تكوين الأعصاب باستخدام خلايا سرطان الجنين P19

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

يستخدم خط الخلايا السرطانية الجنينية P19 (خط الخلية P19) على نطاق واسع لدراسة الآلية الجزيئية للتكوين العصبي مع تبسيط كبير بالمقارنة مع تحليل في الجسم الحي. هنا، نقدم بروتوكول ًا للتكوين العصبي الناجم عن حمض الريتينويك في خط الخلية P19.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

خط الخلية P19 المستمدة من سرطان التراتوسرطان الفأر المستمدة من الأجنة لديه القدرة على التمييز في الطبقات الجرثومية الثلاث. في وجود حمض الريتينويك (RA)، يتم حث خط الخلية P19 المعلق المستزرع للتمييز في الخلايا العصبية. يتم التحقيق في هذه الظاهرة على نطاق واسع كنموذج تكوين الأعصاب في المختبر. ولذلك، فإن خط الخلية P19 مفيد جدا للدراسات الجزيئية والخلوية المرتبطة تكوين الأعصاب. ومع ذلك، بروتوكولات للتمايز العصبية من خط الخلية P19 الموصوفة في الأدب معقدة جداً. الطريقة التي وضعت في هذه الدراسة بسيطة وسوف تلعب دورا في توضيح الآليات الجزيئية في تشوهات النمو العصبي والأمراض العصبية التنكسية.

Introduction

أثناء النمو الجنيني، يتم تحويل طبقة خليةواحدة إلى ثلاث طبقات جرثومية منفصلة 1،3. ولزيادة إمكانيات البحث عن الظواهر التي تحدث في الجسم الحي، تم تطوير توليد المجاميع ثلاثية الأبعاد (الأجسام الجنينية) كنموذج ملائم. المجاميع الخلوية التي تتشكل بهذه الطريقة يمكن أن تتعرض لظروف مختلفة تسبب تمايز الخلايا، والتي تعكس تطور الجنين4،5. يستخدم خط الخلايا السرطانية الجنينية P19 murine (خط الخلية P19) عادة كنموذج خلوي لدراسات تكوين الأعصاب في المختبر6و7و8. يعرض خط الخلية P19 ميزات الخلايا الجذعية متعددة القوى النموذجية ويمكن أن تميز في الخلايا العصبية في وجود حمض الريتينويك (RA) أثناء تجميع الخلايا تليها نمو النيورايت في ظل ظروف الالتزام. وعلاوة على ذلك، فإن خط الخلية P19 غير المتمايزة قادر أيضا على تشكيل خلايا تشبه العضلات وعضلة القلب تحت تأثير كبريتيد ثنائي الميثيل (DMSO)9،10،11،12.

وقد تم الإبلاغ عن العديد من الطرق13،14،15،16 للتمايز العصبية ، ولكن المنهجية معقدة في بعض الأحيان وليس من السهل فهمها من خلال قراءة الأوصاف فقط. على سبيل المثال، تتطلب البروتوكولات في بعض الأحيان مزيجًا من وسط النسر المعدل (DMEM) من Dulbecco (DMEM) المكمّل بمزيج من مصل العجل (CS) ومصل البقر الجنيني (FBS)13. وعلاوة على ذلك، غالبا ما تتكون وسائل الإعلام المستخدمة لتطوير الخلايا العصبية من المكملات العصبية وB2713،14،15،16. وعلى هذا النحو، فإن الأساليب القائمة تنطوي على تعقيد في إعدادها، وهدفنا هنا هو تبسيط البروتوكولات. في هذه الدراسة، أظهرنا أن DMEM مع FBS يمكن استخدامها للحفاظ على خط الخلية P19 (DMEM + 10٪ FBS) وكذلك لتطوير الخلايا العصبية (DMEM + 5٪ FBS + RA). هذه الطريقة المبسطة للتكوين العصبي باستخدام خط الخلية P19 يسمح لنا لدراسة الآلية الجزيئية لكيفية تطوير الخلايا العصبية. وعلاوة على ذلك، يتم إجراء البحوث على الأمراض العصبية مثل مرض الزهايمر أيضا باستخدام خط الخلية P1917،18، ونعتقد أن الطريقة التي وضعت في هذه الدراسة سوف تلعب دورا في توضيح الآليات الجزيئية في تشوهات النمو العصبي والأمراض العصبية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. صيانة الثقافة

  1. ثقافة خط الخلية P19 في صيانة المتوسطة (دولبكو تعديل النسر المتوسطة مع 4500 ملغ / لتر من الجلوكوز تستكمل مع 10٪ FBS، 100 وحدة / مل البنسلين و 100 وحدة / مل ستربيميتوسين). حضانة في 37 درجة مئوية و5٪ CO 2.

2. الخلايا الفرعية

  1. عندما تصل الخلايا إلى التقاء 80٪ تقريبا، قم بإزالة الوسيطالمستهلك من قوارير زراعة الخلايا (المساحة السطحية 25 سم 2).
  2. غسل الخلايا مع 2 مل من الفوسفات المخزنة المالحة (PBS) خالية من الكالسيوم والمغنيسيوم.
  3. إضافة 1 مل من 0.25٪ تريبسين-إدتا (حمض الإيثيلين ديايمينتيراسيتيك) على الخلية أحادية الطبقة.
  4. ضع القارورة في حاضنة CO2 (37 درجة مئوية و 5% CO2)لمدة 2-3 دقائق.
  5. تقييم مرفق الخلية إلى سطح قارورة. تأكد من أن جميع الخلايا منفصلة وعائمة في الوسط.
  6. إضافة 9 مل من الصيانة المتوسطة لوقف النشاط الأنزيمي من التربسين.
  7. إعادة تعليق الخلايا في "الصيانة المتوسطة".
  8. نقل الخلايا إلى أنبوب 15 مل والطرد المركزي لمدة 5 دقائق في 200 × ز ودرجة حرارة الغرفة (RT).
  9. تخلص من الـ supernatant وأضف 10 مل من الصيانة المتوسطة الطازجة إلى الأنبوب الذي تبلغ مساحته 15 مل.
  10. استخدم تعليق الخلية لتحديد رقم الخلية باستخدام عداد الخلية وفقًا لتعليمات الشركة المصنعة.
  11. خلايا البذور في 2 × 104 خلايا / سم2 في قارورة جديدة 25 سم2.
  12. إضافة الصيانة المتوسطة تصل إلى 10 مل.
  13. وضع قارورة مع الخلايا في حاضنة CO2 (37 درجة مئوية و 5٪ CO2)لمدة 2-3 أيام.

3. التربسين الهضم

  1. Aspirate الصيانة المتوسطة من قارورة الخلية. اغسل الخلايا مرة واحدة مع 2 مل من الكالسيوم والمغنيسيوم خالية PBS.
  2. إضافة 1 مل من 0.25٪ تريبسين-EDTA.
  3. ضع القارورة مع الخلايا في حاضنة CO2 عند درجة حرارة 37 درجة مئوية لمدة 2-3 دقائق.
  4. استخدام ماصة 1 مل لفصل الخلايا عن طريق الأنابيب الخلايا عشر مرات.
  5. تحييد التربسين عن طريق إضافة 9 مل من التمايز المتوسطة (دولبكو تعديل النسر المتوسطة مع 4500 ملغ / لتر من الجلوكوز تستكمل مع 5٪ FBS، 100 وحدة / مل البنسلين و 100 وحدة / مل ستربتوبيسين) دون RA إلى الخلايا.
  6. نقل الخلايا إلى أنبوب 15 مل والطرد المركزي لمدة 5 دقائق في 200 × ز وRT.
  7. تخلص من الـ supernatant وأضف 1 مل من التمايز المتوسط بدون حمض الريتينويك (RA). إعادة تعليق بيليه الخلية.
  8. استخدم تعليق الخلية لتحديد رقم الخلية باستخدام عداد الخلية وفقًا لتعليمات الشركة المصنعة.

4. توليد الكلي

  1. إضافة 5 ميكرولتر من RA (1 m الأسهم المذابة في 99.8٪ الإيثانول، المخزنة في -20 درجة مئوية) إلى 10 مل من التمايز المتوسط ومزيج جيدا (التركيز النهائي من 0.5 درجة مئوية RA).
    ملاحظة: RA حساسة للضوء. انخفاض تركيز EtOH لا يؤثر على تمايز الخلايا19،20،21.
  2. أضف 10 مل من التمايز المتوسط (مع RA) إلى طبق الثقافة غير المعالج 100 مم (مخصص لثقافة التعليق).
  3. بذور 1 × 106 الخلايا في طبق 100 ملم (طبق مساحة سطح 56.5 سم2).
  4. وضع قارورة مع الخلايا في الحاضنة في 37 درجة مئوية و 5٪ CO2 لمدة 2 أيام من أجل تعزيز تشكيل المجاميع.
  5. بعد يومين، تبادل المتوسطة التمايز. يستنشق المتوسطة التي تحتوي على المجاميع باستخدام ماصة 10 مل ونقلإلى أنبوب 15 مل في RT.
  6. السماح المجاميع لتسوية من قبل الجاذبية لمدة 1.5 دقيقة في RT.
  7. تجاهل الـ supernatant.
  8. إضافة 10 مل جديدة من التمايز المتوسطة مع 0.5 μM RA باستخدام ماصة المصلية 10 مل.
    تحذير: لا ماصة المجمعات الخلية صعودا وهبوطا.
  9. يُبذر المجاميع في طبق ثقافة جديد غير معالج مقاس 100 مم (مخصص لثقافة التعليق).
  10. وضع لوحة في الحاضنة (في 37 درجةمئوية و 5٪ CO 2) لمدة 2 أيام.

5. تفكك المجاميع

  1. يستنشق مجاميع الخلية باستخدام ماصة 10 مل.
  2. نقل المجاميع إلى أنبوب 15 مل. السماح لمجاميع الخلية لتسوية الجاذبية لمدة 1.5 دقيقة.
  3. إزالة supernatant.
  4. غسل المجاميع مع DMEM وحدها (المصل- والمضادات الحيوية خالية).
  5. السماح لمجاميع الخلية لتسوية عن طريق ترسيب الجاذبية لمدة 1.5 دقيقة في RT.
  6. يستنشق supernatant وإضافة 2 مل من التربسين-EDTA (0.25٪).
  7. ضع مجاميع الخلية في حمام مائي (37 درجة مئوية) لمدة 10 دقائق.
  8. إيقاف عملية التغريب عن طريق إضافة 4 مل من "الصيانة المتوسطة".
  9. ماصة المجاميع صعودا وهبوطا 20 مرة باستخدام ماصة 1 مل.
  10. خلايا الطرد المركزي لمدة 5 دقائق في 200 × ز وRT.
  11. إزالة supernatant وإعادة تعليق بيليه الخلية في 5 مل من الصيانة المتوسطة.
  12. تحديد رقم الخلية مع عداد خلية.

6. خلايا الطلاء

  1. إضافة 3 مل لكل بئر من الصيانة المتوسطة إلى لوحة 6 جيدا.
  2. خلايا البذور في لوحة الثقافة 6-جيدا في كثافة 0.5 × 106/well.
  3. حضانة في 37 درجة مئوية مع تركيز CO2 5٪.
  4. بذور الخلايا على الزجاج غطاء في 6 لوحة ثقافة جيدا وأداء مناعة مع الأجسام المضادة للMAP2 (20٪ التقاء). استخدام لوحة 6-جيدا لعزل الحمض النووي الريبي وأداء RT-PCR لMap2، NeuN، Oct4، Nanog،وغابه (20٪ التقاء).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

وترد في الشكل 1المخطط المبسط للبروتوكول الخاص بتحريض تكوين الأعصاب في خط الخلية P19. من أجل تحديد طابع خط الخلية P19 في حالة غير متمايزة وخلال تكوين الأعصاب، تم استخدام طريقة RT-PCR (النسخ العكسي-polymerase) طريقة التفاعل المتسلسل. وأعرب خط الخلية P19 غير المتمايزة عن الجينات متعددة القوى مثل الموجبة العضوية / carnitine transporter4 (Oct4) وNanog homeobox (Nanog). التكوّن العصبي الناجم عن تجميع الخلايا في ثقافة التعليق في وجود RA أدى إلى انخفاض سريع في التعبير Oct4 وNanog. على العكس من ذلك، التعبير عن علامات الخلايا العصبية: البروتين المرتبط بالأنابيب الدقيقة 2 (Map2)، NeuN (المعروف أيضا باسم البروتين الملزم الحمض النووي الريبي، فوكس-1 التجانس 3 (Rbfox3)) زيادة بعد إثارة تكوين الأعصاب (الشكل 2)6 ،14،15،22. يشار إلى التمهيديات المستخدمة لكل جين جنبا إلى جنب مع تسلسل النيوكليوتيدوحجم من المنتج في الجدول 1. صورة مجهرية من خط الخلية P19 غير متمايزة قدمت مورفولوجيا على شكل دائري (الشكل3A). بعد تحريض تكوين الأعصاب، كان الهيكل العصبي للخلايا مرئية بوضوح 4 أيام بعد الطلاء (الشكل3B). بالإضافة إلى ذلك، يمثل الشكل 4 صورة الفلورة للتعبير MAP2 في خط الخلية P19 المتمايزة (4 أيام بعد خلايا الطلاء)14.

Figure 1
الشكل 1 مخطط البروتوكول لتحريض تكوين الأعصاب في خلايا السرطان الجنينية P19. يتم التسبب في تكوين الأعصاب عن طريق زراعة خط الخلية P19 في طبق ثقافة غير المعالجة 100 مم مع 5٪ من FBS و 0.5 درجة مئوية RA. بعد 4 أيام، يتم فصل مجاميع الخلايا مع التربسين وبذرها على لوحة ثقافة الخلية الملتصقة لمدة 4 أيام التالية. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2 تغييرات التعبير الجيني في خط الخلية P19. يمثل الرسم البياني للنطاق التعبير الجيني لخط الخلايا P19 غير المتمايز(Oct4, Nanog)وأثناء تكوين الأعصاب (Map2,NeuN). تم استخدام غليسيرالدهايد-3-فوسفات ديهيدروجيناز (غابه) كجين مرجعي. يتم تحميل العينات في هلام أغاروز (1.5٪) في النسخ المتماثل المزدوج. المختصرات: يمثل غير متمايز خط الخلية P19 غير المتمايزة دون علاج RA; اليوم 1-4 يمثل الأيام اللاحقة بعد طلاء الخلايا- بعد 4 أيام بعد العلاج RA ومرحلة تجميع الخلايا. الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3 الصور التمثيلية لتحليل خط الخلية P19. (أ) صور مجهرية خفيفة من خط الخلية P19 غير متمايزة. (B) صور مجهرية خفيفة من خط الخلية P19 بعد 4 أيام من تكوين الأعصاب- بعد 4 أيام بعد العلاج RA ومرحلة تجميع الخلايا. شريط مقياس = 100 درجة.

Figure 4
الشكل 4 صورة تمثيلية للمناعة من خط الخلية P19 المتمايزة. صورة مدمجة من الفلورة من خط الخلية P19 ملطخة المضادة للMAP2 وDAPI في 4 أيام بعد الطلاء. شريط مقياس = 100 درجة.

التمهيدي تسلسل التمهيدي المنتج
حجم (bp)
غابده F: TGACCTCAACTACATGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
الخريطة2 F: GCTGAGATCATCACACAC
R: TCCTGCCAAGAGCTCATGCC
211
أكتوبر- تشرين الأول 4 F: GGCGTTCTCTTTGGAAAggTGTTC
R: CTCGAACCACATCCTTTT
313
نيوين F: GGCAAATTCGGGCAATTCG
R: TCATTTCCCCCCTACGTGAT
160
نانوغ F: AAaggatGAAGTGCAAGGTGT
R: CTGGCTTTGCCCTGACTAAGC
520

الجدول 1: المواد التمهيدية المستخدمة في الـ RT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

هنا، ونحن نصف بروتوكول بسيط لتكوين الأعصاب باستخدام خط الخلية P19. على الرغم من أن العديد من التقارير قد نشرت في هذا الصدد، لا تزال منهجية مفصلة للتحريض تكوين الأعصاب باستخدام خط الخلية P19 غير واضحة. وعلاوة على ذلك، استخدمنا الجلوكوز عالية بسيطة (4500 ملغ / لتر) DMEM المتوسطة مع 10٪ FBS للتجربة بأكملها. وقد سمح لنا ذلك بإجراء التجربة العصبية بطريقة سهلة الاستخدام وتوسيع نطاق استخدام هذه الطريقة في المستقبل.

النقاط الأكثر أهمية في هذا البروتوكول هي تركيز RA وكذلك توليد مجاميع الخلايا في ثقافة التعليق. يمكن تنفيذ تحفيز تكوين الأعصاب في خط الخلية P19 دون تشكيل المجاميع، ولكن سيتم تخفيض عدد الخلايا العصبية المنتجة بنسبة الثلثين في ثقافة الخلية22. وقد أظهرت Monzo وآخرون تحريض تكوين الأعصاب في خط الخلية P19 عن طريق زراعة لهم في أحادية الطبقة15. على الرغم من أن طريقتهم مريحة جداً كما يمكننا القضاء على عملية ثقافة التعليق، هناك حاجة إلى مزيد من الدراسات لمقارنة طريقتهم مع غيرها من الأساليب الموصوفة جيدا. وقد نتج تركيز RA الذي يبلغ 0.5 درجة مئوية في المتوسط عن عدد كبير من مجاميع الخلايا وكذلك الخلايا العصبية بعد الطلاء مقارنة بـ 1 ميكرومتر من RA. من المهم أيضًا ملاحظة أننا لم نتمكن من ملاحظة تكوين عصبي فعال عندما يتم إرفاق معظم المجاميع بالجزء السفلي من طبق ثقافة التعليق أثناء علاج RA. الرقم الأمثل لخط الخلية P19 ليتم استخدامه في بداية الإجراء هو 1 × 106 لكل 10 مل من التمايز المتوسط. أثناء تحريض تكوين الأعصاب، يشكل خط الخلية P19 مجاميع متفاوتة الحجم وحتى الخلايا المفردة موجودة في الثقافة. للتغلب على هذه المشكلة، جمعنا المجاميع الخلية بعد 1.5 دقيقة من السقوط الحر في أنبوب 15 مل. ووجدنا أن هذا النهج يسمح باستبعاد تلوث الخلايا المفردة. ومن المستحسن أيضا لإجراء إثراء الخلايا العصبية مع ثقافة الخلية باستخدام الأدوية المضادة للميتوتيك (على سبيل المثال، السيتوسين أرابينوسيد) للثقافة على المدى الطويل لمنع انتشار واسع النطاق من الخلايا الغليفية23.

الخلايا العصبية المستمدة من خط الخلية P19 التعبير عن مستقبلات الغلوتامات الأيونوتروبيك من كل من N-ميثيل-D-أسبارتات (NMDA) وألفا أمينو-3-هيدروكسي-5-ميثيل-4-إيزوكسازول بروبيونات (أمبا)/كاينيت (كا) أنواع24,25, وكذلك وظيفية γ-أمينوبوتيريك حمض (غابا) مستقبلات25. ولذلك، يستخدم خط الخلية P19 على نطاق واسع في الدراسات على الآليات الجزيئية التي تحكم التمايز العصبي26،27،28. والأهم من ذلك، لم يلاحظ تطور الورم بعد زرع الخلايا29،30.

ولهذه الغاية، يتم إجراء البحوث على الأمراض العصبية مثل مرض الزهايمر17،18 أيضا باستخدام خط الخلية P19 ، ونعتقد أن الطريقة التي وضعت في هذه الدراسة وبالتالي سوف تلعب دورا في توضيح الجزيئية آليات في تشوهات النمو العصبي والأمراض العصبية التنكسية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وليس لدى أصحاب البلاغ ما يكشفون عنه.

Acknowledgments

وحظيت الدراسة بدعم مالي من المركز الوطني للعلوم في بولندا (منحة رقم. UMO-2017/25/N/NZ3/01886) وKNOW (مركز البحوث الوطنية الرائدة) الاتحاد العلمي "صحة الحيوان - الغذاء الآمن"، قرار وزارة العلوم والتعليم العالي رقم 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics