Neurogenese mit P19 Embryonalkarzinomzellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Die p19 Maus embryonale Karzinom-Zelllinie (P19-Zelllinie) ist weit verbreitet für die Untersuchung des molekularen Mechanismus der Neurogenese mit großer Vereinfachung im Vergleich zur In-vivo-Analyse verwendet. Hier stellen wir ein Protokoll zur Retinosäure-induzierten Neurogenese in der P19-Zelllinie vor.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die P19-Zelllinie, die von einem von Einem Mausembryon abgeleiteten Teratokarzinom abgeleitet wurde, hat die Fähigkeit, sich in die drei Keimschichten zu differenzieren. In Gegenwart von Retinsäure (RA) wird die suspensionskultivierte P19-Zelllinie induziert, um sich in Neuronen zu differenzieren. Dieses Phänomen wird als Neurogenese-Modell in vitro ausgiebig untersucht. Daher ist die P19-Zelllinie sehr nützlich für molekulare und zelluläre Studien im Zusammenhang mit Neurogenese. Protokolle zur neuronalen Differenzierung der in der Literatur beschriebenen P19-Zelllinie sind jedoch sehr komplex. Die in dieser Studie entwickelte Methode ist einfach und wird eine Rolle bei der Aufklärung der molekularen Mechanismen bei neuroentwicklungsbedingten Anomalien und neurodegenerativen Erkrankungen spielen.

Introduction

Während der embryonalen Entwicklung wird eine einzellige Schicht in drei separate Keimschichten1,2,3umgewandelt. Um die Forschungsmöglichkeiten von Phänomenen zu erhöhen, die in vivo vorkommen, wurde die Erzeugung dreidimensionaler Aggregate (embryonale Körper) als praktisches Modell entwickelt. Zellaggregate, die auf diese Weise gebildet werden, können verschiedenen Bedingungen ausgesetzt werden, die eine Zelldifferenzierung verursachen, die die Entwicklung des Embryos4,5widerspiegeln. Die p19 murinische embryonale Karzinom-Zelllinie (P19-Zelllinie) wird häufig als zelluläres Modell für Neurogenese-Studien in vitro6,7,8verwendet. Die P19-Zelllinie weist typische pluripotente Stammzellmerkmale auf und kann sich in Gegenwart von Retinsäure (RA) während der Zellaggregation in Neuronen differenzieren, gefolgt von Neuritenwachstum unter anhaftenden Bedingungen. Darüber hinaus ist die undifferenzierte P19-Zelllinie auch in der Lage, unter dem Einfluss von Dimethylsulfoxid (DMSO)9,10,11,12muskel- und kardiomyozytenähnliche Zellen zu bilden.

Viele Methoden13,14,15,16 wurden für die neuronale Differenzierung berichtet, aber die Methodik ist manchmal kompliziert und nicht leicht zu erfassen, indem man nur die Beschreibungen liest. Beispielsweise erfordern Protokolle manchmal eine Kombination aus Dulbeccos Modified Eagle Medium (DMEM) Medium, ergänzt durch eine Mischung aus Kalbsserum (CS) und fetalem Rinderserum (FBS)13. Darüber hinaus, Medien für die neuronale Entwicklung verwendet werden oft aus neurobasalen und B27 Ergänzungen13,14,15,16. Daher enthalten bestehende Methoden Komplexität in ihrer Vorbereitung und unser Ziel ist es, die Protokolle zu vereinfachen. In dieser Studie haben wir gezeigt, dass DMEM mit FBS zur Aufrechterhaltung der P19-Zelllinie (DMEM + 10% FBS) sowie zur neuronalen Entwicklung (DMEM + 5% FBS + RA) eingesetzt werden kann. Diese vereinfachte Methode für die Neurogenese mit der P19-Zelllinie ermöglicht es uns, den molekularen Mechanismus zu untersuchen, wie Neuronen entwickelt werden. Darüber hinaus wird die Forschung zu neurodegenerativen Erkrankungen wie der Alzheimer-Krankheit auch mit P19-Zelllinie17,18durchgeführt, und wir glauben, dass die in dieser Studie entwickelte Methode eine Rolle bei der Aufklärung der molekulare Mechanismen bei neuroentwicklungsbedingten Anomalien und neurodegenerativen Erkrankungen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Kulturpflege

  1. Kultur der P19-Zelllinie im Wartungsmedium (Dulbeccos modifiziertes Eagle-Medium mit 4.500 mg/L Glukose, ergänzt durch 10% FBS, 100 Einheiten/ml Penicillin und 100 Einheiten/ml Streptomycin). Bei 37 °C und 5%CO2 inkubieren.

2. Unterkultivierungszellen

  1. Wenn Zellen etwa 80 % Zusammenfluss erreichen, entfernen Sie das verbrauchte Medium aus den Zellkulturkolben (Oberfläche 25 cm2).
  2. Waschen Sie die Zellen mit 2 ml Phosphatgepufferter Saline (PBS) frei von Kalzium und Magnesium.
  3. 1 ml 0,25% Trypsin-EDTA (Ethylendiamintetraessigsäure) auf die Zellmonoschicht geben.
  4. Legen Sie den Kolben 2-3 min in den CO2-Inkubator (37 °C und 5% CO2).
  5. Bewerten Sie die Zellbefestigung an der Kolbenoberfläche. Stellen Sie sicher, dass alle Zellen getrennt und im Medium schwebend sind.
  6. Fügen Sie 9 ml Wartungsmedium hinzu, um die enzymatische Aktivität von Trypsin zu stoppen.
  7. Setzen Sie die Zellen in Maintenance Medium wieder aus.
  8. Übertragen Sie Zellen in ein 15 ml Rohr und Zentrifuge für 5 min bei 200 x g und Raumtemperatur (RT).
  9. Entsorgen Sie den Überstand und fügen Sie 10 ml frisches Wartungsmedium in das 15 ml-Rohr ein.
  10. Verwenden Sie die Zellsuspension, um die Zellnummer anhand eines Zellzählers gemäß den Anweisungen des Herstellers zu bestimmen.
  11. Samenzellen bei 2 x 104 Zellen/cm2 in einem neuen 25 cm2 Kolben.
  12. Fügen Sie das Wartungsmedium bis zu 10 ml hinzu.
  13. Legen Sie den Kolben mit Zellen in den CO2-Inkubator (37 °C und 5% CO2 ) für 2-3 Tage.

3. Trypsin Verdauung

  1. Aspirate Maintenance Medium aus dem Zellkolben. Waschen Sie die Zellen einmal mit 2 ml Calcium und Magnesium-freiem PBS.
  2. 1 ml 0,25% Trypsin-EDTA hinzufügen.
  3. Den Kolben mit Zellen bei 37 °C für 2-3 min in den CO2-Inkubator stellen.
  4. Verwenden Sie 1 ml Pipette, um die Zellen durch zehnfache Pipettierzellen zu dissoziieren.
  5. Neutralisieren Sie Trypsin, indem Sie 9 ml Differenzierungsmedium (Dulbeccos modifiziertes Eagle-Medium mit 4500 mg/L Glukose, ergänzt durch 5% FBS, 100 Einheiten/ml Penicillin und 100 Einheiten/ml Streptomycin) ohne RA zu den Zellen hinzufügen.
  6. Übertragen Sie Zellen für 5 min bei 200 x g und RT in ein 15 ml-Rohr und eine Zentrifuge.
  7. Entsorgen Sie den Überstand und fügen Sie 1 ml Differenzierungsmedium ohne Retinsäure (RA) hinzu. Setzen Sie das Zellpellet wieder auf.
  8. Verwenden Sie die Zellsuspension, um die Zellnummer mithilfe eines Zellzählers gemäß der Anweisung des Herstellers zu bestimmen.

4. Aggregaterzeugung

  1. Fügen Sie 5 l RA (1 mM In 99,8% Ethanol gelöst, bei -20 °C gelagert) zu den 10 ml Differenzierungsmedium hinzu und mischen Sie gut (Endkonzentration von 0,5 m RA).
    HINWEIS: RA ist lichtempfindlich. Eine niedrige Konzentration von EtOH hat keinen Einfluss auf die Zelldifferenzierung19,20,21.
  2. Fügen Sie 10 ml Differenzierungsmedium (mit RA) in das 100 mm unbehandelte Kulturgericht (für Diefederkultur) ein.
  3. Säen Sie die 1 x 106 Zellen in der 100 mm Schale (Dish Oberfläche 56,5 cm2).
  4. Setzen Sie den Kolben mit Zellen bei 37 °C und 5% CO2 für 2 Tage in den Inkubator, um die Bildung von Aggregaten zu fördern.
  5. Tauschen Sie nach 2 Tagen das Differenzierungsmedium aus. Aspiratmittel, das Aggregate mit einer 10 ml Pipette enthält und bei RT in ein 15 ml-Rohr überträgt.
  6. Lassen Sie die Aggregate durch Schwerkraft für 1,5 min bei RT abgleichen.
  7. Entsorgen Sie den Überstand.
  8. Fügen Sie eine frische 10 ml Differenzierungsmedium mit 0,5 m RA mit einer 10 ml serologischen Pipette.
    ACHTUNG: Pipette die Zellaggregate nicht nach oben und unten.
  9. Säen Sie die Aggregate in neue 100 mm unbehandelte Kulturschale (für Suspensionskultur).
  10. Legen Sie die Platte 2 Tage lang in den Inkubator (bei 37 °C und 5% CO2).

5. Aggregate Dissoziation

  1. Aspirieren Sie die Zellaggregate mit einer 10 ml Pipette.
  2. Übertragen Sie die Aggregate in ein 15 ml Rohr. Lassen Sie die Zellaggregate durch Schwerkraft für 1,5 min abgleichen.
  3. Entfernen Sie den Überstand.
  4. Waschen Sie die Aggregate allein mit DMEM (serum- und antibiotikafrei).
  5. Lassen Sie die Zellaggregate durch Gravitationssedimentation für 1,5 min bei RT absetzen.
  6. Aspirieren Sie den Überstand und fügen Sie 2 ml Trypsin-EDTA (0,25%).
  7. Legen Sie die Zellaggregate 10 min in ein Wasserbad (37 °C). Rühren Sie die Aggregate alle 2 min vorsichtig, indem Sie mit einer Hand tippen.
  8. Beenden Sie den Trypsinisierungsprozess, indem Sie 4 ml Wartungsmedium hinzufügen.
  9. Pipette aggregiert 20 Mal mit 1 ml Pipette nach oben und unten.
  10. Zentrifugenzellen für 5 min bei 200 x g und RT.
  11. Entfernen Sie den Überstand und setzen Sie das Zellpellet in 5 ml Wartungsmedium wieder auf.
  12. Bestimmen Sie die Zellennummer mit einem Zellenzähler.

6. Plattieren von Zellen

  1. Fügen Sie 3 ml pro Bohrgut von Maintenance Medium zu einer 6-Well-Platte hinzu.
  2. Samenzellen in der 6-Well-Kulturplatte mit einer Dichte von 0,5 x 106/well.
  3. Bei 37 °C mit 5% CO2-Konzentration inkubieren.
  4. Säen Sie die Zellen auf Deckglas in 6 Brunnenkulturplatte und führen Sie Immunfärbung mit Anti-MAP2-Antikörper (20% Zusammenfluss). Verwenden Sie 6-Well-Platte, um RNA zu isolieren und RT-PCR für Map2, NeuN, Oct4, Nanogund Gapdh (20% Zusammenfluss) durchzuführen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Das vereinfachte Schema des Protokolls für die Neurogenese-Induktion in Der P19-Zelllinie ist in Abbildung 1dargestellt. Um den Charakter der P19-Zelllinie in einem undifferenzierten Zustand und während der Neurogenese zu definieren, wurde die RT-PCR-Methode (Reverse Transkription-Polymerase-Kettenreaktion) verwendet. Die undifferenzierte P19-Zelllinie exprimierte die Pluripotenzgene wie organischekation/carnitin transporter4 (Oct4) und Nanog homeobox (Nanog). Neurogenese induziert durch Zellaggregation in Suspensionskultur in Gegenwart von RA führte zu einer schnellen Abnahme der Oct4 und Nanog Expression. Im Gegensatz dazu nahm die Expression von Neuronenmarkern: mikrotubuli-assoziiertes Protein 2 (Map2), NeuN (auch bekannt als RNA-bindendes Protein, Fox-1 Homolog 3 (Rbfox3)) nach ausgelöster Neurogenese zu (Abbildung 2)6 ,14,15,22. Die für jedes Gen verwendeten Primer sind zusammen mit Nukleotidsequenzen und der Größe des Produkts in Tabelle 1 angegeben. Ein mikroskopisches Bild der undifferenzierten P19-Zelllinie zeigte eine runde Morphologie (Abbildung 3A). Nach der Induktion der Neurogenese war die neuronale Struktur der Zellen 4 Tage nach der Beschichtung deutlich sichtbar (Abbildung 3B). Zusätzlich stellt Abbildung 4 das Fluoreszenzbild der MAP2-Expression in der differenzierten P19-Zelllinie (4 Tage nach der Beschichtung von Zellen)14dar.

Figure 1
Abbildung 1 : Protokollschema für die Induktion der Neurogenese in P19 embryonalen Karzinomzellen. Die Neurogenese wird induziert, indem die P19-Zelllinie in einer 100 mm unbehandelten Kulturschale mit 5% FBS und 0,5 M RA kultiviert wird. Nach 4 Tagen werden die Zellaggregate mit Trypsin dissoziiert und auf der anhaftenden Zellkulturplatte für die nächsten 4 Tage gesät. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2 : Veränderungen der Genexpression in der Zelllinie P19. Das Banddiagramm stellt die Genexpression für die undifferenzierte P19-Zelllinie (Okt4, Nanog) und während der Neurogenese (Map2, NeuN) dar. Als Referenzgen wurde Glyceraldehyd-3-Phosphat-Dehydrogenase (Gapdh) verwendet. Proben werden in das Agarose-Gel geladen (1,5%) in Doppelreplikationen. Abkürzungen: Undifferenziert stellt die undifferenzierte P19-Zelllinie ohne RA-Behandlung dar; Tag 1-4 steht für die folgenden Tage nach der Zellbeschichtung – nach 4 Tagen nach DER RA-Behandlung und der Zellaggregationsphase. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3 : Repräsentative Bilder der Analyse der Zelllinie P19. (A) Leichte mikroskopische Bilder von undifferenzierter P19-Zelllinie. (B) Leichte mikroskopische Bilder der P19-Zelllinie nach 4 Tagen Neurogenese - nach 4 Tagen nach RA-Behandlung und Zellaggregationsphase. Maßstabsleiste = 100 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4 : Repräsentatives Immunfluoreszenzbild der differenzierten P19-Zelllinie. Zusammengeführtes Immunfluoreszenzbild der P19-Zelllinie, die 4 Tage nach der Beschichtung mit Anti-MAP2 und DAPI gefärbt ist. Maßstabsleiste = 100 m. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

leitfaden Primer-Sequenz ergebnis
Größe (bp)
Gapdh F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATCTCGGCCTTG
85
Karte2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCTGCC
211
Okt4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tabelle 1: Für RT-PCR verwendete Primer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier beschreiben wir ein einfaches Protokoll für die Neurogenese mit der P19-Zelllinie. Obwohl viele Berichte in dieser Hinsicht veröffentlicht wurden, eine detaillierte Methodik für Neurogenese Induktion mit P19-Zelllinie bleibt unklar. Darüber hinaus haben wir ein einfaches hochglukose (4.500 mg/L) DMEM-Medium mit 10% FBS für das gesamte Experiment verwendet. Dies ermöglichte es uns, das neurogene Experiment benutzerfreundlich durchzuführen und die Anwendung dieser Methode für die Zukunft zu erweitern.

Die kritischsten Punkte in diesem Protokoll sind die RA-Konzentration sowie die Erzeugung von Zellaggregaten in der Suspensionskultur. Die Stimulation der Neurogenese in der P19-Zelllinie kann ohne die Bildung von Aggregaten durchgeführt werden, aber die Anzahl der produzierten neuronalen Zellen wird in der Zellkultur um zwei Drittel reduziert22. Monzo et al. haben die Neurogenese-Induktion in der P19-Zelllinie gezeigt, indem sie sie in Monolayer15kultiviert haben. Obwohl ihre Methode sehr praktisch ist, da wir Suspension Sondenkultur-Prozess beseitigen können, sind weitere Studien erforderlich, um ihre Methode mit anderen gut beschriebenen Methoden zu vergleichen. Die RA-Konzentration von 0,5 m im Medium ergab eine hohe Anzahl von Zellaggregaten sowie Neuronen nach der Beschichtung im Vergleich zu 1 m RA. Es ist auch wichtig zu beachten, dass wir eine effiziente Neurogenese nicht beobachten konnten, wenn die meisten Aggregate während der RA-Behandlung an der Unterseite der Suspensionskulturschale befestigt sind. Die optimale Anzahl der zu Beginn des Verfahrens zu verwendenden P19-Zelllinie beträgt 1 x 106 pro 10 ml Differenzierungsmedium. Während der Induktion der Neurogenese bildet die P19-Zelllinie unterschiedliche Aggregate und sogar einzelne Zellen finden sich in der Kultur. Um dieses Problem zu lösen, sammelten wir die Zellaggregate nach 1,5 min freien Fall in einem 15 ml Rohr. Wir fanden heraus, dass dieser Ansatz den Ausschluss der Kontamination einzelner Zellen ermöglicht. Es wird auch empfohlen, neuronale Anreicherung mit der Zellkultur mit Anti-Mitotik-Medikamente (z.B. Cytosin-Arabinosid) für langfristige Kultur durchzuführen, um die extensive Proliferation von Gliazellen zu hemmen23.

Neuronen, die aus der P19-Zelllinie gewonnen wurden, exprimieren ionotrope Glutamatrezeptoren sowohl der N-Methyl-D-Aspartat-Rezeptoren (NMDA) als auch der Alpha-Amino-3-Hydroxy-5-methyl-4-isoxazolpropionat (AMPA)/Kainit (KA) Typen24,25, sowie funktionellen Rezeptoren für Aminobuttersäure (GABA)25. Daher ist die P19-Zelllinie in den Studien über molekulare Mechanismen zur neuronalen Differenzierung weit verbreitet26,27,28. Noch wichtiger ist, dass die Tumorentwicklung nach der Zelltransplantation nicht beobachtet wurde29,30.

Zu diesem Zweck wird die Erforschung neurodegenerativer Erkrankungen wie der Alzheimer-Krankheit17,18 auch mit P19-Zelllinie durchgeführt, und wir glauben, dass die in dieser Studie entwickelte Methode somit eine Rolle bei der Aufklärung der molekularen Mechanismen bei neuroentwicklungsbedingten Anomalien und neurodegenerativen Erkrankungen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Die Studie wurde vom National Science Centre, Polen (Grant-Nr. UMO-2017/25/N/NZ3/01886) und KNOW (Leading National Research Centre) Scientific Consortium "Healthy Animal - Safe Food", Entscheidung des Ministeriums für Wissenschaft und Hochschulbildung Nr. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics