CRISPR-मानव कवक रोगज़नक़ Candida albicans की मध्यस्थता जीनोम संपादन

* These authors contributed equally
Genetics
 

Summary

Candida albicans के कुशल जीनोम इंजीनियरिंग रोगजनन और चिकित्सकीय के विकास को समझने के लिए महत्वपूर्ण है । यहां, हम जल्दी और सही CRISPR का उपयोग कर सी albicans जीनोम को संपादित करने के लिए एक प्रोटोकॉल का वर्णन किया । प्रोटोकॉल जांचकर्ताओं बिंदु उत्परिवर्तनों, निवेशन, और विलोपन सहित आनुवंशिक संशोधनों की एक विस्तृत विविधता लागू करने की अनुमति देता है ।

Cite this Article

Copy Citation | Download Citations

Evans, B. A., Pickerill, E. S., Vyas, V. K., Bernstein, D. A. CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans. J. Vis. Exp. (141), e58764, doi:10.3791/58764 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

इस विधि का वर्णन द्विगुणित मानव कवक रोगज़नक़ Candida albicans के कुशल CRISPR मध्यस्थता जीनोम संपादन । CRISPR- सी albicans में मध्यस्थता जीनोम संपादन Cas9, गाइड आरएनए, और मरंमत टेम्पलेट की आवश्यकता है । एक प्लाज्मिड एक खमीर codon अनुकूलित Cas9 (CaCas9) व्यक्त उत्पंन किया गया है । गाइड एक पाम साइट से सीधे ऊपर अनुक्रम (NGG) Cas9 अभिव्यक्ति वेक्टर में क्लोन कर रहे हैं । एक मरंमत टेम्पलेट तो इन विट्रो मेंप्राइमरी एक्सटेंशन द्वारा किया जाता है । मरंमत के Cotransformation टेंपलेट और सदिश सी. albicans में जीनोम संपादन की ओर जाता है । उपयोग किए गए सुधार टेम्पलेट के आधार पर, जांचकर्ता न्यूक्लियोटाइड परिवर्तन, सम्मिलन या हटाए जाने का परिचय दे सकता है. के रूप में C. albicans एक द्विगुणित है, उत्परिवर्तनों एक जीन के दोनों alleles में किए गए हैं, बशर्ते कि ए और बी alleles बंदरगाह SNPs कि गाइड लक्ष्यीकरण या मरंमत टेंपलेट शामिल करने के साथ हस्तक्षेप नहीं है । Multimember जीन परिवारों समानांतर में संपादित किया जा सकता है अगर उपयुक्त संरक्षित अनुक्रम परिवार के सभी सदस्यों में मौजूद हैं । C. albicans CRISPR प्रणाली FRT साइटों और encodes flippase द्वारा पार्श्व है । flippase की प्रेरण पर, एंटीबायोटिक मार्कर (CaCas9) और गाइड आरएनए जीनोम से हटा रहे हैं । यह जांचकर्ता जीनोम करने के लिए अनुवर्ती संपादन करने के लिए अनुमति देता है । c. albicans CRISPR एक शक्तिशाली कवक आनुवंशिक इंजीनियरिंग उपकरण है, और वर्णित प्रोटोकॉल के लिए मामूली परिवर्तन सी. glabrata, एन castellii, और एस cerevisiaeसहित अंय कवक प्रजातियों के संशोधन की अनुमति है ।

Introduction

Candida albicans सबसे प्रचलित मानव कवक रोगज़नक़1,2,3है । सी albicans और स्तनधारी आणविक जीव विज्ञान के बीच मतभेदों को समझना रोधी चिकित्सकीय की अगली पीढ़ी के विकास के लिए महत्वपूर्ण है । यह जांचकर्ताओं की आवश्यकता को जल्दी और सही आनुवंशिक रूप से C. albicansहेरफेर करने में सक्षम हो ।

सी albicans के आनुवंशिक हेरफेर ऐतिहासिक चुनौती दी गई है । C. albicans plasmids बनाए रखने नहीं करता है, इस प्रकार सभी निर्माणों जीनोम में शामिल किया जाना चाहिए । इसके अलावा, सी albicans द्विगुणित है; इसलिए, जब एक जीन दस्तक या एक उत्परिवर्तन शुरू, यह सुनिश्चित करना है कि दोनों प्रतियां4बदल दिया गया है महत्वपूर्ण है । इसके अलावा, कुछ सी. albicans loci heterozygous हैं, आगे आनुवंशिक पूछताछ5उलझी हुई है । आनुवंशिक रूप से C. albicansमें हेरफेर करने के लिए, यह मुताबिक़ पुनर्संयोजन6के कई दौर प्रदर्शन करने के लिए विशिष्ट है । हालांकि, जीनोम और श्रमसाध्य के निर्माण के विकास के द्विगुणित प्रकृति यह एक संभावित थकाऊ प्रक्रिया बना दिया है, खासकर अगर एक से अधिक परिवर्तन की आवश्यकता है । इन सीमाओं और albicans के चिकित्सा महत्व नई प्रौद्योगिकियों के विकास की मांग है कि जांचकर्ताओं को सक्षम करने के लिए और अधिक आसानी से सी. albicans जीनोम हेरफेर ।

संकुल नियमित रूप से अंतराल लघु palindromic दोहराता है (CRISPR)-मध्यस्थता जीनोम संपादन एक शक्तिशाली उपकरण है कि शोधकर्ताओं ने एक जीनोम के अनुक्रम बदलने के लिए अनुमति देता है । CRISPR तीन घटकों की आवश्यकता है: 1) Cas9 nuclease कि लक्ष्य डीएनए, 2) एक 20 आधार गाइड आरएनए कि लक्ष्य Cas9 ब्याज के अनुक्रम के लिए, और 3) मरंमत टेंपलेट डीएनए कि मरंमत दरार साइट और इरादा परिवर्तन7शामिल हैं, 8. एक बार गाइड लक्ष्य जीनोम अनुक्रम को Cas9 लाता है, Cas9 एक protospacer आसंन आकृति (पाम) अनुक्रम (NGG) सीधे गाइड अनुक्रम के ऊपर डीएनए9सट करने की आवश्यकता है । दोनों 20 आधार गाइड और पाम दृश्यों के लिए आवश्यकता लक्ष्यीकरण विशिष्टता और सीमा से लक्ष्य दरार की एक उच्च डिग्री प्रदान करता है ।

CRISPR प्रणालियों के लिए जीवों की एक विविध सेट के जीनोम संपादित करें और10समस्याओं की एक विस्तृत विविधता से निपटने के लिए डिजाइन किया गया है । यहां वर्णित है एक लचीला, संपादन के लिए कुशल CRISPR प्रोटोकॉल एक सी. albicans ब्याज की जीन । प्रयोग एक जीन के लिए एक बंद codon परिचय, अनुवाद समाप्ति के कारण । सुधार टेम्पलेट प्रस्तुत किया गया है के आधार पर अन्य संपादन किए जा सकते हैं । nourseothricin (Natr) युक्त खमीर codon-अनुकूलित Cas9 (CaCas9) और एक गाइड आरएनए के साथ चिह्नित एक टुकड़ा एक तटस्थ स्थल पर सी. albicans जीनोम में शामिल किया गया है । मरंमत टेंपलेट के साथ Cotransformation वांछित उत्परिवर्तन कूटबंधन मुताबिक़ पुनर्संयोजन और कुशल जीनोम संपादन द्वारा दरार की मरंमत की ओर जाता है । नीचे वर्णित TPK2का संपादन है, लेकिन सभी C. albicans ओपन रीडिंग फ्रेम CRISPR द्वारा कई बार लक्षित किया जा सकता है । CRISPR प्रणाली FRT साइटों द्वारा पार्श्व है और CaCas9 अभिव्यक्ति प्लाज्मिड पर इनकोडिंग flippase की प्रेरण द्वारा सी. albicans जीनोम से हटाया जा सकता है । c. albicans CRISPR सिस्टम जांचकर्ताओं को सटीकता से सक्षम बनाता है और c. albicans जीनोम11,12को तुरंत संपादित करता है ।

Protocol

1. गाइड आरएनए अनुक्रम की पहचान और क्लोनिंग

  1. गाइड आरएनए अनुक्रम की पहचान
    1. एक 5 '-NGG-3 ' पाम अनुक्रम को बंद करें जहां बंद codon डाला जाएगा के लिए पहचानें । (चित्र 1a) लेबल सभी पाम TPK2 के पहले १०० आधार जोड़े में पाया दृश्यों (आंकड़ा 1a) हैं ।
      नोट: प्रत्येक C. albicans खुले पठन फ़्रेम को टार्गेट करने वाले मार्गदर्शिका अनुक्रम को http://osf.io/ARDTX 11,12पर पाया जा सकता है ।
    2. आगे गाइड Primer_3 अनुक्रम की पहचान करें, जो 20 कुर्सियां सीधे एक NGG पाम साइट के ऊपर होगा और एक पंक्ति में 5 से अधिक टीएस शामिल नहीं होगा । आधार पर बाएं क्लिक करें सीधे NGG के ऊपर और कर्सर 20 कुर्सियां खींचें, तो प्राइमर टैब पर बाएं क्लिक करें प्राइमर जोड़ने के लिए ।
    3. रिवर्स गाइड Primer_3 अनुक्रम, जो आगे गाइड अनुक्रम के लिए पूरक हो जाएगा की पहचान करें ।
      नोट: दिखाया गया है गाइड है कि उपयोग PAM_3 (आंकड़ा 1b) ।
    4. प्राइमर पर राइट-क्लिक करें और "प्राइमरी डाटा कॉपी" का चयन करें । किसी पाठ संपादन प्रोग्राम में अनुक्रम चिपकाएं ।
  2. आगे और रिवर्स गाइड ओलिगोस्पर्मिया को क्लोनिंग (तालिका 1, चित्र 1b) की सुविधा के लिए बदस्तूर अनुक्रम जोड़ें ।
    1. खरीदने से पहले आगे गाइड Primer_3 के 5 ' अंत करने के लिए न्यूक्लियोटाइड अनुक्रम ATTTG जोड़ें ।
    2. खरीदने से पहले आगे गाइड Primer_3 के 3 ' अंत करने के लिए जी जोड़ें ।
    3. खरीदने से पहले रिवर्स गाइड Primer_3 के 5 ' अंत करने के लिए न्यूक्लियोटाइड अनुक्रम AAAAC जोड़ें ।
    4. खरीदने से पहले रिवर्स गाइड Primer_3 के 3 ' अंत करने के लिए सी जोड़ें ।
  3. डाइजेस्ट CaCas9 अभिव्यक्ति वेक्टर pV1524 with BsmBI.
    नोट: pV1524 में एक एम्पीसिलीन (Ampr) और nourseothricin (Natr) मार्कर होते हैं । Cas9 सी. albicansके लिए codon-ऑप्टिमाइज़ किया गया है.
    1. जोड़कर प्लाज्मिड को पचा: pv1524 के 2 μg, 10x बफर के 5 μL, μL के 1 BsmBI, और एच2ओ के लिए ५० μL एक १.५ मिलीलीटर ट्यूब में । 20 मिनट के लिए ५५ ° c पर मशीन (वैकल्पिक रूप से, Esp3I के साथ 15 मिनट के लिए pv1524 डाइजेस्ट, ३७ डिग्री सेल्सियस पर BsmBI की एक isoschizomer,.)
    2. कमरे के तापमान (आरटी) के लिए शांत है और 30 एस के लिए स्पिन २,३४८ x जी में ट्यूब के नीचे करने के लिए संघनित्र लाने के लिए । कदम १.४ या स्टोर पच प्लाज्मिड पर-20 डिग्री सेल्सियस के लिए आगे बढ़ें ।
  4. फॉस्फेट-पचा रीढ़ की दावत ।
    1. 1 एच के लिए 1 μL बछड़ा आंत्र फॉस्फेट (CIP) पाचन मिश्रण और ३७ डिग्री सेल्सियस पर मशीन के लिए जोड़ें ।
    2. व्यावसायिक रूप से उपलब्ध पोलीमरेज़ चेन रिएक्शन (पीसीआर) शुद्धिकरण किट (किट के साथ दिए गए निर्देशों) का उपयोग करके पच प्लाज्मिड को शुद्ध करें और इसे 30 μL ऑफ रेफरेंस बफर (EB) में elute ।
  5. Phosphorylate आणि ऐनी फॉरवर्ड गाईड Primer_3 आणि रिवर्स गाईड Primer_3.
    1. १०० माइक्रोन फॉरवर्ड गाइड Primer_3 के ०.५ μL जोड़ें, ०.५ μL की १०० माइक्रोन रिवर्स गाइड Primer_3, 10x टी-4 μL बफर के 5 ligase, टी-4 μL polynucleotide के 1 कळेनासे, और एच2ओ के ४३ μL एक पीसीआर ट्यूब करने के लिए ।
    2. 10x टी-4 ligase बफर के 5 μL जोड़ें, टी-4 polynucleotide कळेनासे के 1 μL, और आण्विक जीवविज्ञान के ४४ μL ग्रेड एच2ओ एक दूसरी पीसीआर ट्यूब में ।
      नोट: यह नकारात्मक नियंत्रण के रूप में काम करेगा ।
    3. 30 मिनट के लिए ३७ डिग्री सेल्सियस पर एक thermocycler में प्रतिक्रिया मिश्रण, तो 5 मिनट के लिए ९५ डिग्री सेल्सियस पर मशीन ।
    4. धीमी रैंप दर पर मिश्रण ठंडा करने के लिए 16 ° c करने के लिए ऐनी, ओलिगोस्पर्मिया. फिर annealed oligo मिश्रण को 4 डिग्री सेल्सियस पर रखें ।
  6. Ligate ने annealed ओलिगोस्पर्मिया को पच pv1524 से कदम 1.4.3.
    1. एक पीसीआर ट्यूब के लिए निंनलिखित जोड़ें: 1 μL 10x टी-4 ligase बफर, टी-4 डीएनए ligase के ०.५ μL, μL annealed मिश्रण के ०.५ oligo, पचता CIP-इलाज शुद्ध प्लाज्मिड (20 – 40 एनजी), और एच2ओ एक 10 μL कुल मात्रा ।
    2. एक पीसीआर ट्यूब करने के लिए निम्नलिखित जोड़ें: 1 μL 10x टी-4 ligase बफर, टी-4 डीएनए ligase के ०.५ μL, पच-इलाज वेक्टर शुद्ध सदिश (20-40 एनजी), नकारात्मक नियंत्रण मिश्रण के 1 μL, और एक 10 μL कुल मात्रा के लिए एच2ओ ।
    3. 30 मिनट के लिए 16 डिग्री सेल्सियस पर एक thermocycler में दोनों ट्यूबों, तो 10 मिनट के लिए ६५ डिग्री सेल्सियस पर गर्मी, तो 25 डिग्री सेल्सियस के लिए शांत ।
  7. एक मानक गर्मी सदमे परिवर्तन प्रोटोकॉल का उपयोग कर रासायनिक सक्षम कोलाई DH5α में बंधाव मिश्रण के 5 μL रूपांतरण । LB amp/Nat मीडिया (२०० μg/एमएल amp, ५० μg/एमएल Nat) पर चयन करें ।
    नोट: pV1524 का चयन करने में विफलता और इसके डेरिवेटिव डबल चयन मीडिया पर Nat/CaCas9/गाइड मॉड्यूल के नुकसान में FLP/FRT के द्वारा बैक्टीरिया में उत्पाद परिणाम होगा ।
  8. miniprep द्वारा चार transformants से plasmids शुद्ध, और sequencing प्राइमर (तालिका 1) के साथ सम्मिलन अनुक्रम अनुक्रम.
    ध्यान दें: अधिकांश समय, sequencing 4 transformants को पहचानने के लिए पर्याप्त है 1 सही क्लोन ।
  9. गाइड आरएनए अनुक्रम है कि plasmids सहेजें-20 डिग्री सेल्सियस पर BsmBI कटौती साइट में एक ही समय क्लोन ।

2. डिजाइनिंग और मरंमत की पीढ़ी टेंपलेट

  1. डालें एक बंद codon जीन अनुक्रम में बाएं क्लिक करके और न्यूक्लियोटाइड जोड़ने कि एक रोकें codon और प्रतिबंध पाचन साइट (चित्रा 1C, टेबल 1) सांकेतिक शब्दों में बदलना ।
    नोट: सम्मिलन पाम अनुक्रम को बाधित करेगा ।
    नोट: एक प्रतिबंध पाचन साइट मरंमत टेंपलेट अनुक्रम में शामिल किया जाएगा क्लोन (चित्रा 1C) के कुशल स्क्रीनिंग की सुविधा ।
  2. वाम क्लिक 10 जहां उत्परिवर्तन बनाया जाएगा और कर्सर ६० कुर्सियां ऊपर खींच के नीचे कुर्सियां । प्राइमरी टैब पर लेफ्ट-क्लिक करें । यह सुधार टेम्पलेट Forward_3 जोड़ देगा । वाम क्लिक करें, जहां उत्परिवर्तन बनाया जाएगा और कर्सर ६० कुर्सियां बहाव खींचें के ऊपर 10 कुर्सियां । प्राइमरी टैब पर लेफ्ट-क्लिक करें । यह सुधार टेंपलेट रिवर्स 3 जोड़ देगा । (चित्रा 1C)
  3. सुधार टेम्पलेट जनरेट करने के लिए प्राइमरी एक्सटेंशन निष्पादित करें ।
    1. जोड़ें १.२ μL के १०० माइक्रोन मरंमत खाका आगे प्राइमर, १.२ μL की १०० माइक्रोन मरंमत टेम्पलेट रिवर्स प्राइमर, deoxynucleotide triphosphates के 6 μL (dNTPs) (कुल एकाग्रता ४० मिमी), बफर के 6 μL, μL Taq के ०.६ पोलीमरेज़ (3 यूनिट), और एच2ओ के ४५ μL 4 पीसीआर में से प्रत्येक के लिए ट्यूब.
    2. पीसीआर के 20 और 30 राउंड के बीच चल कर प्राइमरी एक्सटेंशन परफॉर्म करें । उदाहरण विस्तार की शर्तें: 2 मिनट में ९५ ° c, (30 s at ९५ ° c, 1 min at ५० ° c, 1 min at ६८ ° c) x ३४, 10 min at ६८ ° c.
    3. एक १.५ मिलीलीटर ट्यूब में सभी 4 पीसीआर ट्यूबों की सामग्री का मिश्रण है और एच2ओ के ५० μL में उत्पादों को शुद्ध करने के लिए एक पीसीआर शोधन किट का उपयोग करें ।
    4. Quantitate ने प्राइमरी एक्सटेंशन प्रॉडक्ट्स को २६० एनएम पर सोखने का निर्धारण करके पर्याप्त डीएनए सुनिश्चित करने के लिए ।
      नोट: प्राइमरी एक्सटेंशन उत्पाद के विशिष्ट अंतिम एकाग्रता ~ 200-300 एनजी/µ एल

3. मरंमत टेम्पलेट और प्लाज्मिड के साथ सी. albicans का रूपांतरण

  1. कर ते/लिथियम एसीटेट ।
    1. मिश्रण 10 मिमी Tris-सीएल, 1 मिमी EDTA, १०० mm लिथियम एसीटेट, और एच2ओ (सभी शेयर समाधान पीएच ७.५) ५० मिलीलीटर कुल मात्रा को प्राप्त करने के लिए ।
  2. थाली बनाओ
    1. मिक्स ४०% खूंटी ३३५०, १०० mm लिथियम एसीटेट, 10 मिमी Tris-सीएल, 1 मिमी EDTA, और एच2ओ (सभी शेयर समाधान पीएच ७.५) ५० मिलीलीटर कुल मात्रा को प्राप्त करने के लिए ।
  3. डाइजेस्ट सही ढंग से-१.९ कदम से क्लोन plasmids ।
    1. प्लाज्मिड के 10 μg जोड़ें, 10x बफर के 4 µ एल, ०.४ µ एल के 10 मिलीग्राम/एमएल गोजातीय सीरम एल्ब्युमिन (BSA), ०.५ µ एल के KpnI, ०.५ µ एल के SacI, और एच20 से ४० µ एल कुल मात्रा एक १.५ मिलीलीटर ट्यूब में । ३७ ° c रातोंरात (चित्रा 1 डी) में मशीन ।
  4. c. albicans SC5314, वंय-प्रकार prototroph की एक रात संस्कृति बढ़ती है, खमीर peptone डेक्सट्रोज में 25 डिग्री सेल्सियस में ०.२७ mM Uridine (YPD + उड़ी) के साथ पूरक, आदर्श आयुध डिपो६०० से कम 6 ।
    1. 5 मिनट के लिए कताई द्वारा २,३४८ एक्स जी में स्पिनिंग के प्रति कोशिकाओं के६०० आयुध डिपो और 5 आयुध डिपो६०० निलंबित १०० µ l TE/लिथियम एसीटेट ।
  5. सूचीबद्ध क्रम में एक १.५ मिलीलीटर ट्यूब करने के लिए निम्न जोड़ें: 1) १०० µ एल से कोशिकाओं के चरण 3.4.1, 2) ४० µ एल के उबला हुआ और जल्दी ठंडा सामन शुक्राणु डीएनए (10 मिलीग्राम/एमएल), 3) 10 µ जी के प्लाज्मिड पाचन से कदम 3.3.1, 4) 6 µ जी की शुद्धि की मरंमत टेंपलेट , और 5) प्लेट की 1 मिलीलीटर ।
  6. सूचीबद्ध क्रम में एक १.५ मिलीलीटर ट्यूब करने के लिए निम्न जोड़ें: 1) कोशिकाओं के १०० µ एल, 2) ४० µ एल उबला हुआ और जल्दी से ठंडा सामन शुक्राणु डीएनए (10 मिलीग्राम/एमएल), 3) एच2ओ मात्रा के बराबर है कि डीएनए में बदलने के लिए ३.५ चरण, और 4) 1 मिलीलीटर की थाली ।
    नोट: यह एक नकारात्मक नियंत्रण के रूप में काम करेगा ।
  7. pipetting द्वारा धीरे रूपांतरों मिश्रण है और 25 डिग्री सेल्सियस रात भर में मशीन चलो ।
  8. गर्मी उंहें 25 मिनट के लिए एक ४४ डिग्री सेल्सियस पानी के स्नान में रखकर कोशिकाओं सदमे ।
  9. एक benchtop केंद्रापसारक में २,३४८ x जी में 5 मिनट के लिए स्पिन और प्लेट मिश्रण supernatant निकालें । YPD के 1 मिलीलीटर + उड़ी जोड़कर एक बार धो और 5 मिनट के लिए फिर से २,३४८ x gपर केंद्रापसारक
  10. YPD के ०.१ मिलीलीटर में कोशिकाओं को निलंबित + उड़ी और 25 डिग्री सेल्सियस रात भर में एक रोलर ड्रम या शेखर पर मशीन ।
  11. प्लेट पर YPD + उड़ी के साथ २०० μg/एमएल nourseothricin । 2-5 दिनों में कालोनियां दिखाई देंगी ।

4. एकल कालोनियों के लिए धारियां

  1. एक १०० मिमी x 15 मिमी पेट्री पकवान तिमाहियों में विभाजित है, और प्रत्येक वृत्त का चक्र लेबल ।
    1. एक बाँझ दंर्तखोदनी या applicator के साथ परिवर्तन की थाली से कालोनियों के एक स्पर्श और चक्र के सबसे लंबे समय तक की ओर लकीर ।
    2. एकल कालोनियों के लिए लकीर एक अपूतित तकनीक का उपयोग कर और कालोनियों के लिए 30 डिग्री सेल्सियस पर 2 दिनों के लिए विकसित करने की अनुमति ।

5. कॉलोनी पीसीआर

  1. डिजाइन आगे की जांच प्राइमर (FCP) ~ २०० आधार जोड़े प्रतिबंध साइट है कि शुरू की गई थी और उल्टा जांच प्राइमर (आरसीपी) ~ ३०० आधार जोड़े बहाव के ऊपर ।
    1. इसमें ०.३ μL की FCP, ०.३ μL की आरसीपी, ०.३ μL की thermostable पोलीमरेज़ (ExTaq १.५ यूनिट्स), 3 μL की dNTPs (कुल एकाग्रता ४० मि. मी.), 3 μL की ExTaq बफर, और 23 μL की एच2ओ को एक १.५ मिलीलीटर ट्यूब से जोड़ें ।
      नोट: ०.५ μL/रिएक्शन के अलावा dimethyl sulfoxide (DMSO) पीसीआर दक्षता में सुधार कर सकते हैं ।
    2. कदम 4.1.2 से एक एकल खमीर कॉलोनी के ०.२५ μL जोड़ें कदम 5.1.1 से मिश्रण करने के लिए, एक P10 पिपेट टिप और देखभाल लेने के लिए नहीं आगर परेशान का उपयोग कर ।
    3. पीसीआर द्वारा डीएनए बढ़ाना और एक जेल पर पीसीआर के 5 μL चलाने के लिए सुनिश्चित करने के लिए प्रवर्धन सफल होता है, देखभाल के लिए ट्यूब के तल पर सेल गोली परेशान नहीं ले रही ।

6. कॉलोनी पीसीआर के प्रतिबंध पाचन

  1. पीसीआर उत्पाद के 10 μL जोड़ें (देखभाल नहीं करने के लिए ट्यूब के नीचे सेल गोली परेशान नहीं), बफर के 3 μL, 1 प्रतिबंध एंजाइम के μL, और एच2ओ के 16 μL, तो निर्माता के निर्देशों के अनुसार और एक agarose जेल पर हल करने के लिए corre की पहचान सीटी जीनोम संपादन ।
    नोट: यहां उपयोग किया गया प्रतिबंध एंजाइम TPK2 विशिष्ट सुधार टेम्पलेट में एंकोडेड साइट है ।

7. बचत उपभेदों

  1. 30 डिग्री सेल्सियस पर YPD + Uri में प्रतिबंध पाचन द्वारा पुष्टि की गई है कि कालोनियों से एक रात संस्कृति बढ़ने ।
  2. संस्कृति के 1 मिलीलीटर और ५०% ग्लिसरॉल के 1 मिलीलीटर जोड़ें (ग्लिसरॉल के अंतिम एकाग्रता लाने के लिए 25%)-८० डिग्री सेल्सियस पर भंडारण के लिए उपयुक्त एक ट्यूब के लिए ।
  3. -८० ° c पर सही क्लोनों की दुकान ।
    नोट: सही उपभेदों में संग्रहित किया जा सकता है-८० ° c कई वर्षों के लिए ।

8. Natr मार्कर का निष्कासन

  1. लकीर सही ट्रांस्फ़ॉर्मर पर खमीर peptone माल्टोज़ (YPMaltose) (2% माल्टोज़) ।
  2. लकीर की थाली और संस्कृति से एक कॉलोनी उठाओ ४८ ज के लिए खमीर 30 डिग्री सेल्सियस में तरल YPMaltose 20 ग्राम/L माल्टोज़ में ।
  3. प्लेट 200 – 400 कोशिकाओं पर YPMaltose 20 g/L माल्टोज़ और गर्मी में 30 डिग्री सेल्सियस के लिए 24 ज.
  4. YPMaltose और YPMaltose २०० μg/एमएल नेट पर प्लेट दोहराने ।
  5. 24 घंटे के लिए 30 डिग्री सेल्सियस पर मशीन
    नोट: कालोनियों कि अब YPMaltose २०० μg/एमएल nourseothricin पर बढ़ती है लेकिन YPMaltose पर बढ़ने Natr मार्कर (CaCAS9) और गाइड आरएनए खो दिया है ।
  6. उपभेदों Natr मार्कर (CaCAS9) खो दिया है और गाइड आरएनए के रूप में कदम 7.1 – 7.3 में किया गया सहेजें ।
    नोट: एक समान प्लाज्मिड, pV1393, SAP2 का उपयोग करता है के रूप में एक MAL2 मोटर के लिए विरोध किया । YCB पर विकास-BSA flippase प्रेरित और Natआर को हटाने अगर pV1393 जीन संपादन के लिए प्रयोग किया जाता है होगा ।

Representative Results

गाइड के अनुक्रम RNAs और मरंमत टेंपलेट्स कि लक्ष्य c. albicans TPK2, एक सी-AMP कळेनासे उत्प्रेरक उपइकाई, ऊपर सुझाव दिया दिशा निर्देशों के अनुसार डिजाइन किए गए थे । अनुक्रम (तालिका 1, चित्र 1) में दिखाए जाते हैं । गाइड RNAs CaCas9 अभिव्यक्ति वैक्टर और cotransformed में वाइल्ड-टाइप सी albicansटेम्पलेट की मरंमत के साथ क्लोन किया गया । एक पारिस्थितिकीआरआई प्रतिबंध पाचन साइट और मरंमत टेंपलेट में codons बंद करो पाम साइट को बाधित और सही म्यूटेंट (चित्रा 1) के लिए स्क्रीनिंग की सुविधा । Transformants एकल कालोनियों के लिए धारिया थे और मरंमत टेंपलेट (चित्रा 2)के निगमन के लिए कॉलोनी पीसीआर और प्रतिबंध पाचन द्वारा दिखलाई । प्रतिबंध पाचन जल्दी से उत्परिवर्ती दृश्यों से जंगली प्रकार भेद ।

Oligonucleotide नाम Oligonucleotide अनुक्रम
आगे गाइड Primer_3 ATTTGgggtgaactatttgttcgcc
रिवर्स गाइड Primer_3 AAAACggcgaacaaatagttcaccc
टेंपलेट Forward_3 सुधारें tcagcaatatcagcaacaatttcaacaaccgcagcaacaactttatTAAGAATTCggcga
टेंपलेट Reverse_3 सुधारें attttgtccagtttgggctgcagcagggtgaactatttgttcgccGAATTCTTAataaag
आगे की जांच प्राइमर ttaaagaaacttcacatcaccaag
उल्टा जांच प्राइमर actttgatagcataatatctaccat
sequencing प्राइमर ggcatagctgaaacttcggccc

तालिका 1: इस अध्ययन के लिए प्रयुक्त oligo न्यूक्लियोटाइड की सूची । साइटों क्लोनिंग प्रयोजनों के लिए जोड़ा और कैपिटल गाइड प्राइमर दृश्यों में बोल्ड कर रहे हैं । जीनोमिक डीएनए में रूपांतरित होने वाले मरंमत टेम्पलेट में अनुक्रम को कैपिटल और बोल्ड कर रहे हैं ।

Figure 1
चित्रा 1 : गाइड आरएनए के आरेख और मरंमत टेम्पलेट डिजाइन । () TPK2के पहले १०० न्यूक्लियोटाइड में सभी पाम अनुक्रम का लेबल । पाम अनुक्रम 3 (PAM_3), के रूप में है कि इस अध्ययन में इस्तेमाल अनुक्रम है पर प्रकाश डाला है । () गाइड आरएनए डिजाइन का उपयोग PAM_3. 20 आधार प्राइमरों SnapGene का उपयोग डिजाइन लोअरकेस और नीले हैं । क्लोनिंग के लिए आवश्यक अतिरिक्त कुर्सियां अपरकेस और हरी ऑफसेट दिखाया गया है । () मरंमत टेंपलेट प्राइमरों कि एक ताा रोक codon और पारिस्थितिकीआरआई साइट डालने TPK2 पढ़ने के फ्रेम में डाला जाता है । जंगली प्रकार के अनुक्रम से अलग डीएनए लाल और अपरकेस है । () कैसे एक गाइड PAM_4 का उपयोग डीएनए के सकारात्मक किनारा पर बनाया गया है का उदाहरण है । () गाइड आरएनए और KpnI और SacI के साथ पाचन की क्लोनिंग के बाद pV1524 की योजनाबद्ध आरेख. Neut5L-5 ' और Neut5L-3 ' को टारगेट कर वेक्टर को C. albicans जीनोम में Neut5L साइट पर रखना है । CaENO1p मोटर है कि खमीर के CaCas9अनुकूलित की अभिव्यक्ति ड्राइव है । Natr nourseothricin प्रतिरोध कैसेट है । CaSNR52p की मोटर ड्राइविंग गाइड आरएनए एक्सप्रेशन (sgRNA) है । FRT साइटों और सट रहे है flippase द्वारा संयुक्त (FLP) flippase अभिव्यक्ति पर CRISPR कैसेट को हटाने । (ई) के समान एक योजनाबद्ध व्यास एट अलद्वारा प्रकाशित किया गया था । 11. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

Figure 2
चित्रा 2 : परिचय और TPK2के लिए एक बंद codon और पारिस्थितिकीआरआई प्रतिबंध साइट की पुष्टि । प्रवर्धन के लिए इस्तेमाल किया प्राइमरों तालिका 1में सूचीबद्ध हैं । जंगली प्रकार और उत्परिवर्ती अनुक्रम जेल के नीचे दिखाए जाते हैं । यह आंकड़ा व्यास एट अल.11से संशोधित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 : कार्टून का विवरण मरंमत टेंपलेट्स कि (एक) विलोपन और (ख) सम्मिलन उत्पंन होगा । में धूसर डैश (A) सुधार टेम्पलेट प्राइमरों में मौजूद नहीं हस्तक्षेप अनुक्रम चित्रण. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Discussion

c. albicans CRISPR कुशलता से c. albicans जीनोम को संपादित करता है । pV1524 encodes एक खमीर codon-अनुकूलित Cas9 और इस तरह बनाया गया है कि जांचकर्ताओं आसानी से क्लोन गाइड आरएनए CaSNR52 प्रमोटर (चित्रा 1)11के अनुप्रवाह अनुक्रम कर सकते हैं । यह सुनिश्चित किया जाना चाहिए कि केवल गाइड अनुक्रम की एक प्रतिलिपि अनुक्रमण द्वारा CaCas9 अभिव्यक्ति वैक्टर में क्लोन किया गया है, के रूप में अतिरिक्त प्रतियां जीनोम संपादन में बाधा होगी । यदि गाइड की एकाधिक प्रतियां लगातार पेश कर रहे हैं, एक annealed बंधाव में इस्तेमाल किया गाइड की एकाग्रता कम करना चाहिए । वेक्टर और प्रोटोकॉल वर्णित किसी भी सी albicans जीन के लक्ष्यीकरण की अनुमति । यद्यपि C. albicans द्विगुणित है, केवल एक ही परिवर्तन एक जीन के दोनों alleles को लक्षित करने के लिए आवश्यक है । इसके अलावा, CRISPR-CaCas9 जीनोम संपादन के जुलूस प्रकृति शोधकर्ताओं जीन परिवारों के कई सदस्यों को लक्षित करने के लिए सक्षम बनाता है । सी. albicans डाह के लिए कई जीन परिवारों जैसे स्रावित aspartyl का टीज़र (SAPS) और agglutinin जैसे सीक्वेंस प्रोटीन (ALS) महत्वपूर्ण होते हैं. CRISPR जीनोम संपादन इन जीन परिवारों की जांच की सुविधा होगी ।

ऊपर वर्णित प्रोटोकॉल एक खुली पठन फ़्रेम के लिए एक रोकें codon शुरू, जिसके परिणामस्वरूप phenotypic एक नल (चित्रा 2) के बराबर है । आनुवंशिक प्रत्यावर्तन की एक विस्तृत विविधता की मरंमत टेंपलेट अलग से बनाया जा सकता है । बकवास, बकवास, और मूक उत्परिवर्तनों एक उपयुक्त मरंमत टेम्पलेट के साथ पुनर्संयोजन के माध्यम से डाला जा सकता है । एक प्रतिबंध साइट के शामिल किए जाने के रूपांतरण जांच को कारगर बनाने, के बिना उन के रूप में12,13अनुक्रमण द्वारा जांच की जानी चाहिए । इसके अलावा, C. albicans CRISPR के शोधकर्ताओं के सम्मिलन और विलोपन उत्पन्न करने के लिए सक्षम बनाता है, यह एक आदर्श प्रणाली संबध टैग डालने के लिए बना रही है, मोटर स्वैप प्रदर्शन, और नॉकआउट उत्पन्न (चित्रा 3). इन उत्परिवर्तनों के लिए सही transformants के लिए स्क्रीनिंग अधिक श्रमसाध्य है, के रूप में यह संपादन अनुक्रम के लिए आवश्यक है मरंमत की सही शामिल करने की पुष्टि टेंपलेट्स । इसके अलावा, दक्षिणी दाग के लिए एक जीन की अतिरिक्त प्रतियां सुनिश्चित करने के लिए आवश्यक हो सकता है जीनोम में अतिरिक्त स्थानों पर नहीं डाला गया है । NGG पाम साइट की आवश्यकता जीनोम है कि लक्षित किया जा सकता है के क्षेत्रों पर मामूली सीमाओं स्थानों । वैकल्पिक CRISPR प्रणालियों का विकास जो वैकल्पिक nucleases जैसे Cpf1 या Cas9 सिस्टम पर रूपांतरों का उपयोग करता है/इनमें से कई सीमाएं14को कम कर देगी । इस समय जांचकर्ताओं के ज्ञान के लिए, ये सिस्टम अभी तक C. albicansकरने के लिए लागू नहीं किया गया है ।

CRISPR प्रणाली के ऊपर प्रोटोकॉल में वर्णित है कि यह Saccharomyces cerevisiae, Naumouozyma castellii, और मानव रोगज़नक़ Candida glabrata11 सहित प्रजातियों की एक विस्तृत विविधता में लागू किया जा सकता है विकसित किया गया है . परिवर्तन और इन खमीर के कुशल संपादन वर्णित प्रोटोकॉल में मामूली परिवर्तन की आवश्यकता है, लेकिन इन वैकल्पिक जीनोम के संपादन के लिए रूपरेखा उल्लेखनीय है कि सी albicans12के लिए वर्णित के समान है । इसके अलावा, खमीर जीनोम संपादन प्रक्रियाओं को विकसित करने के लिए एक उत्कृष्ट तंत्र प्रदान करते हैं । खमीर में, जब ADE2 , adenine के लिए एक अग्रदूत साबित होता है संश्लेषण मार्ग जमा, कोशिकाओं को लाल मोड़ । यह आसानी से देख phenotype जांचकर्ताओं संपादित कोशिकाओं की पहचान करने के लिए और जल्दी से जीनोम संपादन प्रोटोकॉल का समस्या निवारण की अनुमति देता है । व्यापक आण्विक जीवविज्ञान कवक के लिए उपलब्ध उपकरण बॉक्स के साथ संयुक्त, संपादन के लिए प्रोटोकॉल कई खमीर प्रजातियों15,16विकसित किया गया है । कवक में जीनोम संपादन प्रौद्योगिकी के इस तरह के एक व्यापक आवेदन काफी वैज्ञानिक विषयों की एक विस्तृत विविधता को प्रभावित करने की क्षमता है ।

CRISPR बहुत सी albicansमें जीनोम इंजीनियरिंग की दक्षता में सुधार हुआ है, लेकिन तारीख CRISPR सी. albicansमें जीनोम वाइड स्क्रीन प्रदर्शन करने के लिए इस्तेमाल नहीं किया गया है । वर्तमान प्रोटोकॉल एक मरंमत के लिए उत्परिवर्तनों परिचय टेंपलेट की आवश्यकता है, nonhomologous के रूप में सी albicans में मार्ग में शामिल होने के अंत12अक्षम है । हर जीन के लिए मरंमत खाका ओलिगोस्पर्मिया की पीढ़ी जीनोम चौड़ा स्क्रीन के निष्पादन के लिए एक महत्वपूर्ण बाधा है । डीएनए संश्लेषण और CRISPR प्रौद्योगिकियों को अग्रिम की कमी लागत का संगम विलोपन पुस्तकालयों के विकास को और अधिक संभव बना देगा । उदाहरण के लिए, CaCas9 वेक्टर से एक मरंमत टेंपलेट की अभिव्यक्ति स्थाई प्लाज्मिड पुस्तकालयों के विकास के लिए रास्ता प्रशस्त है कि हर11जीन लक्ष्य । इसके अलावा, क्षणिक Candida CRISPR प्रोटोकॉल है कि CaCas9 अभिव्यक्ति वेक्टर सी. albicans जीनोम में शामिल की आवश्यकता नहीं है17विकसित किया गया है । इसके अलावा, बढ़ा गाइड अभिव्यक्ति वृद्धि जीनोम संपादन क्षमता18। ये, और अंय CRISPR प्रौद्योगिकियों के लिए अग्रिम, सी albicansमें जीनोम चौड़ा स्क्रीन के विकास के लिए महत्वपूर्ण है19,20,21,22

C. albicans जीनोम द्विगुणित होता है, लेकिन A और B alleles हमेशा समरूप5नहीं होते हैं । ऐसी heterozygosity चुनौतियों और अवसरों दोनों प्रदान करता है । यदि एक लक्ष्य दोनों alleles, एक पाम साइट, गाइड अनुक्रम, और मरंमत टेंपलेट है कि जीन की दोनों प्रतियां पर कार्य करेगा इस्तेमाल किया जाना चाहिए । तथापि, एक जीन में मौजूद एकल न्यूक्लियोटाइड बहुरूपताओं के आधार पर, C. albicans CRISPR प्रणाली जांचकर्ताओं को एक एकल एलील को लक्षित करने में सक्षम बनाती है । ऐसी परिशुद्धता के लिए जांचकर्ताओं alleles के बीच कार्यात्मक मतभेदों की जांच करने की अनुमति की क्षमता है । विशिष्ट alleles लक्ष्यीकरण सावधानी से किया जाना चाहिए, के रूप में एक एलील या एक पूरे गुणसूत्र में heterozygosity (LOH) के नुकसान मनाया गया है । जब संपादन एकल सी albicans alleles, एक आसंन डीएनए अनुक्रम की जांच करने के लिए निर्धारित अगर एक क्लोन एक द्विगुणित SNP प्रोफ़ाइल बनाए रखा है चाहिए । इसके अलावा, बंद लक्ष्य प्रभाव सी albicans CRISPR के लिए काफी कम हैं, लेकिन पूरे जीनोम अनुक्रमण कुंजी उपभेदों के लिए विचार किया जा सकता है ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

लेखकों ने पांडुलिपि पर पढ़ने और उपयोगी टिप्पणियों के लिए डॉ॰ Gennifer मागेर का धन्यवाद किया । यह काम गेंद राज्य विश्वविद्यालय प्रयोगशाला स्टार्टअप कोष और NIH-1R15AI130950-01 से D.A.B. को समर्थन किया गया

Materials

Name Company Catalog Number Comments
Chemicals
Agar BD Bacto 214010
agarose amresco 0710-500G
Ampicillan Sigma-Aldrich A9518
Bacto Peptone BD Bacto 211677
Bsmb1 New England Biolabs R0580L
Calf intestinal phosphatase (CIP) New England Biolabs M0290L
Cut Smart Buffer New England Biolabs B7204S
Dimethyl Sulfoxide (DMSO) Sigma-Aldrich D8418
dNTPs New England Biolabs N0447L
Ethylenediaminetetraacetic acid (EDTA) Sigma-Aldrich 3609
Glacial Acetic Acid Sigma-Aldrich 2810000ACS
Glucose BDH VWR analytical BDH9230
Glycerol Sigma-Aldrich 49767
Kpn1 New England Biolabs R3142L
LB-Medium MP 3002-032
Lithium Acetate Sigma-Aldrich 517992
L-Tryptophan Sigma-Aldrich T0254
Maltose Sigma-Aldrich M5885
Molecular Biology Water Sigma-Aldrich W4502
NEB3.1 Buffer New England Biolabs B7203S
Nourseothricin Werner Bioagents 74667
Poly(ethylene glycol) PEG 3350 Sigma-Aldrich P4338
Sac1 New England Biolabs R3156L
Salmon Sperm DNA Invitrogen AM9680
T4 Polynucleotide kinase New England Biolabs M0201S
T4 DNA ligase New England Biolabs M0202L
Taq polymerase New England Biolabs M0267X
Tris HCl Sigma-Aldrich T3253
uridine Sigma-Aldrich U3750
Yeast Extract BD Bacto 212750
Equipment
Electrophoresis Appartus
Incubator
Microcentifuge
PCR machine
Replica Plating Apparatus
Rollerdrum or shaker
Spectrophotometer
Waterbath

DOWNLOAD MATERIALS LIST

References

  1. Pfaller, M. A., Diekema, D. J. Epidemiology of invasive candidiasis: a persistent public health problem. Clinincal Microbiology Review. 20, (1), 133-163 (2007).
  2. Magill, S. S., et al. Multistate point-prevalence survey of health care-associated infections. New England Journal of Medicine. 370, (13), 1198-1208 (2014).
  3. Wisplinghoff, H., et al. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clinical Infectious Disease. 39, (3), 309-317 (2004).
  4. Jones, T., et al. The diploid genome sequence of Candida albicans. Proceedings of the National Academy of Science USA. 101, (19), 7329-7334 (2004).
  5. Muzzey, D., Schwartz, K., Weissman, J. S., Sherlock, G. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biology. 14, (9), (2013).
  6. Morschhauser, J., Michel, S., Staib, P. Sequential gene disruption in Candida albicans by FLP-mediated site-specific recombination. Molecular Microbiololgy. 32, (3), 547-556 (1999).
  7. Lau, V., Davie, J. R. The discovery and development of the CRISPR system in applications in genome manipulation. Biochemistry and Cell Biology. 95, (2), 203-210 (2017).
  8. Doudna, J. A., Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  9. Anders, C., Niewoehner, O., Duerst, A., Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. 513, (7519), 569-573 (2014).
  10. Reardon, S. Welcome to the CRISPR zoo. Nature. 531, (7593), 160-163 (2016).
  11. Vyas, V. K., et al. New CRISPR Mutagenesis Strategies Reveal Variation in Repair Mechanisms among Fungi. mSphere. 3, (2), (2018).
  12. Vyas, V. K., Barrasa, M. I., Fink, G. R. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science Advances. 1, (3), e1500248 (2015).
  13. Evans, B. A., et al. Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6. PeerJ. 6, e4920 (2018).
  14. Kim, D., et al. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology. 34, (8), 863-868 (2016).
  15. Tarasava, K., Oh, E. J., Eckert, C. A., Gill, R. T. CRISPR-enabled tools for engineering microbial genomes and phenotypes. Biotechnology Journal. e1700586 (2018).
  16. Raschmanova, H., Weninger, A., Glieder, A., Kovar, K., Vogl, T. Implementing CRISPR-Cas technologies in conventional and non-conventional yeasts: Current state and future prospects. Biotechnology Advances. 36, (3), 641-665 (2018).
  17. Min, K., Ichikawa, Y., Woolford, C. A., Mitchell, A. P. Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System. mSphere. 1, (3), (2016).
  18. Ng, H., Dean, N. Dramatic Improvement of CRISPR/Cas9 Editing in Candida albicans by Increased Single Guide RNA Expression. mSphere. 2, (2), (2017).
  19. Huang, M. Y., Woolford, C. A., Mitchell, A. P. Rapid Gene Concatenation for Genetic Rescue of Multigene Mutants in Candida albicans. mSphere. 3, (2), (2018).
  20. Shapiro, R. S., et al. A CRISPR-Cas9-based gene drive platform for genetic interaction analysis in Candida albicans. Nature Microbiology. 3, (1), 73-82 (2018).
  21. Grahl, N., Demers, E. G., Crocker, A. W., Hogan, D. A. Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species. mSphere. 2, (3), (2017).
  22. Nguyen, N., Quail, M. M. F., Hernday, A. D. An Efficient, Rapid, and Recyclable System for CRISPR-Mediated Genome Editing in Candida albicans. mSphere. 2, (2), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics