסויים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים שיש להם שאין ניגודי אינטרסים.

Acknowledgements

אנו מודים ב' דאלי הליבה אוניברסיטת יוטה גנומיקה ספריית רצף, ק' בושה הליבה אוניברסיטת יוטה ביוסטטיסטיקה וייעוץ סטטיסטי, גישה הליבות האלו טכני נתמכת על ידי פרס מכון הסרטן הלאומי P30 CA042014. הפרויקט המתוארת נתמכה על מענקים מכון הסרטן הלאומי P01 CA073992 ו K01 CA128891 ושל קרן סרטן הצייד.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics