Çevre zenginleştirme etkileri kolon Microbiome biyolojik çeşitliliğin bir fare kolon tümörü modeli tanımlamak için bir yöntem

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Çevre zenginleştirme (EE) yaşam tarzı, stres ve hastalık arasındaki bağlantıları altında yatan mekanizmaları ortaya çıkarmak için kullanılan bir hayvan konut ortamdır. Bu iletişim kuralı özellikle hayvan mortalite etkisi olabilir microbiota biyolojik çeşitlilik değişiklikleri tanımlamak için iki nokta üst üste tumorigenesis ve EE bir fare modelini kullanan bir yordam açıklanır.

Cite this Article

Copy Citation | Download Citations

Fuller, A. K., Bice, B. D., Venancio, A. R., Crowley, O. M., Staab, A. M., Georges, S. J., Hidalgo, J. R., Warncke, A. V., Angus-Hill, M. L. A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model. J. Vis. Exp. (132), e57182, doi:10.3791/57182 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Birkaç son yıllarda yapılan çalışmalarda insan hastalık geliştirmeye yönelik an enriched çevre yaşayan yararlı etkileri gösterildiği. Farelerde, çevre zenginleştirme (EE) fare bağışıklık sistemini harekete geçirerek tumorigenesis azaltır veya geliştirilmiş microbiome çeşitlilik, tümör microenvironment dahil yara onarım yanıt uyararak tümörü taşıyan hayvan hayatta kalma etkiler. Burada olması koşuluyla bir fare kolon tümörü modelindeki microbiome çevre zenginleştirme biyoçeşitlilik üzerindeki etkilerini değerlendirmek için ayrıntılı bir yönerge. Hayvancılık ve hayvan genotip ve fare koloni entegrasyonu için konuları ile ilgili önlemler açıklanmıştır, tümü sonuçta mikrobiyal biyolojik çeşitlilik etkiler. Bu önlemler heeding daha fazla tek tip microbiome aktarımına izin vermek ve sonuç olarak çalışma bulguları yıkmak tedavi olmayan bağımlı etkileri hafifletmek. Ayrıca, bu yordam, 16S rDNA sıralama gelen uzun vadeli çevre zenginleştirme takip distal kolon toplanan dışkı izole DNA kullanarak microbiota değişiklikleri karakterizedir. Gut microbiota dengesizlik iltihabi bağırsak hastalığı ve kolon kanseri, aynı zamanda obezite ve diyabet diğerleri arasında patogenezi ile ilişkilidir. Önemlisi, bu iletişim kuralı için EE ve microbiome analiz microbiome patogenezinde rol insan hastalık özetlemek nerede sağlam fare modelleri mevcut hastalıkların çeşitli eğitim için yararlı olabilir.

Introduction

Çevre zenginleştirme (EE) çalışmalar sosyal stimülasyon (büyük konut kafesleri, hayvanların büyük gruplar), bilişsel stimülasyon (kulübe, tünel, iç içe geçmiş malzeme, platformlar) ve fiziksel aktivite (koşularda etkiler için karmaşık konut parametrelerini kullanmak tekerlekler). EE hastalığı başlatma ve fare modelleri, berberlik indüklenen alopesi, Alzheimer hastalığı da dahil olmak üzere geniş bir dizi kullanarak ilerleme artmış aktivite ve geliştirilmiş sosyal ve Bilişsel etkileşimleri etkileri anlamak için birçok labs tarafından kullanıldığında vardır, Rett sendromu ve birkaç tümör ve sindirim rahatsızlıkları modelleri1,2,3,4,5,6.

Birkaç fare modelleri iki nokta üstüste tumorigenesis farelerde incelemek için geliştirilmiştir. Belki de en iyi tanımlanmış modeli ApcMin faredir. ApcMin fare 19907William Dove laboratuvarda geliştirilen ve yaygın olarak insan kolorektal kanseri ile ilişkili APC gen mutasyonlar bir fare modeli olarak kullanılmıştır. Aksine insanlar öncelikle APC mutasyonlar, ApcMin fareler barındıran küçük bağırsak tümörleri, kolon tümörleri çok nadir görülmesi ile geliştirmek. Ancak, bir Tcf4Het alleli Tcf4, bir tek knockin nakavt heterozigoz mutasyon ile büyük ölçüde ApcMin alleli8ile birleştirildiğinde iki nokta üstüste tumorigenesis artırır. Son zamanlarda, bu fare modeli kolon tumorigenesis kolon tumorigenesis6EE etkilerini belirlemek için kullanılır. İçinde Bice ve ark. çalışma, fizyolojik ve fenotipik EE üzerine etkileri kadın ve erkek dört farklı fare satırlarının (vahşi-tipi (WT), Tcf4Het / + Apc+/ +, Tcf4+/ + ApcMin / +, ve Tcf4 Het / + APCMin / +)) tanımlı değil. Belki de en ilginç bulgu EE önemli ölçüde hem erkek hem de dişi kolon tümörü taşıyan hayvanların ömrü artar oldu. Bu EE en az azaltabilir gösterdi bazı belirtilerin iki nokta üstüste tumorigenesis ile ilişkili ve hayvan sağlığını geliştirmek. Dikkat çekici, erkeklerde geliştirilmiş bu ömrü sınırlı tumorigenesis doğrudan bir sonucu değildir ve bunun yerine yanıt geliştirilmiş microbiome biyolojik çeşitlilik6dahil olmak üzere, şifa bir tümör yara inisiyasyon bağlıydı.

Birkaç EE belirli çalışmaları ile ilginç sonuçları yayınlanmıştır. Ancak, bir teknik açıdan önemli sonuçlar diğer laboratuvarlar için çevrilebilir değildir. Aynı EE metodolojileri farklı laboratuvarlar arasında Bakımı olan bir inanılmaz derecede karmaşık bir sorun, sadece zenginleştirme aygıtlar ve kullanılan, konut nedeniyle ama aynı zamanda yatak takımları, gıda, havalandırma, üreme, genetik, etkinlik oda ve hayvan iletişim kuralı gereksinimleri, diğerleri arasında9,10,11. Bir hayvan Tümleştirme, nerede hayvanlar stabil fare koloni, bu nedenle genetik arka plan ve diyet kompozisyon tedavi sigara ilgili etkileri önlemek için normalleştirme tümleştirilmelidir örnektir. Ayrıca, birçok EE çalışma microbiome hastalığı ve ortak fare yetiştiriciliği uygulamaları gut microbiome10,12bileşimi etkileyebilir yol önemi gerçekleşme öncesinde tamamlanmıştır.

EE üreme stratejisi ve hayvan yerleştirme-stres artırabilir değilse düzgün gerçekleştirilen. EE çalışmalar çok sayıda erkek ve dişi hayvanlar ve birden çok genotip kullanmak beri deneysel hayvan gereksinimini birleştirilmek üzere birkaç çöp verilen zor kurulabilir. Bu nedenle, bir üreme ve strateji Sütten kesme geliştirilmiştir farklı çöp üzerinden doğru genotip Emzikteki hayvanların birleştirme izin vermek için. Bunun için birincil mantığı çöp arasında microbiota normalize etmek ve deneysel çevreye hayvanlar taşındığında stresi azaltmak için yapıldı. Microbiome Barajı10' dan gönderilmiş. Kolonisi mikrobiyal çeşitliliği sağlamak için kadın Jackson Labs satın alınan ve bir ay önce9,10,12deneme başladı koloni entegre. Daha fazla microbiome biyolojik çeşitlilik hayvanlar arasında normalize etmek, kadın üreme önce co barındırılıyor. Islahı, yetiştirme sırasında ortak konut ve kaçmak için yetenek Hemşirelik pups stres düzeyleri anne bakım13,14muhtemelen microbiome normalleştirme sürdürmek, geliştirilmiş. EE sigara önlemek için microbiome üzerindeki etkileri ile ilgili, tüm deneysel hayvan bu ortak konut bir deneysel kafes içine farklı çöp üzerinden birkaç erkek birleştirirken oluştu mücadele ve ek stres engelledi. Son olarak, tüm genotip hayvanların eşit sayıda kafeslerde dahil edilmiştir. Bu geliştirilmiş microbiota biyolojik çeşitlilik için fırsat genotip arasında sağlanan ve coprophagia (dışkı tüketmeye hayvanın eğilim) veya olası genotip özgü davranış farklılıkları genel bir çalışma. kaldırıldı

Bu iletişim kuralı microbiome araştırma, daha fazla tek tip microbiome nüfus etkinleştirmek için microbiota normalleştirme microbiota iletim ve hayvan koloni Tümleştirme dahil olmak üzere bilinen yönleri dahil etmek için önceki EE çalışmalarda genişletir bir strateji sağlar deneysel hayvan arasında. Bu önlemler heeding çalışma bulguları yıkmak yeteneği olmayan tedavi ilgili microbiota farklılıklar nedeniyle önemlidir. EE sigara ortadan kaldırarak microbiota değişiklikleri araştırmacılar özellikle microbiota kompozisyon hastalığı gelişme ve ilerleme sırasında EE rolü tanımlamak sağlayacaktır ilgili.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm yöntem tanımlamak burada kurumsal hayvan bakım ve kullanım Komitesi (IACUC), Utah Üniversitesi tarafından onaylanmış protokoller uyarınca gerçekleştirilmiştir.

1. deneysel tasarım ve EE ve denetim kafes kurulumu

Not: Başvuru için deneysel tasarım anahattı gösterilmiştir (şekil 1).

  1. Denetimi (NE) ve EE kafesleri ayarlayın (Şekil 2).
    1. Doğu kafesleri ayarlamak için zenginleştirme aygıtları eksikliği autoclaved geleneksel kontrol kafesleri (Tablo 1) kullanın.
    2. İçin büyük kafes, salmastra ve tünel (Tablo reçetesi) kapsayacak kadar büyük kafes başına bir delik.
    3. Yavru yetiştirme ve EE kafesleri ayarlamak için iki büyük autoclaved kafesleri sterilize salmastra güvenli tünel ve kat alanı (Tablo 1) artırmak için 2 steril platformları ile bağlayın. EE deneyler için sterilize çalıştıran tekerlekler, tünel, igloolarda, kulübe, gezinme topları ve malzeme EE kafes içinde iç içe geçirme sağlar.
    4. EE ve NE kafesleri eşit havalandırma sağlamak için havalandırılmış bir rafa yerleştirin.
      Not: 2 platformları (Tablo 1) ile iki büyük kafes izin en fazla 12 hamile dişiler yavru Kur15 yetiştirme başına ( Tablo malzemelerigörmek, adım 3.2 belge ve Tablo 2).
    5. Fareler ışınlanmış ad libitum standart chow ve autoclaved ters osmoz su besleme.
    6. Fareler steril odada malzemeler ile sağlar.
      Not: Boş kafesleri ve kafesler hayvanlar ile tüm manipülasyonlar hood kontaminasyonu önlemek için yapmanız gerekir. Büyük kafes kafesin manipülasyonu için belgili tanımlık kafes yapışkanlı bir film ile delik kapağı.
  2. Hayvan ıslahı için hazırlayın. Çiftleşme öncesi 2 hafta boyunca bir tek büyük kafes (Tablo 1) ev 15 2 - ay yaşlı kadın grup. Ayrı ayrı Evi 2 - aylık littermate erkek çiftleşme öncesi 2 hafta boyunca.
    Not: Kadın üreme için sayısını deneme ve hayvanların gerekli sayıda bağlıdır. Bu çalışmada, 15 kadın 12 takılı kadın, elde etmek için en fazla olduğu kullanılmıştır 1.1.2 (Tablo 2) içinde açıklanan Kur yetiştirme yavru içinde izin verilen numara.
  3. Üremek için hayvanlar, efendim ve dam başına 2 kadın 1 erkek birleştirin. Sabah ilk kontrol hayvanlar gece boyunca şeklindeki görsel bir işaret olabilir vajinal fişler için olmalıdır.
    Not: Ev kadın ve erkek her erkek takılı kadar birlikte. Harici ise vajinal bir fiş görsel olarak, tespit edilebilir.
    1. İçselleştirilmiş fişler algılamak için bir sonda vajinal açılış içine eklenir ve vajinal fiş varsa, sonda değil kolayca eklenir (16; 4.3.6 bölümüne bakın).
      Not: Çiftleşme gece oluştu bu yana bir fiş yarım gün algılanan sabah kaydedin.
    2. Sonra kadın vajinal prizler, onları büyük bir yavru kafesi şeklindeki diğer kadın (kurulum adım 1.1.2 zenginleştirme cihazlar olmadan) ile grup konut için yetiştirme aktarın.
    3. Değiştir yeni eşleşmemiş grup yer alan kadın dişilerle çiftleşme için şeklindeki ve bir 7 günlük süre içinde en fazla sayıdaki çöp için çiftleşme devam edin.
      Not: Bütün hayvanlar birbirlerinin 7 gün içinde teslim tarihi olmalıdır.
  4. Hamile kadın grup böylece tüm çöp içinde bir büyük yavru yetiştirme kafesi (kurulum adım 1.1.2 zenginleştirme cihazlar olmadan) yetiştirilir konut içinde doğum izin.
    1. Yavru numaraları ve birthdates takip ve Genotipleme pups yaş 7 gün başlar.
      1. Yavrular kendi ayak yaş13,17belirtmek için bir sayı kodu ile 7 gün, dövme.
      2. Ayak % 70 etanol ile temiz ve yavaşça ayak17 ' ye paralel cilt yüzeyi içine mürekkep içeren bir mikro-dövme aygıtını takın (bkz. Tablo malzeme).
      3. Doku Genotipleme makastan ile 7 - gün eski ventilasyon dokudan küçük bir parça incising tarafından en çok kuyruk ipuçlarını toplamak.
    2. Dokusundan genomik DNA izole etmek ve 18' açıklandığı gibi geleneksel bir gösteriş meraklısı yöntemi kullanarak PCR gerçekleştirin.
    3. 14-21 gün anneler ile büyük kafesler içine sekste ayrı hayvanlara.
      Not: Büyük yavrular kendi besleme edebiliyoruz ve daha genç pups eski kadar kendi beslemek için yeterli hemşire devam emin olun.
    4. 21-28 gün, erkek ve dişi hayvanlar ayrı olarak ND veya EE ortamlar, kafes (Şekil 2A) her genotip eşit oranlarda tutmak emin içine genotip tarafından dağıtın.
      Not: IACUC (Tablo 2) tarafından izin verilen maksimum sayıyı hayvanlar her ND veya EE kafes içinde izin verilen toplam sayısı dayalı olun. Kuzey kafesleri en az 5 hayvanlar (Tablo 2) var. Sosyal uyarılması, hiç az 20 ve alan kısıtlamalar ile için EE kafeslerde en fazla 41 hayvanlar EE kafes (Tablo 2) izin verilmelidir.

2. dışkı toplama 16 hafta-in yaş

  1. 1-2 gün kurban önce dışkı toplama başlar ve ayrı ayrı dışkı steril araçlarını kullanarak diseksiyon sırasında kurban gününde toplamak.
    Not: Aynı zamanda 1-2 gün kala koleksiyon toplama dışkı bir örnek yok dışkı toplanması sırasında mevcut olma olasılığını nedeniyle kayıplarını önlemek için yardımcı olabilir.
    1. Toplamak canlı hayvanlardan, dikkatle scruff üzerinde temiz bir kafes hayvan tabure için. Steril microfuge tüp steril forseps kullanarak dışkı toplamak.
      Not: Hayvanlar genellikle hızlı dışkı koleksiyonuna bir steril microfuge tüp doğrudan izin veren immobilize zaman dışkı ortadan kaldırır. İmmobilize zaman hemen bir hayvan dışkılama değil, temiz bir kafesin içine yerleştirin ve hayvan (genellikle en fazla 1 saat) arınmak bekleyin.
    2. Dışkı kurban gününde toplamak.
      1. Hayvan ötenazi için belgili tanımlık hayvan içinde isoflurane ıslatılmış bir pamuk ile küçük bir kap içeren bir Sırça fanus yerleştirin. Bir kez nefes kesilmesi (genellikle 2 dakika sonra) gözlenen, hayvan colon diseksiyonu izin vermek için sırtını yatıyordu.
      2. % 70 etanol fare karın için geçerlidir.
      3. Üretral açılış anterior cilt Forseps ile Asansör ve göğüs kafesi erişene dek ventral orta çizgi kesmek için makas kullanın ve her bacak doğru ilk kesi Bankası kesim. Geri pas cilt ve aynı desende Periton duvarından kesmek için makas kullanın.
      4. Forseps teşrih ve distal kolon rektum üzerinden ayırmak için anüs, distal kolon kavramak için kullanın. İki nokta üst üste dikey Forseps ile kablolarıylaberaber, iki nokta üst üste serbest bırakmak için bıçaklanmasından ile kesmek için makas kullanın.
      5. Hemen altında çekum kolon kesme ve filtre kağıt üzerinde yatıyordu. Forseps eklenecek açık makas bir tarafı izin vermek için Lümen açılış kolon boru üst kaldırmak için kullanın. Boyuna, distal ve proksimal splay açık kolon uzunlamasına kesilmiş.
      6. Dışkı distal kolon steril forseps kullanarak bir steril microfuge tüp içine toplamak.
  2. Dışkı microfuge tüp-80 ˚C, bakteriyel DNA izolasyon zamana kadar saklayın.
    Not: Kurban, dışkı, ek olarak günde diğer örnekleri tam kan, serum, plazma, normal gibi tümör doku toplamak ve kolon ve ince bağırsak, microsomes, yağ dokusu, vb. çalışmada tanımlanan adres sorular için.

3. genomik DNA izolasyonu dışkı

Not: Bir tabure patojen algılama protokol sonrası dışkı mikrobiyal DNA izole etmek için ticari bir kit kullanmaktadır. Örnekleri-80 ˚C dondurucu ve kuru buz deposu için doğrudan Tartım sırasında kaldırın.

  1. Dışkı ilâ 220 mg oda sıcaklığında (RT) dışkı lizis arabelleği 1.4 mL içeren bir temiz microfuge tüp transferi ( Tablo malzemelerigörmek).
  2. Girdap örnek iyice katılar (Şekil 2B) homojenize için 1 dakika için. Süspansiyon (gram-pozitif bakteriler de dahil olmak üzere) tüm bakterileri parçalayıcı 5 min için 95 ˚C için ısı.
  3. Girdap örnekleri 15 s ve sonra 20.000 x g dışkı katı cips için 1 dakika için de santrifüj için. 2-mL microfuge Tube transfer süpernatant. PCR inhibitörleri, tablet eriyene kadar girdap emmek için her örnek için bir tablet ekleyin ve RT, Örnek 1 dk. için kuluçkaya.
  4. 20.000 x g 3 dk da örneğine santrifüj kapasitesi ve süpernatant yeni bir microfuge tüp aktarın. 20.000 x g İndinavir K 3 dk. Aliquot 15 μL için (20 mg/mL stok) yeni 1.5 mL microfuge tüpüne santrifüj kapasitesi. 200 μL örnek İndinavir K. içeren tüpe pipet
  5. Guanidinium klorür lizis tampon tüp, girdap 15 ait 200 μL eklemek s ( Tablo malzemelerigörmek) ve örneği için 10 dk. eklemek 200 μL etanol (96-%100) tüpler için 70 ˚C'kuluçkaya ve mix de vortexing tarafından.
  6. Yer bir silika spin sütun 2 mL toplama tüp içinde temel ve örnekleri sütun için geçerlidir. 20.000 x g, 1 dk santrifüj kapağı kapatın.
  7. Sütun için yeni bir 2 mL toplama tüp nakletmek ve 500 μL yıkama arabelleği 1 sütun, sütun ve 20.000 x g. Transfer sütun için yeni bir 2 mL toplama tüp, 1 dk santrifüj kap ve yıkama arabelleğinin 2 500 μL sütuna eklemek eklemek , kap ve 3 dakika 20.000 x g, santrifüj kapatın.
  8. Kapalı kap ile sütun için yeni bir 2 mL toplama tüp aktarmak ve kalan yıkama arabellek kaldırmak için 20.000 x g de ek bir 1 dk santrifüj kapasitesi. Sütun bir 1.5 mL microfuge tüp etiketli aktarmak ve 200 μL membran için EDTA içeren elüsyon arabelleği ekleyerek örnek elute (bkz. Tablo malzeme).
  9. Kapağı kapatın ve 1 dk. santrifüj Örnek 1 dk az 20.000 x g. atma sütun için RT kuluçkaya.

4. DNA toplama belirlenmesi ve PCR için numune hazırlama

Not: Bir yer ve her örnek içinde genomik DNA konsantrasyonu belirlemek için piyasada bulunan dsDNA floresan tahlil kullanmak ( Tablo malzemelerigörmek). Floresan boya özellikle çift iplikçikli DNA bağlamanız gerekir.

  1. Her örnek (199 µL dsDNA ana karışımı her örneğinin 1 µL) ve bir 1:50 1: 200 seyreltme hazırlamak seyreltme standartları. Bir yer dsDNA ayarı kullanarak analiz.
    Not: DNA PCR'yüksek hacimli inhibitör olabilir, bu nedenle, birimin kullanılan DNA PCR son hacmi % 10'dan fazla olmamalıdır. Sadece floresan boya bağlı DNA kirletici son hesaplanan DNA toplama için olası katkısını ortadan kaldırarak belli gibi bir yer örneğinde, DNA'ın hassas ölçüm sağlar. Bu düzeyde doğru Nefelometri bir aşağı akım sıralama uygulama için önemlidir.
  2. 5 ng/μL 10 mM Tris, pH 8,5 çalışma şablon stokları her örneği yapmak için uygun hacmi ile seyreltilmiş PCR Şablonlar hazırlayın.
  3. -20 ° C'de mağaza örnekleri

5. tasarım astar 16S için istenen V bölgeleri

  1. Seçime bağlı olarak istenen V 16S rRNA bölgeleri yükseltmek için tasarım astar.
  2. Ribozomal veritabanı projesi19, maç, sonda ile astar için çeşitli kültürlenebilen yaklaşık isabet oranı belirlemek için analiz.
    Not: V1-V3 bölgeler için kullanılan geçerli çalışma hangi pozisyon 8 V1 bölgesi içinde ve hangi pozisyonda 533 V3 bölgesi içinde bağlar 533 ters21, bind astar Bosshard ileri20, yayınladı. Astar dizin oluşturma için çıkıntı bağdaştırıcısı sıralamaları eklemeniz gerekir.
  3. Astar tasarlarken, Kütüphane hazırlık22 (Tablo 3) sıralama 16S metagenomics için tavsiye edilen şekilde bağdaştırıcı dizileri her astar 5' ucunda içerir.
  4. Bu büyük astar kartuş arıtma ile sentez. Rendelenmiş astar sulandırmak ve hisse senedi 1 mikron için 10 mM Tris, pH 8,5 çalışan bir PCR oranında seyreltin.

6. Amplicon V Region(s) çıkıntı bağdaştırıcısı serileri ile yükseltmek için PCR 22 bağlı

  1. Amplicon kadar PCR reaksiyon mix Tablo 4' te açıklandığı gibi ayarlayın.
  2. Yapışkan bir açık PCR plaka mühür tabağa yerleştirin ve Tablo 5' te parametreleri kullanarak PCR amplicon çalıştırın.
  3. (İsteğe bağlı) Bir özel jel veya amplicon boyutta nicel ölçüm sağlar yüksek hassasiyet DNA tahlil PCR ürünleri amplicon çalıştırma ( Tablo malzemelerigörmek).
    Not: 550 amplicon boyutudur bu çalışmada elde bp (şekil 3A).

7. PCR manyetik Temizleme'yi kullanarak 22 boncuk

  1. Amplicon PCR plaka hızlı bir şekilde 1000 x g yoğunlaşma toplamak 1 dk santrifüj kapasitesi.
    Not: PCR tüp şeritler PCR tabak yerine kirlenme en aza indirmek için kullanılabilir. Tüp kapakları atmak ve asla yeniden kullanabilirsiniz.
  2. Eşit olarak onları dağıtmak ve manyetik, 20 μL eklemek için manyetik boncuk boncuk her amplicon PCR, girdap sonra pipette birimin tümü yukarı ve aşağı yavaş yavaş 10 kat.
  3. RT 5 dk. yer PCR plaka 2 min için manyetik bir stand kadar manyetik boncuklar toplanır ve süpernatant açıktır kuluçkaya. Kaldırmak ve süpernatant atın.
  4. Yıkama boncuk PCR plaka üzerinde manyetik ise 200 μL taze % 80 etanol ile stand ve 30 için kuluçkaya RT s manyetik stand. Dikkatli bir şekilde süpernatant çıkarın.
  5. Yıkama için ikinci kez tekrarlayın. Şimdi, iyi pipet ucu herhangi bir kalıntı etanol kuyulardan kaldırmak ve 10 dakikadır kurutma hava izin vermek için kullanın.
  6. PCR plaka manyetik standından kaldırın ve her şey için 10 mM Tris pH 8,5 52,5 μL ekleyin. Pipet yukarı ve boncuk askıya almak ve 2 min için oda sıcaklığında kuluçkaya 10 kat aşağı.
  7. PCR plaka manyetik boncuklar toplamak ve 50 μL in süpernatant temiz bir PCR plakasına aktarmak için manyetik stand aktarın. Yapışkan bir açık PCR plaka mühür tabağa yerleştirin ve -20 ˚C bir hafta kadar saklayın.

8. dizin PCR için bir plaka düzeni hazırlanması

Not: V1-V3 kütüphane oluşturmak için ikinci bir PCR ile dizin gerçekleştirildi ( Tablo malzemelerigörmek) kit. Varsayılan dizin oluşturma şeması (şekil 3B ve 23) her örnek için benzersiz Çift dizin kombinasyonlarını eşlenecek kullanıldı.

  1. Her örnek 2 dizin astar benzersiz bir kombinasyonu olduğundan emin olun (örneğin, ikili dizin oluşturma).

9. dizin açıklanan 22 adaptörü dizileri için Barkod eklemek PCR gerçekleştirmek.

  1. PCR amplicons (temiz amplicons) 2.5 μL yeni 96 iyi plaka ve dizin oluşturma içinde yardım etmek için bir dizin plaka klasiği yerde aktarın.
  2. Dizin 1 düzenlemek ve hazır plaka grafik (Resim 3B) örnekte olduğu gibi 2 astar dizin.
    Not: Görsel yardımlar astar karışmalarının önlemek için sağlanmıştır: dizin 2 astar tüpler olması gereken beyaz kapaklar ve net çözüm, dizin 1 astar tüpler turuncu kapaklar ve sarı çözüm varken.
  3. PCR karışımı tepki dizin Tablo 6' da açıklandığı gibi bir araya getirin. Aşağı yukarı 10 kez pipetting karıştırın. Bir yapışkan açık PCR plaka mühür ile kapak ve 1 dk. için oda sıcaklığında 1000 x g de toplamak için santrifüj kapasitesi.
  4. Tablo 7' parametreleri kullanarak PCR dizini çalıştırın.

10. son PCR Kütüphane arındırmak

Not: Bu PCR temizlik yukarıda adım 7 için aynıdır ve manyetik boncuklar PCR temiz-yukarıya PCR22dizinin gerçekleştirmek için kullanır.

  1. Adım 10 1000 x g yoğunlaşma toplamak 1 dk için de hızlı bir şekilde PCR tabaktan santrifüj kapasitesi.
  2. Eşit olarak onları dağıtmak, o zaman, manyetik 20 μL eklemek için manyetik boncuk boncuk her amplicon PCR, girdap sonra karışımı yavaş yavaş 10 kat yukarı ve aşağı tüm birimi pipette.
  3. RT 5 min için kuluçkaya.
  4. Yer PCR plaka 2 manyetik boncuklar toplanan ve süpernatant olana min için manyetik bir stand açıktır. Kaldırmak ve süpernatant atın.
  5. Yıkama boncuk PCR plaka üzerinde manyetik ise 200 μL taze % 80 etanol ile stand ve 30 için kuluçkaya s manyetik stand oda sıcaklığında. Dikkatli bir şekilde süpernatant çıkarın.
  6. Yıkama için ikinci kez tekrarlayın.
  7. İkinci yıkama iyi pipet ucu herhangi bir kalıntı etanol kuyulardan kaldırmak ve 10 dakikadır kurutma hava izin vermek için kullanın.
  8. PCR plaka manyetik standından kaldırın ve her şey için 10 mM Tris pH 8,5 52,5 μL ekleyin. Pipet yukarı ve boncuk askıya almak ve 2 min için oda sıcaklığında kuluçkaya 10 kat aşağı.
  9. PCR plaka manyetik boncuklar toplamak ve 50 μL in süpernatant temiz bir PCR plakasına aktarmak için manyetik stand aktarın. Yapışkan bir açık PCR plaka mühür tabağa yerleştirin ve -20 ˚C bir hafta kadar saklayın.
  10. (İsteğe bağlı) Bir özel jel veya amplicon boyutta nicel ölçüm sağlar yüksek hassasiyet DNA tahlil dizin PCR ürünleri çalıştırma ( Tablo malzemelerigörmek).
    Not: Bu çalışmada elde son dizin oluşturulmuş Kütüphane boyutu 668 yapıldı bp (şekil 3C-D).

11. ölçmek, normalleştirme ve sıralama için dizin oluşturulmuş kitaplıklar havuz

  1. Bir yer ve bir dsDNA floresan tahlil kiti ile her örneğinin DNA konsantrasyonu belirlemek (tablo malzemeleri görmek).
    1. 1: 200 seyreltme (1 µL karışımında arabellek ve reaktif içeren 199 µL dsDNA ana, her örneğinin) örneğinin dizin oluşturulmuş örnekleri ve standartları (190 µL dsDNA ana mix ve standart 10 µL) her biri için hazır olun. Bir yer dsDNA ayarı kullanarak analiz.
  2. DNA toplama hesaplama kütüphaneleri ortalama Kütüphane boyutu hesaplayarak normalleştirmek. Bunu bağdaştırıcısı uzunlukları, dizin uzunlukları ve V amplicon büyüklük--dan astar toplayarak ve gerçek boyutu (şekil 3C, bkz: 22) hesaplanan boyuta benzer olduğundan emin olmak için özel jel tarafından ürünleri görüntüleyin.
    1. Alternatif olarak, nicel ölçüm DNA bütünlük, amplicon boyutu ve konsantrasyon (malzemeler tablo, şekil 3D) sağlayan bir yüksek hassasiyet DNA tahlil kullanmaktadır.
      Not: Bu çalışmada, ortalama Kütüphane boyutu tabanlı bağdaştırıcısı uzunlukları, dizin uzunlukları ve V1-V3 amplicon büyüklük--dan astar özetleme hesaplanır. Ortalama boyutu 668 yapıldı bp.
    2. Tablo 8' formülü kullanarak örnekleri konsantrasyonları normalleştirilmiş.
  3. Seyreltik örnekleri 4 nM ve havuzu 5 μL sıralama için tek bir tüp içine her 4-nM örnekten.

12. sıra yeni nesil Sekanslama sistemi kullanarak kitaplığı ve verileri ayrıştırmak

  1. Kütüphanede sıra.
    Not: Bu çalışma için Utah Üniversitesi Yüksek üretilen iş genomik çekirdek Kütüphane denatürasyon ve ( 6,22içinde açıklandığı gibi) örnek sıralama yapılır.
  2. Verileri ayrıştırmak.
    Not: Havuza alınan örnekler veri ayırmak için dizin okuma tespit ve ( 22içinde açıklandığı gibi) ayrılmış.
  3. FASTQ dosyaları oluşturmak ve bu sonraki veri analizi için kullanmaktadır.

13. 16S Amplicon Kütüphane sıralanmış verileri çözümlemek

Not: Bu adımı Bice ve arkiçinde açıklandığı gibi gerçekleştirilir., 20176.

  1. (Bkz: Malzemeler tablo; serbestçe kullanılabilir veri çözümleme araçları'nı yüklemek 24).
  2. Demultiplexed fastq dosyaları (25,26' açıklandığı gibi) sıralanmış verileri topla. Tüm unassembled dizileri atmak.
  3. Protokolü ( 27açıklandığı gibi) malzeme çekme bir de novo açık taksonomik birimi (OTU) takip çözümlemesi.
    1. SampleID tarafından bir tek fastq dosyasına dizileri ve % 97'si veya daha büyük benzerlik OTUs, içine grup sıralarıyla 28içinde açıklandığı gibi bin. 150 ve yüzde 75 %'kimlik29,30en az sıra uzunluğu ile küme çekirdek temsilcisi dizileri hizalayın. Taksonomi açıklanan28atayın.
      Not: Örnekleri binned ve ardından taksonomik atama ve OTU tablo inşaat3231, analiz.
    2. Açıklayıcı adlar ve örnek kimliği için bağlantı ve eşleme dosyası33,34doğrulamak için örnekleri özelliklerini tanımlayan bir eşleme dosyası oluşturun.
    3. OTUs bir eşleme dosyası35kullanarak örnek açıklamaları için bağlantılar bir OTU ağ olun.
    4. Taksonomi özetleri göreli bereket açısından takson ile araziler36özetleyerek hesaplamak.
    5. Alfa örnekleri örnekleri için uygun tek tip sıralama derinlikte çeşitliliğini keşfedin. Alfa çeşitlilik için uygun derinliği tanımlamak için 37içinde açıklandığı gibi biome özetlemek-table komutunu kullanarak her örnekte gözlenen toplam sayıları özetler.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Çeşitli çalışmalarda zihin-beden tıp pratiği sağlık sonuçları geliştirir göstermiştir. Benzer şekilde, farelerde, çevre zenginleştirme geliştirilmiş ömrü ve tümör yara onarım6dahil sonuçları geliştirir. Bu nedenle, bir EE yordamı ilk microbiome (şekil 1) deney inisiyasyon önce normalleştirme sırasında bu fenotip microbiota rolünü tanımlama amacı ile geliştirilmiştir. Önemlisi, tüm üreme hayvan ıslahı başlamasından önce en az bir ay için fare koloni entegre edilmiştir ve yeni doğan yavrular microbiota iletim deneme önce normale anneler içinde bir büyük kafes ile birlikte barındırılıyor. Hayvanlar 21-28 gün eski olduğunda, her genotip eşit sayıda onların anılan sıraya göre konut içine, EE ya da Kuzey ortamlar (Şekil 2A) sütten kesmek. 16 hafta, dışkı tüm hayvanlardan toplanan ve homojenize (Şekil 2B), takip bakteriyel DNA izolasyon tarafından. Son olarak, amplicons üzerinden güçlendirilmiş 16S microbiome DNA ve barkod (şekil 3) aynı anda tüm microbiome kütüphanelerin sıralama için izin vermek için dizine tabure. WT ve hayvanlar NE ve EE koşulları taşıyan tümör tespit benzersiz sıraların şekil 4' te gösterilmiştir. İlginçtir, EE WT hayvanlarda biyoçeşitlilik geliştirmek değil, ancak bu yöntem biyolojik çeşitlilik iyileştirmeler sağlar gösteren tümörü taşıyan hayvanlar (şekil 4), biyolojik çeşitlilik büyük ölçüde artar. Bu artış biyolojik çeşitlilik, bakteri, önemli olan Alphaproteobacteria ve Betaproteobacteria sınıflarda artırır ve patojenik Gammaproteobacteria (şekil 5 azaltır filum artan varlığı bağlanabilir ; Ek tablo 1). Betaproteobacteria içinde en büyük artış olduğunu Sutterella, büyük olasılıkla komensal salgılanan IgA bozulması (şekil 6, Ayrıca bkz:38) dahil cins sınıftır.

Figure 1
Resim 1 : Bir temsil deneysel zaman çizelgesi'nin. İletişim kuralının en başarılı olarak 7 gün aralıklarla kısa bantları 7 günlük windows, temsil eder. Bu aynı zamanda deney yavru yaş aralığını görsel öğeyi yardımcı olur. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : EE ve NE konut (iletişim kuralında tanımlandığı gibi) koşulları ve dışkı homogenates. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : 16S Microbiome Kütüphane hazırlık. (A)Unpurified PCR amplicon ürünler elde edilen dışkı genomik DNA'sı. ()B) kullanılan yazılım göre tasarlanmış dizin oluşturma plaka grafik (Tablo malzemeleri, 23). İkili dizin birleşimleri, I7 (dizin 1; Satır) ve I5 (dizin 2; Sütun), her örnek için gösterilir. Her dizin 8. bp uzunluğu. Örnek numaraları EE çalışmalardan ilgili fare numaralarına bakın. (C) Unpurified dizin PCR ürünleri. (D) kalite analiz final saflaştırılmış ve havuzlu 16S kitaplıkları. (A, C, D) Siyah okları 550 bp amplicon ve 668 bp dizin oluşturulmuş kitaplığı göstermek. Kırmızı oklar arıtma ö içinde gösterildiği gibi aşağıdaki ortadan kalkar non-spesifik ürünleri göstermek Üst ve alt işaretleri boyutu işaretleri örnek boyutu başvurusuna için ekledi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : Alfa çeşitlilik EE, aşağıdaki değişiklikler Tcf4Het / + ApcMin / + hayvanlar. Alfa WT çeşitliliği ve Tcf4Het / + ApcMin / + hayvanlar taşıyan tümör. 20.000 okur, NE ve WT EE, p= 0.64 ve NE ve, EE Tcf4Het / + ApcMin / +, piki örnek t-testi ile Welch düzeltme kullanarak 0.03 =. Bice ve arkuyarlanmıştır., 20176. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5 : EE-aracılı değişiklikleri takip, EE Tcf4Het / + ApcMin / + hayvanlar. R-ggplot2 kutusu-bıyık araziler değişiklikleri ifade eden filum bakteri ve sınıfları Alphaproteobacteria, Betaproteobacteria ve Gammaproteobacteria bolluk içinde oluşturulan. Aykırı daireler olarak belirtilmiştir. p= 0,005 iki örnek t-testleri ile Welch düzeltme kullanarak. Standart hata ortalamaya (SEM) kullanılarak hesaplanan hata çubukları. Bice ve arkuyarlanmıştır., 20176. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6 : Değiştirir, EE takip Sutterella göreli bolluk içinde Tcf4Het / + ApcMin / + hayvanlar. Aykırı daireler olarak belirtilmiştir. p= 0,005 iki örnek t-testi ile Welch düzeltme kullanarak. SEM uyarlama Bice ve arkkullanılarak hesaplanan hata çubukları., 20176. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Supplemental Table 1
Ek tablo 1: sınıflandırma, bakteri izole dışkı toplanan NE ve EE fareler üzerinden gelen. Sınıflandırma genotip(a)şube, (B) sınıfı, (C) sipariş, (D) aile ve (E) cins düzeyinde arasında. NE ve aynı genotip EE veya WT için karşılaştırmalar Tcf4Het / + ApcMin / +. P-değerler bir iki örnek t-testi ile Welch düzeltme kullanılarak hesaplanır. Bice ve arkuyarlanmıştır., 20176. Bu dosyayı indirmek için buraya tıklayınız.

Madde Toplam alan (2inç) Toplam alan (cm2) Kafes boyutu (inç) L x g x y Kafes boyutu (cm) L x g x y
Bir denetim kafes (NE) 68,25 440.32 10,5 x 6,5 x 5.5 26.67 x 16.51 x 13.97
Bir büyük kafes (EE) 264.36 1706.32 13.87 x 19.06 a x 7,75 35.24 x 48.42 x 19.69
İki büyük kafesler (EE) 528.72 3412.64 2 13.87 x 19.06 a x 7,75 @ 2 35.24 x 48.42 x 19.69 @
İki platform (EE) 93 600 2 11.8 x 3.94 x 2,95 @ 2 30 x 10 x 7, 5 @
İki platform (EE) ile iki büyük kafesler 621.72 4013 2 13.87 x 19.06 a x 7,75 + 2 11.8 x 3.94 x 2,95 @ @ 2 35.24 x 48.42 x 19.69 + 2 30 x 10 x 7, 5 @ @

Tablo 1: EE ve NE kafes boyutları ve kat alanı.

Hayvanlar kafese izin Gerekli inç kare hayvan EE kafes alanı (inç2) İzin verilen toplam hayvanlar
En çok 25 12 6222 (4013 cm2) En çok 25
25 + 15 6222 (4013 cm2) kadar 41
Erkek ile çöp 51 6222 (4013 cm2) 12'ye kadar

Tablo 2: kat alanı üzerinde dayalı kafeslerde hayvanlar sayılara izin 15 .

Amplicon PCR astar
İleri 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3 '
Ters 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3 '
Odağı belirli dizileri kalın olarak gösterilir ve kalın olmayan çıkıntı bağdaştırıcısı sırasıdır.

Tablo 3: Amplicon PCR astar.

Kurmak Amplicon PCR reaksiyon
Birim
Mikrobiyal DNA (5ng/μl) 2.5 μl
İleri astar (1 mikron; 5.1.2 adım) 5.0 μl
Astar tersine (1 mikron; 5.1.2 adım) 5.0 μl
2 x HotStart hazır Mix 12.5 μl
Toplam 25,0 μl

Tablo 4: Amplicon PCR karışımı.

Amplicon PCR kurmak
95 ° C için 1 dakika
25 döngüleri:
30 saniye için 95 ° C
30 saniye için 55 ° C
72 ° C 60 saniye
72 ° C için 1 dakika
4 ° C'de tutun

Tablo 5: Amplicon PCR Program kurmak.

Dizin PCR barkod derleme
DNA 2.5 μl
Dizin astar 1 (N7XX) 2.5 μl
Dizin astar 2 (S5XX) 2.5 μl
2 x HotStart hazır Mix 12.5 μl
PCR sınıf su 5 μl
Toplam 25 μl

Tablo 6: dizin PCR karışımı.

Dizin PCR Kur
95 ° C için 1 dakika
8 döngüleri:
30 saniye için 95 ° C
30 saniye için 55 ° C
30 saniye için 72 ° C
5 dakika 72 ° C
4 ° C'de tutun
Mağaza-20 ° c

Tablo 7: dizin PCR Program yukarı ayarla

Havuzu oluşturma için örnek toplama formül
(Ng/μl DNA konsantrasyon) x 106 konsantrasyon nM içinde =
(660 g/mol ortalama Kütüphane boyutu x)
Bu çalışmada elde bir örnektir:
(85.2 ng/μl) x 10 ^ 6 = 193.3 nM
(660 g / mol x 668 bp)

Tablo 8: örnekleri havuzu önce normalleştirme için formül

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu yordam, normal veya tümör hayvan taşıyan çevre zenginleştirme takip dışkı izole microbiota analizi için verir. Çünkü bunlar farklı cinsiyette ve genotip birçok hayvan elde etmek üreme dahil büyük deneyler, microbiome deney başlamasından önce hayvanlar arasında normalleştirme önemlidir sigara-EE önlemek için microbiome üzerindeki etkileri ile ilgili biyolojik çeşitlilik.

NE ve EE koşullar arasında tutarlılık sağlamak için üreme süreci tüm fareler başlangıçta aynı mikroplar maruz var ve bu nedenle, benzer microbiome içeriği sahip olmaları beklenmektedir, emin olmak için yapılır. Mümkün ve büyük olasılıkla, o fare genotip microbiome kompozisyon etkiler. Bu nedenle, fare numaraları genotip başına NE ve EE arasında koşulları dışkı tüketen herhangi bir hayvan microbiome benzer bir çeşitlilik karşınıza çıkacak emin olmak için saklanır.

EE tasarlama deneyler birkaç zorluklar belirgin olur. Birincisi, hayvan deneyleri için gerekli toplam sayısı deneysel detayları bağlıdır ancak toplam da hayvanlar kafese izin sayısı ile sınırlıdır. Örneğin, geçmişe dönük verileri çevreleyen fare hayatta bir ön EE deneme mekanizması temel gelişmiş yaşam önceki deneylerinde gözlenen tanımlamak için hayvan sayısını hesaplamak için kullanılmıştır. Bu veri, karşılaştırma grubundaki 17 hayvanların toplam Alfa nerede bir iki taraflı t-test hayatta kalma bir fark tespit etmek bir % 80 güç için gerekli 0,05 =. Yani, 4-5 hayvanlar 20-24 (ya da en fazla 41) hayvan deney grubu kafeste başına vs kontrol grubunda bir güç hesaplama karşılamak gerekir. Bu nedenle, birkaç denetim grubu kafesleri ile birlikte deneysel kafes ihtiyaç vardır. Ayrıca, karmaşık genotip ile gerekli üreme kadın büyük sayılar gerektirir her genotip yeterli hayvan numaralarını elde etmek zordur. Ancak, daha az transgenik farklılıklar mevcut nerede diğer modellerle aynı genotip daha fazla hayvanların bu sistemde analiz edilebilir ve daha az doğurmak gereklidir. Amerika Birleşik Devletleri'nde 12 hamile kadın2 alanı (Tablo 2) 633 barındırılıyor olabilir. Bu pups Yaşlandıkça daha fazla yer kaplar konudur. Erkek yavrular dişi yavruları 14-21 gün ayrılır göz önüne alındığında, bir onaylanmış bir istisna alan bazı ülkelerde mümkün olabilir. Aksi halde, erkek ve dişi yavruları genotyped olabilir ve seçili ve annelerin en büyük fare numaraları kalmak ile genç yaşta ayrılmış. Bu çalışmalar için rızasını kazanmak ve alan kısıtlamaları hakkında yerel kurallara uymak için önemlidir. Son olarak, microbiota ile hayvanların microbiota bileşiminde bile küçük farklılıkları algılamak için gerekli sayıda bir temanınhesaplamak zordur. Bu çalışmada ise microbiota önemli farklılıklar bulunmuştur, grup başına 4 hayvanlarla hayvanlar sayısı artmakta EE fareler arasında daha fazla değişken veya EE tarafından yalnızca az da olsa farklı microbiota ortaya koyacaktır mümkündür.

Özellikle bu yöntemi makalede ekipman ve bu yatak takımları kullanılır, yüzey üzerinde önemli görünmeyebilir. Ancak, tutarlılık etkileyen birkaç belirgin olmayan sorunları karşılaşılan olabilir ve başlamadan bu çok büyük, pahalı ve zaman alıcı çalışmalar önce ele alınması gerekmektedir. Bir kafes havalandırma olduğunu. Büyük sayılarla bir kafeste hayvanların havalandırma bir sorun haline gelir ve çoğu araştırmacı denetim ve deneysel kafesler arasında tutarlı ortamları sağlamak çalışırken dikkate almayın bir konudur. Tanımlanan kurulumundaki tüm kafesleri havalandırma deneysel arasında eşitlemek ve denetlemek için havalandırılmış bir dolapta yerleştirilir kafesleri. Ne zaman kullanarak kafesleri havalandırılmış bir dolapta uymaz bu başarılı olamaz. Havalandırma deneysel arasında normal duruma getirmeye ve kontrol anlamına gelir diğer hayvanlar test olabilir ve sürekli olarak uygulanan, ama bu yöntemler bu çalışmada incelenmiştir değil. Benzer tutarlılığı sorunları yatak ile ortaya çıkmaktadır. Bu çalışmada kullanılan kolon kanseri modeli sistemde, sindirim hastalığı hayvan yatak, belirli türde yemek özellikle yatak takımları, sindirim tıkanıklıkları ve hastalık için önde gelen mısır mısır koçanı. Zaman başka türlü işgal, denetim ortamı olduğu gibi odada yemek için hayvanlar biliniyorsa bu akılda tutmak önemlidir. Bu olay ve sonraki tutarsız sağlık etkileri tüm verileri derinden etkileyecektir.

16S ribozomal gen bakteri nüfus eğitim için bir araç olarak kullanılmıştır. Genetik değişkenliği, V1-V9 ve bakteri39arasında nispeten değişmeden kalır serpiştirilmiş korunmuş bölgelerde hızlı dokuz bölgeleri içerir. V1-V3 bölge özellikle, en yüksek olasılık türler düzeyi kimlik39sağlar. Benzer V1-V3 kolorektal kanser (CRC) üzerinde çalışmalar ve kolorektal Adenoma gelişmiş değişiklikler faiz üç kültürlenebilen bulundu: Bacteroidetes, Firmicutes ve bakteri21,40,41. Bu da egzersiz mikrobiyal nüfus vardiya ve Firmicutes42artışa yol bildirilmiştir. Bu nedenle, microbiome nüfus potansiyel olarak bu kültürlenebilen adenoma ve CRC değiştirilmesi için bilinen çevre zenginleştirme etkileri tanımlamak için V1-V3 astar 16S metagenomic Kütüphane hazırlık protokolü22 takip kullanarak bu çalışmada tespit edilmiştir. Bu yordam değişken diğer bölgeler 16S rRNA genlerinin sıra ve yükseltmek için değiştirilebilir. Sonda maç microbiota sondası tarafından tanımlanan örnek mevcut filogenetik sınıflandırma anlamak için kullanmak için bir yoludur. Bu şekilde, özellikle tanımlamak ve filogenetik mikroplar ilgi sınıflandırmak için probları hedeflenebilir. Bu dışkı örneklerinde mevcut microbiota farklı bir karakterizasyonu sağlar ve hastalık ilerleme etkileyebilir fareler taşıyan tümör microbiome içinde ek EE bağlı değişiklikler gösterebilir.

Bu yordamı, Sutterella EE hayvan taşıyan tümör takip en değişik cins tespit edilmiştir cins kullanarak. Bu yordamı pertürbasyon insan hastalık genetik olarak değiştirilmiş modellerinde microbiome kompozisyon üzerinde etkilerini çözümlemek için herhangi bir yöntem kullanmak çalışmalar karşılamak için adapte edilebilir. Örneğin, EE yerine, fareler Sutterella aşılama mikrobiyal biyolojik çeşitlilik artırabilir ve onarım hayvan taşıyan 16-hafta-yaşlı erkek tümör yarası için yeterli olup tanımlamak için Sutterella ile aşılanmış.

Hiç şüphesiz, bu iletişim kuralının en eşsiz yönü endişe microbiota EE önce normalleştirme ve microbiome çeşitlilik EE çalışmalar boyunca sürdürmek bitti. Microbiome çalışmalar sürekli gelişiyordu çünkü, büyük olasılıkla microbiome karakterize için daha sağlam yöntemleri ortaya çıkacak ve bu protokol microbiome karakterizasyonu eski haline gelecektir. Örneğin, geçerli çalışma ile 16S rRNA yükseltmek için kullanılan problar bağlı olarak seçilir ve tüm bakteri microbiome içinde mevcut karakterize değil probları önyargı var. Anket ve microbiome karakterize için kullanılan yöntemleri kuşkusuz artıracak iken, normalleştirme ve microbiome göz önünde bulundurarak EE deneyler temel bir faset kalır iken tasarlama ve çalıştırma EE temel Vakfı deneyleri.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar onlar-si olmak hayır çatışması beyan ederim.

Acknowledgements

B. Dalley'in Utah Üniversitesi Biyoistatistik temel istatistik tavsiye ve erişim için Ulusal Kanser Enstitüsü Ödülü P30 CA042014 tarafından desteklenen bu teknik çekirdek Utah Üniversitesi genomik çekirdek Kütüphane sıralama ve K. Boucher için teşekkür ediyoruz. Açıklanan proje Ulusal Kanser Enstitüsü hibe P01 CA073992 ve K01 CA128891 ve avcı kanser Vakfı tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Teklad Diets/Harlan Labs Chow Harlan Labs 3980X Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.
Cell-Sorb Plus bedding Fangman Specialties 82010 Autoclave prior to use.
AIMS Tattooing System For Neonates AIMS NEO-9 https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.
Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system Lab Products 82120ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Life Span Enrichment Device Lab Products 82109ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 Cage 13-7/8" Length X 19-1/16" Width X 7-3/4" Depth Lab Products 82100ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Zyfone One Cage 2100 AllerZone Micro-Isolator filter top Lab Products 82101ZF Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.
Tunnel Bio-Serv K3323 or K3332 Connect cages together and use for enrichment
Grommet to connect Tunnel to cages Fabricated by the University of Utah Machine Shop n/a Be certain the material is resistant to chewing and autoclavable
Fast-track wheel Bio-Serv K3250 or K3251 Use with mouse igloo and floor
Mouse Igloo Bio-Serv K3328, K3570 or K3327 Use with Fast-track wheel and floor
Mouse Igloo floor Bio-Serv K3244 Use with mouse Igloo and Fast-Track
Mouse Hut Bio-Serv K3272, K3102 or K3271
Crawl Ball Bio-Serv K3330 or K3329
Bio-hut Bio-Serv K3352 Wood pulp hut used for sheltering and nesting
Adhesive film  VWR 60941-072 Use to temporarily cover drilled hole in large cage to prevent mice from escaping
Laminar Flow Ventilated Rack Techniplast Bio-C36 The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.
1.5 mL Microfuge Tube- RNAse and DNAse free Any supplier
QIAamp DNA Stool MiniKit Qiagen 51504 This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE
Waterbath (capable of heating to 95) Any supplier For 94 degree incubation of stool samples to lyse cells.
Waterbath (capable of heating to 70 degrees) Any supplier For 70 degree incubation of stool samples 
Ethanol (200 proof) Sigma Aldrich E7023
Fluorometer: Qubit ThermoFisher Scientific Q33216
Qubit dsDNA broad Range Assay Kit ThermoFisher Scientific Q32850
EB Buffer or 10 mM Tris pH 8.5 Qiagen 19086
Experiment specific primers Any Supplier
PCR grade water Any supplier
2X KAPA HiFi HotStart Ready Mix  Kapa Biosystems KK2601 For Amplicon Amplification (1.25 mL allows 100 rxns).
Agarose for running diagnostic gels Any supplier
TapeStation High Sensitivity D1000 Screen Tape Trace Agilent 5067-5583 TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.
Agencourt AMPure XP Magnetic Beads Beckman Coulter A63880 Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions
Magnetic stand Life Technologies AM10027
Library Preparation Guide Illumina Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.
Unique Dual Indexing Illumina Illumina Experiment Manager Software Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html
Nextera XT 96 Index Kit Illumina FC-131-1002 Used to add barcodes to amplicons
MicroAmp Optical 96-well reaction plate Applied Biosystems/ThermoFisher N8010560
TruSeq Index Plate Fixture Illumina FC-130-1005
Adhesive clear plate seal Applied Biosystems /ThermoFisher 4360954 Applied Biosystems/ThermoFisher Microamp adhesive film
Sequencing by MiSeq with v3 reagents and dual 300 bp reads Illumina MS-102-3003
PhiX Control Kit Illumina FC-110-3001
Proteinase K (600 mAU/ml) Qiagen 19131 Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit
Data Analysis Tools Qiime QIIME software Tools Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime
Step 13.2. Qiime FastQ Join method  (http://code.google.com/p/ea-utils  ).  For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).
Step 13.3. Qiime De-Novo OTU picking protocol http://qiime.org/scripts/pick_de_novo_otus.html.
Step 13.3.1. Open Taxonomic Units (OTUs) using Uclust Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).
Step 13.3.1. Pynast Pynast Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010). 
Step 13.3.1. Pynast Pynast_Greengenes DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study
13.3.1. Note:  Qiime Multiple Split Libraries http://qiime.org/scripts/multiple_split_libraries_fastq.html.
13.3.1. Note:  Qiime Pick de novo OTUs script http://qiime.org/scripts/pick_de_novo_otus.html 
Step 13.2.2. Qiime Create a mapping file http://qiime.org/documentation/file_formats.html.
Step 13.2.2. Qiime Validate a mapping file http://qiime.org/scripts/validate_mapping_file.html.
Step 13.3.3. Qiime Link the OTU to sample description to mapping file http://qiime.org/scripts/make_otu_network.html.
Step 13.3.4. Qiime Summarize Taxa through plots http://qiime.org/scripts/summarize_taxa_through_plots.html.
Step 13.3.5. Qiime Biome Summarize table http://biom-format.org/documentation/summarizing_biom_tables.html  In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.

DOWNLOAD MATERIALS LIST

References

  1. Bechard, A., Meagher, R., Mason, G. Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice. Journal of the American Association for Laboratory Animal Science : JAALAS. 50, (2), 171-174 (2011).
  2. Jankowsky, J. L., et al. Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease. J Neurosci. 25, (21), 5217-5224 (2005).
  3. Kondo, M., et al. Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression. Eur J Neurosci. 27, (12), 3342-3350 (2008).
  4. Reichmann, F., Painsipp, E., Holzer, P. Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system. PLoS One. 8, (1), 54811 (2013).
  5. Cao, L., et al. Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition. Cell. 142, (1), 52-64 (2010).
  6. Bice, B. D., et al. Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model. Cell reports. 19, (4), 760-773 (2017).
  7. Moser, A. R., Pitot, H. C., Dove, W. F. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science. 247, (4940), 322-324 (1990).
  8. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis. Proc Natl Acad Sci U S A. 108, (12), 4914-4919 (2011).
  9. Holmdahl, R., Malissen, B. The need for littermate controls. Eur J Immunol. 42, (1), 45-47 (2012).
  10. Ubeda, C., et al. Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice. J Exp Med. 209, (8), 1445-1456 (2012).
  11. Spor, A., Koren, O., Ley, R. Unravelling the effects of the environment and host genotype on the gut microbiome. Nat Rev Microbiol. 9, (4), 279-290 (2011).
  12. Fujiwara, R., Watanabe, J., Sonoyama, K. Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers. Br J Nutr. 99, (6), 1174-1177 (2008).
  13. Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation. Lab Anim. 44, (2), 88-103 (2010).
  14. Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice. Frontiers in behavioral neuroscience. 3, 25 (2009).
  15. National Research Council (U.S.). Update of the Guide for the Care and Use of Laboratory Animals. Institute for Laboratory Animal Research (U.S.). National Academies Press. Washington, D.C. 220 (2011).
  16. Silver, L. M. Mouse genetics : concepts and applications. Oxford University Press. New York. (1995).
  17. Chen, M., Kan, L., Ledford, B. T., He, J. Q. Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently. Journal of the American Association for Laboratory Animal Science : JAALAS. 55, (2), 189-198 (2016).
  18. Truett, G. E., et al. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  19. Cole, J. R., et al. Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucleic Acids Res. 42, 633-642 (2014).
  20. Bosshard, P. P., Zbinden, R., Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int J Syst Evol Microbiol. 52, Pt 4 1263-1266 (2002).
  21. Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer. PLoS One. 7, (6), 39743 (2012).
  22. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina. Available from: https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf (2017).
  23. Illumina Experiment Manager. Illumina. Available from: https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html (2017).
  24. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 7, (5), 335-336 (2010).
  25. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis. Durham, NC. (2011).
  26. Knight, R., Caporaso, J. G. QIIME: Multiple Paired Ends Script. QIIME. Available from: http://qiime.org/scripts/multiple_join_paired_ends.html (2017).
  27. Knight, R., Caporaso, J. G. QIIME: De-Novo OTU Picking Protocol. QIIME. Available from: http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  28. Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26, (19), 2460-2461 (2010).
  29. Caporaso, J. G., et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26, (2), 266-267 (2010).
  30. DeSantis, T. Z., et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72, (7), 5069-5072 (2006).
  31. Knight, R., Caporaso, J. G. QIIME: Multiple Split Libraries Fastq Script. QIIME. Available from: http://qiime.org/scripts/multiple_split_libraries_fastq.html (2017).
  32. Knight, R., Caporaso, J. G. QIIME: De Novo Otus Script. QIIME. http://qiime.org/scripts/pick_de_novo_otus.html (2017).
  33. Knight, R., Caporaso, J. G. QIIME: Links to Sample Identification. QIIME. Available from: http://qiime.org/documentation/file_formats.html (2017).
  34. Knight, R., Caporaso, J. G. QIIME: Validation of Mapping File. QIIME. Available from: http://qiime.org/scripts/validate_mapping_file.html (2017).
  35. Knight, R., Caporaso, J. G. QIIME: Link of OTUs to Sample Description Using Mapping File. QIIME. Available from: http://qiime.org/scripts/make_otu_network.html (2017).
  36. Knight, R., Caporaso, J. G. QIIME: Summarize Taxa Through Plots. QIIME. Available from: http://qiime.org/scripts/summarize_taxa_through_plots.html (2017).
  37. Knight, R., Caporaso, J. G. QIIME: Biome Summarize Table Command. QIIME. Available from: http://qiime.org/documentation/summarizing_biom_tables.html (2017).
  38. Moon, C., et al. Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation. Nature. 521, (7550), 90-93 (2015).
  39. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69, (2), 330-339 (2007).
  40. Chen, H. M., et al. Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma. Am J Clin Nutr. 97, (5), 1044-1052 (2013).
  41. Zhu, Q., et al. Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer. PLoS One. 9, (6), 90849 (2014).
  42. Evans, C. C., et al. Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity. PLoS One. 9, (3), 92193 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics