Nörojenez P19 embriyonal karsinom hücrelerini kullanarak

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

P19 fare embriyonik karsinom hücre hattı (P19 hücre hattı) yaygın olarak büyük basitleştirme ile nörojenez moleküler mekanizmasını incelemek için kullanılan in vivo analizi ile karşılaştırıldığında. Burada, P19 hücre hattında retinoik asit kaynaklı nörogenezi için bir protokol sunuyoruz.

Cite this Article

Copy Citation | Download Citations

Leszczyński, P., Śmiech, M., Teeli, A. S., Zołocińska, A., Słysz, A., Pojda, Z., Pierzchała, M., Taniguchi, H. Neurogenesis Using P19 Embryonal Carcinoma Cells. J. Vis. Exp. (146), e58225, doi:10.3791/58225 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bir fare embriyo türevi teratokarsinoma türetilen P19 hücre hattı üç mikrop katmanları ayırt etme yeteneğine sahiptir. Retinoik asit (RA) varlığında, süspansiyon kültürlü P19 hücre hattı nöronlara ayırt etmek için indüklenir. Bu fenomen bir nörojenez modeli olarak yaygın olarak incelenmiştir. Bu nedenle, P19 hücre hattı neurogenesis ile ilişkili moleküler ve hücresel çalışmalar için çok yararlıdır. Ancak literatürde açıklanan P19 hücre hattının nöronal farklılaşması için protokoller çok karmaşıktır. Bu çalışmada geliştirilen Yöntem basittir ve nörogelişimsel anomalilerde ve nörodejeneratif hastalıklarda moleküler mekanizmaların aydınlatılmasına bir rol oynayacak.

Introduction

Embriyonal gelişim sırasında, tek bir hücre tabakası üç ayrı germ katmanına dönüştürülür1,2,3. İn vivo oluşan olayların araştırma olanaklarını artırmak için, üç boyutlu toplamları (embriyonik organları) nesil uygun bir model olarak geliştirilmiştir. Bu şekilde oluşan hücresel agregalar, embriyo4,5' in gelişimini yansıtan hücre farklılaşmasına neden olan çeşitli koşullara maruz kalabilirler. P19 murine embriyonik karsinom hücre hattı (P19 hücre hattı) yaygın olarak kullanılan bir hücresel model olarak nörojenez çalışmaları için vitro6,7,8. P19 hücre hattı, tipik pluripotent kök hücre özelliklerini sergiler ve hücre toplama sırasında retinoik asit (RA) varlığında nöronların içine yapışabilir koşullar altında nörit gelişiminin ardından ayırt edebilirsiniz. Dahası, farklılaşılmış P19 hücre hattı da dimetil sülfoxid (DMSO)9,10,11,12etkisi altında kas ve kardiyomiyosit benzeri hücreler şekillendirme yeteneğine sahiptir.

Birçok yöntem13,14,15,16 nöronal farklılaşma için bildirilmiştir, ancak metodoloji bazen karmaşık ve sadece açıklamaları okuyarak kavramak kolay değil. Örneğin, protokoller bazen buzağı serum (CS) ve fetal sığır serumu (FBS)13karışımı Ile tamamlayıcı Dulbecco modifiye kartal Orta (dmem) orta bir kombinasyonu gerektirir. Dahası, nöronal gelişim için kullanılan medya genellikle nörobasal ve B27 takviyeleri oluşur13,14,15,16. Bu nedenle, mevcut yöntemler onların hazırlanması karmaşıklık içerir ve burada amacımız protokolleri basitleştirmek için. Bu çalışmada, biz FBS ile DMEM P19 hücre hattı (DMEM + 10% FBS) yanı sıra nöronal gelişim için (DMEM + 5% FBS + RA) korumak için kullanılabilir olduğunu göstermiştir. P19 hücre hattını kullanarak nörogenezi için bu Basitleştirilmiş Yöntem bize nöronların nasıl geliştirildiğini moleküler mekanizması çalışma sağlar. Dahası, Alzheimer hastalığı gibi nörodejeneratif hastalıklar üzerinde araştırma da P19 hücre hattı kullanılarak gerçekleştirilir17,18, ve biz bu çalışmada geliştirilen Yöntem aydınlatılmasına bir rol oynayacaktır inanıyoruz nörogelişimsel anomalilerde ve nörodejeneratif hastalıklarda moleküler mekanizmalar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. kültür Bakımı

  1. Kültür P19 hücre hattı bakım ortamı (Dulbecco modifiye kartal orta ile 4.500 mg/L glikoz ile tamamlayıcı 10% FBS, 100 birimler/mL penisilin ve 100 birimleri/mL streptomisin). 37 °C ve% 5 CO2' de Inküye.

2. alt-kültür hücreleri

  1. Hücreler yaklaşık% 80 konfluence ulaştığında, harcanan ortamı hücre kültürü flsorından çıkarın (yüzey alanı 25 cm2).
  2. Hücreleri 2 mL fosfat tamponlu tuz (PBS) ile kalsiyum ve magnezyum içermeyen yıkayın.
  3. Ekle 1 mL 0,25% tripsin-EDTA (Etilen asit) hücre monolayer üzerine.
  4. 2-3 dakika boyunca CO2 inkükobu (37 °c ve% 5 Co2) ile Flask koyun.
  5. Hücre ekini Flask yüzeyine değerlendirin. Tüm hücrelerin ayrılmış ve ortamda yüzen emin olun.
  6. Trypsin enzimatik etkinliğini durdurmak için 9 mL bakım orta ekleyin.
  7. Bakım ortamında hücreleri yeniden resuspend.
  8. Hücreleri 15 mL 'Lik bir tüpe aktarın ve 200 x g ve oda SıCAKLıĞıNDA (RT) 5 dakika santrifüj yapın.
  9. Süpernatant atın ve 15 ml tüp içine taze bakım orta 10 ml ekleyin.
  10. Hücre sayacını, üreticinin talimatlarına göre bir hücre sayacı kullanarak belirlemek için hücrenin süspansiyonunu kullanın.
  11. Tohum hücreleri 2 x 104 hücreler/cm2 yeni bir 25 cm2 Flask.
  12. Bakım orta 10 mL 'ye kadar ekleyin.
  13. 2-3 gün boyunca CO2 kuluçvator (37 °c ve 5% Co2) hücreleriyle Flask koyun.

3. tripsin sindirim

  1. Hücre şişinden aspirate bakım orta. Hücreleri bir kez 2 mL kalsiyum ve magnezyum içermeyen PBS ile yıkayın.
  2. 1 mL 0,25% tripsin-EDTA ekleyin.
  3. 2-3 dk için 37 °C ' de CO2 inkükodiye hücrelerle Flask koyun.
  4. Hücrelerden on kez pipetleme yaparak hücreleri ayırmak için 1 mL pipet kullanın.
  5. Növite tripsin 9 mL farklılaşma orta ekleyerek (Dulbecco modifiye kartal orta ile 4500 mg/L glikoz ile tamamlayıcı 5% FBS, 100 birimleri/mL penisilin ve 100 birimleri/mL streptomisin) hücrelere RA olmadan.
  6. Hücreleri 15 mL 'Lik bir tüpe aktarın ve 200 x g ve RT 'de 5 dakika santrifüj yapın.
  7. Süpernatant atın ve retinoik asit (ra) olmadan farklılaşma orta 1 ml ekleyin. Hücre Pellet yeniden resuspend.
  8. Hücre sayısını, üreticinin talimatlarına göre bir hücre sayacı kullanarak belirlemek için hücrenin süspansiyonunu kullanın.

4. toplama üretimi

  1. 5 μL RA (99,8% etanol içinde çözünmüş 1 mM stok,-20 °C ' de saklanır), 10 mL Diferannizasyon ortamına ekleyin ve iyi karıştırın (son konsantrasyon 0,5 μM RA).
    Not: RA hafif duyarlıdır. Düşük konsantrasyon EtOH hücre farklılaşma etkilemez19,20,21.
  2. 100 mm 'lik tedavi edilmemiş kültür çanak (süspansiyon kültürüne adanmış) için 10 mL diferansiyel Orta (RA ile) ekleyin.
  3. 100 mm çanak (çanak yüzey alanı 56,5 cm2) 1 x 106 hücreleri tohum.
  4. 37 °C ve 5% CO2 için 2 gün boyunca küvatörün içine hücreleri ile Flask koyun oluşumunu tanıtmak için.
  5. 2 gün sonra, farklılaşma ortamını değiş tokuş yapın. 10 mL pipet kullanarak ve RT 'de 15 mL tüpüne transfer edilen, orta içeren agrega, aspirate.
  6. 1,5 dk 'da RT 'de yerçekimi tarafından yerleşmek için toplamları izin verin.
  7. Süpernatant atın.
  8. 10 mL serolojik pipet kullanarak 0,5 μM RA ile taze 10 mL Diferif orta ekleyin.
    Dikkat: Hücre toplamalarını yukarı ve aşağı pipet etmeyin.
  9. Yeni 100 mm tedavi edilmemiş kültür çanak (süspansiyon kültürü adanmış) içine toplamları tohum.
  10. Plakayı 2 gün boyunca kuluçte (37 °C ve% 5 CO2) olarak yerleştirin.

5. toplamları dissociation

  1. 10 mL pipet kullanarak hücre toplamalarını aspirate.
  2. 15 mL tüp için toplamları aktarın. Hücre toplamları 1,5 dk için yerçekimi ile yerleşmek için izin verin.
  3. Süpernatant çıkarın.
  4. Tek başına DMEM ile toplamaları yıkayın (serum ve antibiyotik içermeyen).
  5. Hücre toplamları RT 1,5 dk için yerçekimi sedimentasyon tarafından yerleşmek için izin verin.
  6. Süpernatant aspirate ve 2 ml Trypsin-EDTA (% 0,25) ekleyin.
  7. Hücre toplamalarını bir su banyosuna (37 °C) 10 dakika boyunca yerleştirin. bir el ile dokunarak her 2 dakikada bir hafifçe toplar.
  8. 4 mL bakım ortamı ekleyerek tripsinleştirme sürecini durdurun.
  9. 1 mL pipet kullanarak 20 kez yukarı ve aşağı pipet toplar.
  10. 200 x g ve RT 'de 5 dak için santrifüj hücreler.
  11. Süpernatant çıkarın ve 5 ml bakım Orta hücre Pelet pelletini.
  12. Bir hücre sayacı ile hücre numarasını belirleyin.

6. kaplama hücreleri

  1. 6-kuyu plaka bakım orta iyi başına 3 mL ekleyin.
  2. Tohum hücreleri 6-iyi kültür plaka 0,5 bir yoğunlukta x 106/well.
  3. % 5 CO2 konsantrasyonu Ile 37 °c ' de inkübe.
  4. 6 iyi kültür plakasında kapak camında hücreleri tohum ve anti-MAP2 antikor (% 20 konfluence) ile immünostatuvar gerçekleştirin. RNA izole etmek ve MAP2, Neun, Oct4, Nanogve GAPDH (% 20 Confluence) için RT-PCR gerçekleştirmek için 6-well plaka kullanın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

P19 hücre hattında nörojenez indüksiyon için protokol Basitleştirilmiş şeması Şekil 1' de sunulmaktadır. P19 hücre satırının karakterini ayırt edilemez bir durumda ve nörogenezi sırasında tanımlamak için, RT-PCR (Ters transkripsiyon-polimeraz zincir reaksiyonu) yöntemi kullanılmıştır. Farklılaşılmış P19 hücre hattı, organik Kyon/karnitin transporter4 (Oct4) ve Nanog Homeobox (Nanog) gibi pluripotency genlerini ifade etmiştir. RA 'nın varlığında süspansiyon kültüründe hücreler toplanması ile indüklenen nörojenez, Oct4 ve Nanog ifadesinin hızlı bir şekilde azalmasına yol açtı. Aksine, nöron işaretçileri ifadesi: Microtubule ilişkili protein 2 (MAP2), Neun (RNA bağlayıcı protein olarak da bilinir, Fox-1 homolog 3 (Rbfox3)) tetiklenen nörogenezi sonra artmış (Şekil 2)6 ,14,15,22. Her bir gen için kullanılan astar, nüklerotit sıralamasını ve Tablo 1 ' de ürünün boyutuna göre belirtilir. Farklılaşılmış P19 hücre hattının mikroskobik görüntüsü, yuvarlak şekilli bir morfoloji (Şekil 3a) sundu. Neurogenesis indüksiyon sonra, hücrelerin nöronal yapısı açıkça görünür 4 gün kaplama sonra (Şekil 3B). Ayrıca, Şekil 4 farklılaşmış P19 hücre satırında MAP2 ifade floresans görüntüsünü temsil eder (4 gün hücreler kaplama sonra)14.

Figure 1
Şekil 1 : P19 embriyonal karsinom hücrelerinde nörogenezi indüksiyon için protokol şeması. Neurogenesis 100 mm tedavi edilmemiş bir kültür çanak P19 hücre hattı FBS ve 0,5 μM RA% 5 ile kültürleme tarafından indüklenir. 4 gün sonra, hücre toplamları tripsin ile Disosiye ve sonraki 4 gün takip için bağlı hücre kültürü plaka üzerinde tohumlu. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 2
Şekil 2 : P19 hücre satırında Gen ifadesinin değişiklikleri. Bant grafiği farklılaşılmış P19 hücre hattı (Oct4, Nanog) ve nörojenez (MAP2, Neun) sırasında gen ifadesini temsil eder. Referans geni olarak gliserol-3-fosfat dehidrojenaz (Gapdh) kullanılmıştır. Örnekler agaroz jel (% 1,5) yüklenir Çift çoğaltmalar. Kısaltmalar: Farklılaşılmamış P19, RA tedavisi olmadan farklılaşılmamış hücre çizgisini temsil eder; Gün 1-4, RA tedavisi ve hücre toplama aşamasından 4 gün sonra, hücre kaplamasından sonraki günleri temsil eder. Bu figürün daha büyük bir versiyonunu görmek Için lütfen tıklayınız.

Figure 3
Şekil 3 : P19 hücre hattının analizinin temsili görüntüleri. (A) farklılaşılmış P19 hücre hattının hafif mikroskobik görüntüleri. (B) P19 hücre hattının hafif mikroskobik görüntüleri 4 gün nörojenezden sonra-ra tedavisi ve hücre toplama aşamasından 4 gün sonra. Ölçek çubuğu = 100 μm. Bu rakam daha büyük bir sürümünü görüntülemek Için lütfen buraya tıklayın .

Figure 4
Şekil 4 : Farklılaşmış P19 hücre hattının temsili immünofluorescence görüntü. P19 hücre hattının birleştirilmiş immünofluorescence görüntü Anti-MAP2 ve DAPı ile lekelenmiş 4 gün sonra kaplama. Ölçek çubuğu = 100 μm. Bu rakam daha büyük bir sürümünü görüntülemek Için lütfen buraya tıklayın .

Astar Primer sıra Ürün
boyutu (BP)
Hüseyin bozkurt F: TGACCTCAACTACATGGTCTACA
R: CTTCCCATTCTCGGCCTTG
85
MAP2 F: GCTGAGATCATCACACAGTC
R: TCCTGCCAAGAGCTCATGCC
211
Oct4 F: GGCGTTCTCTTTGGAAAGGTGTTC
R: CTCGAACCACATCCTTCTCT
313
Neun F: GGCAAATGTTCGGGCAATTCG
R: TCAATTTTCCGTCCCTCTACGAT
160
Nanog F: AAAGGATGAAGTGCAAGCGGTGG
R: CTGGCTTTGCCCTGACTTTAAGC
520

Tablo 1: RT-PCR için kullanılan astar.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Burada, P19 hücre hattını kullanarak nörojenez için basit bir protokol açıklanmaktadır. Bu konuda birçok rapor yayınlanmasına rağmen, P19 hücre hattını kullanarak nörojenez indüksiyon için ayrıntılı bir metodoloji belirsiz kalır. Dahası, biz tüm deney için 10% FBS ile basit bir yüksek glikoz (4.500 mg/L) DMEM orta kullanılmıştır. Bu bize Kullanıcı dostu bir şekilde nörojenik deney yapmak ve gelecek için bu yöntemin kullanımını genişletmek için izin verdi.

Bu protokoldeki en kritik noktalar, RA konsantrasyonunun yanı sıra süspansiyon kültüründe hücre toplamları üretilmesi. P19 hücre hattında nörogenezi stimülasyon agrega oluşumu olmadan gerçekleştirilebilir, ancak üretilen nöronal hücrelerin sayısı hücre kültüründe üçte ikisi tarafından azaltılacak22. Monzo ve ark. P19 hücre satırında nörogenezi indüksiyon göstermiştir Tek tabakalı onları kültür15. Biz süspansiyon kültürü sürecini ortadan kaldırmak gibi onların yöntemi oldukça uygun olmasına rağmen, daha fazla çalışmalar diğer iyi açıklanan yöntemlerle kendi yöntemini karşılaştırmak için gereklidir. Orta 0,5 μM ' lik RA konsantrasyonu, 1 μM RA 'ya kıyasla kaplama sonrası yüksek sayıda hücre toplamasını ve nöronları üretti. Ayrıca, agregaların çoğu RA tedavisi sırasında süspansiyon kültürü çanak altına bağlı olduğunda etkili bir nörojenezi gözlemlemek olamazdı dikkat etmek önemlidir. Prosedürün başında kullanılacak P19 hücre hattının en uygun sayısı, her 10 mL Diferation Medium için 1 x 106 ' dır. Neurogenesis indüksiyon sırasında, P19 hücre hattı varyasyon boyutlarda toplamları ve hatta tek hücreler kültürde bulunur formları. Bu sorunu aşmak için, 15 mL 'Lik bir tüpte 1,5 min. ücretsiz düşüşten sonra hücre toplamalarını topladık. Biz bu yaklaşım tek hücrelerin kontaminasyonu dışlama sağlar bulundu. Ayrıca glial hücrelerin geniş proliferasyonu inhibe uzun süreli kültür için anti-mitotik ilaçlar (örn., sitozin arabinoside) kullanarak hücre kültürü ile nöronal zenginleştirme gerçekleştirmek için tavsiye edilir23.

Her iki N-metil-D-aspartat (NMDA) ve Alfa-amino-3-hidroksi-5-metil-4-isokazol Propionat (AMPA)/kainite (KA) türleri P19 hücre hattı ekspres iyonotropik glutamat reseptörlerden türetilen nöronlar,yanı sıra fonksiyonel γ-aminobutirik asit (GABA) reseptörleri25. Bu nedenle, P19 hücre satırı yaygın nöronal farklılaşma yöneten moleküler mekanizmalar üzerinde çalışmalar kullanılır26,27,28. Daha da önemlisi, hücre nakli sonrasında tümör gelişimi görülmemiştir29,30.

Bu amaçla, Alzheimer hastalığı gibi nörodejeneratif hastalıklar üzerinde araştırma17,18 de P19 hücre hattı kullanılarak gerçekleştirilir, ve biz bu çalışmada geliştirilen yöntem böylece moleküler aydınlatılmasına bir rol oynayacak inanıyoruz nörogelişimsel anomalilerde ve nörodejeneratif hastalıklarda mekanizmalar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların ifşa etmesi gereken hiçbir şey yok.

Acknowledgments

Çalışma mali Ulusal Bilim Merkezi, Polonya tarafından destekleniyordu (Grant No. UMO-2017/25/N/NZ3/01886) ve KNOW (lider Ulusal Araştırma Merkezi) bilimsel konsorsiyum "sağlıklı hayvan-güvenli gıda", bilim ve yüksek Eğitim Bakanlığı kararı No. 05-1/KNOW2/2015

Materials

Name Company Catalog Number Comments
6x DNA Loading Dye EURx E0260-01
Agarose Sigma- Aldrich A9539
cDNA synthesis kit EURx E0801-02
DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride) Sigma- Aldrich 10236276001 Working concentration: 1 μg/mL
DMEM high glucose (4.5 g/L) with L-glutamine Lonza BE12-604Q
Ethanol 99.8% Chempur CHEM*613964202
Fetal Bovine Serum (FBS) EURx E5050-03
MAP2 antibody Thermo Fisher Scientific PA517646 Dilution 1:100
PCR reaction kit EURx E0411-03
Penicillin/Streptomycin 10K/10K Lonza DE17-602E
Phosphate Buffered Saline (PBS), 1x concentrated without Ca2+, Mg2+ Lonza BE17- 517Q
Retinoic acid Sigma- Aldrich R2625-50MG  dissolved in 99.8% ethanol; store in -20 °C up to 6 months
Secondary Antibody (Alexa Fluor 488) Thermo Fisher Scientific A11034 Dilution 1:500
Skim milk Sigma- Aldrich 1153630500
TBE Buffer Thermo Fisher Scientific B52
Triton-X 100 Sigma- Aldrich T8787-100ML
Trypsin 0.25% - EDTA in HBSS, without  Ca2+, Mg2+,with Phenol Red biosera LM-T1720/500
Cell Culture Plastics
1 mL Serological Pipettes Profilab 515.01
10 mL Serological Pipettes Profilab 515.10
100 mm dish dedicated for suspension culture Corning C351029
15 mL centrifuge tubes Sigma- Aldrich CLS430791-500EA
5 mL Serological Pipettes Profilab 515.05
6-well plate Corning CLS3516
Cell culture flasks, surface area 25 cm2 Sigma- Aldrich CLS430639-200EA

DOWNLOAD MATERIALS LIST

References

  1. Ramkumar, N., Anderson, K. V. SnapShot: mouse primitive streak. Cell. 146, (3), 488 (2011).
  2. Solnica-Krezel, L., Sepich, D. S. Gastrulation: making and shaping germ layers. Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).
  3. Tam, P. P. L., Gad, J. M. Chapter 16: Gastrulation in the Mouse Embryo. Gastrulation: From Cells to Embryo. Stern, C. D. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. 233-262 (2004).
  4. Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. Loss of Oct4 expression during the development of murine embryoid bodies. Developmental Biology. 371, (2), 170-179 (2012).
  5. ten Berge, D., et al. Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies. Cell Stem Cell. 3, (5), 508-518 (2008).
  6. Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. From embryonal carcinoma cells to neurons: the P19 pathway. Bioessays. 16, (5), 343-348 (1994).
  7. Lin, Y. T., et al. YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway. Experimental Cell Research. 318, (15), 1877-1888 (2012).
  8. Neo, W. H., et al. MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression. Journal of Biological Chemistry. 289, (30), 20788-20801 (2014).
  9. Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  10. McBurney, M. W., Rogers, B. J. Isolation of male embryonal carcinoma cells and their chromosome replication patterns. Developmental Biology. 89, (2), 503-508 (1982).
  11. Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. Retinoic acid-induced neural differentiation of embryonal carcinoma cells. Molecular and Cellular Biology. 3, (12), 2271-2279 (1983).
  12. Jasmin,, Spray, D. C., Campos de Carvalho, A. C., Mendez-Otero, R. Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells. Stem Cells and Development. 19, (3), 403-412 (2010).
  13. Solari, M., Paquin, J., Ducharme, P., Boily, M. P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity. Toxicological Sciences. 113, (1), 116-126 (2010).
  14. Babuska, V., et al. Characterization of P19 cells during retinoic acid induced differentiation. Prague Medical Report. 111, (4), 289-299 (2010).
  15. Monzo, H. J., et al. A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells. Journal of Neuroscience Methods. 204, (1), 87-103 (2012).
  16. Popova, D., Karlsson, J., Jacobsson, S. O. P. Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity. BMC Pharmacology and Toxicology. 18, (1), 42 (2017).
  17. Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. The toxicity of 6-hydroxydopamine on PC12 and P19 cells. Molecular Brain Research. 69, (1), 84-92 (1999).
  18. Tsukane, M., Yamauchi, T. Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment. Journal of Enzyme Inhibition and Medicinal Chemistry. 24, (2), 365-371 (2009).
  19. Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. The effects of solvents on embryonic stem cell differentiation. Toxicology in Vitro. 20, (3), 265-271 (2006).
  20. Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells. The Journal of Cell Biology. 94, (2), 253-262 (1982).
  21. Roy, B., Taneja, R., Chambon, P. Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand. Molecular and Cellular Biology. 15, (12), 6481-6487 (1995).
  22. Hamada-Kanazawa, M., et al. Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid. FEBS Letters. 560, (1-3), 192-198 (2004).
  23. Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons. Evidence-Based Complementary and Alternative. 838051 (2013).
  24. Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters. Developmental Brain Research. 90, (1-2), 141-150 (1995).
  25. MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro. Neuroscience. 80, (2), 487-499 (1997).
  26. Hong, S., et al. Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells. Biochemical and Biophysical Research Communications. 377, (3), 935-940 (2008).
  27. Wenzel, M., et al. Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells. FEBS Letters. 590, (24), 4453-4460 (2016).
  28. Harada, Y., et al. Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin. Cellular and Molecular Neurobiology. 37, (3), 437-443 (2017).
  29. Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum. Neuroscience. 58, (4), 753-763 (1994).
  30. Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line. Developmental Brain Research. 84, (1), 130-141 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics