Utilisation de CRISPR/Cas9 pour éliminer gm-CSF dans les cellules CAR-T

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ici, nous présentons un protocole pour modifier génétiquement les cellules CAR-T via un système CRISPR/Cas9.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sterner, R. M., Cox, M. J., Sakemura, R., Kenderian, S. S. Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells. J. Vis. Exp. (149), e59629, doi:10.3791/59629 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La thérapie cellulaire du récepteur d'antigène chimérique T (CAR-T) est une nouvelle option de traitement de pointe et potentiellement révolutionnaire pour le cancer. Cependant, il y a des limites significatives à son utilisation répandue dans le traitement du cancer. Ces limitations incluent le développement des toxicités uniques telles que le syndrome de dégagement de cytokine (CRS) et la neurotoxicité (NT) et l'expansion limitée, les fonctions d'effecteur, et l'activité antitumorale dans les tumeurs pleines. Une stratégie visant à améliorer l'efficacité du CAR-T et/ou à contrôler les toxicités des cellules CAR-T consiste à modifier le génome des cellules CAR-T elles-mêmes lors de la fabrication des cellules CAR-T. Ici, nous décrivons l'utilisation de l'édition de gène CRISPR/Cas9 dans les cellules DE CAR-T par transduction avec une construction lentivirale contenant un ARN de guide au facteur de stimulation de colonie de macrophage de granulocyte (GM-CSF) et cas9. À titre d'exemple, nous décrivons CRISPR/Cas9 pare-t-il de GM-CSF. Nous avons montré que ces cellules GM-CSFk/o CAR-T produisent effectivement moins de GM-CSF tout en maintenant la fonction critique des lymphocytes T et entraînent une activité antitumorale accrue in vivo par rapport aux cellules carturiennes de type sauvage.

Introduction

La thérapie cellulaire du récepteur d'antigène chimérique T (CAR-T) est très prometteuse dans le traitement du cancer. 1 Fois , 2 Deux thérapies cellulaires CAR-T ciblant le CD19 (CART19) ont récemment été approuvées aux États-Unis et en Europe pour l'utilisation dans les malignités des cellules B après avoir démontré des résultats frappants dans des essais cliniques multicentriques. 3 (en) , 4 ( en plus) , 5 Les obstacles à une utilisation plus répandue des cellules CAR-T sont une activité limitée dans les tumeurs solides et les toxicités associées, y compris le syndrome de libération de cytokine (SRC) et la neurotoxicité (NT). 3 (en) , 5 Annonces , 6 Annonces , 7 Annonces , 8 Annonces , 9 Pour améliorer l'indice thérapeutique de la thérapie cellulaire CAR-T, des outils d'ingénierie génomique tels que les nucléases de doigts de zinc, taleNs et CRISPR sont utilisés pour modifier davantage les cellules CAR-T dans le but de générer des cellules CAR-T moins toxiques ou plus efficaces. 10 Ans et plus , 11 Ans, états-unis (

Dans cet article, nous décrivons une méthode pour générer des cellules CAR-T éditées CRISPR/Cas9. L'objectif spécifique de cette méthode est de modifier génétiquement les cellules CAR-T pendant la fabrication des cellules CAR-T via CRISPR/Cas9 pour générer des cellules CAR-T moins toxiques ou plus efficaces. La raison d'être de l'élaboration de cette méthodologie repose sur les leçons tirées de l'expérience clinique de la thérapie cellulaire CAR-T, ce qui indique un besoin urgent de nouvelles stratégies pour augmenter la fenêtre thérapeutique de la thérapie cellulaire CAR-T et étendre l'application à d'autres tumeurs et est soutenue par les progrès récents dans la biologie synthétique permettant des modifications multiples des cellules de CAR-T qui ont commencé à entrer dans la clinique. Alors que plusieurs outils d'ingénierie génomique sont en cours de développement et d'application dans différents contextes, tels que les nucléases de doigts de zinc, taleNs, et CRISPR, notre méthodologie décrit la modification CRISPR/Cas9 des cellules CAR-T. 10 Ans et plus , 11 CRISPR/Cas9 est un mécanisme de défense bactérienne à base d'ARN qui est conçu pour éliminer l'ADN étranger. CRISPR s'appuie sur les endonucalases pour censer une séquence cible identifiée à l'aide d'un ARN guide (gRNA). L'édition CRISPR des cellules CAR-T offre plusieurs avantages par rapport à d'autres outils d'ingénierie génomique. Il s'agit notamment de la précision de la séquence gRNA, la simplicité de concevoir un gRNA ciblant le gène d'intérêt, l'efficacité élevée d'édition de gènes, et la capacité de cibler plusieurs gènes puisque plusieurs gARN peuvent être utilisés en même temps.

Plus précisément dans les méthodes décrites ici, nous avons utilisé un lentivirus codant L'ARN guide CRISPR et Cas9 pour perturber un gène pendant la transduction cararie des lymphocytes T. En sélectionnant une technique appropriée pour modifier les cellules CAR-T, nous suggérons que la technique décrite ici est un mécanisme efficace pour générer des cellules CAR-T de qualité de recherche, mais parce que l'effet à long terme de l'intégration permanente de Cas9 dans le génome est inconnu, nous proposer cette méthodologie pour développer des cellules CAR-T de qualité de recherche de preuve de concept mais pas pour produire de bonnes pratiques de fabrication catégorie cellules CAR-T.

En particulier, ici nous décrivons la génération du facteur stimulant de colonie de macrophage de granulocyte (GM-CSF) knock-out des cellules de CAR-T de BUT-T ciblant CD19 humain. Ces cellules CAR-T ont été générées par transduction avec des particules lentivirales codant un ARN guide spécifique à GM-CSF (nom de gène CSF2) et Cas9. Nous avons précédemment constaté que la neutralisation de GM-CSF améliore CRS et NT dans un modèle de xénogreffe. 12 cellules GM-CSFk/o CAR-T permettent l'inhibition de GM-CSF pendant le processus de fabrication, réduisant efficacement la production de GM-CSF tout en améliorant l'activité antitumorale et la survie des cellules CAR-T in vivo par rapport aux cellules cartumanes de type sauvage. 12 Ainsi, ici nous fournissons une méthodologie pour générer des cellules CAR-T éditées CRISPR/Cas9.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Ce protocole suit les lignes directrices du Conseil d'examen institutionnel (CISR) de la clinique Mayo et du Comité de biosécurité institutionnelle (BAC).

1. Production de cellules CART19

  1. Isolement cellulaire, stimulation et culture ex-vivo
    1. Effectuer tous les travaux de culture cellulaire dans une hotte de culture cellulaire en utilisant l'équipement de protection individuelle approprié. Récoltez les cellules mononucléaires périphériques de sang (PBMC) des cônes normaux de sang de donneur de de--identifié recueillis pendant l'apheresis car ceux-ci sont connus pour être une source viable de PBMCs.13
    2. Pour isoler les PBMC, ajouter 15 ml d'un milieu de gradient de densité à un tube de séparation de gradient de densité de 50 ml. Diluer le sang du donneur avec un volume égal de saline tamponnée par phosphate (PBS) contenant 2 % de sérum bovin fœtal (SGF) pour éviter le piégeage cellulaire.
      1. Ajouter le sang dilué du donneur du cône dans le tube de séparation, en prenant soin de ne pas perturber l'interface entre le sang et le milieu de gradient de densité. Centrifugeuse à 1200 x g pendant 10 min à RT.
      2. Décant le supernatant dans un nouveau 50 ml conique, laver avec PBS 2% FBS en apportant jusqu'à 40 ml, centrifugeuse à 300 x g pendant 8 min à RT, aspirer supernatant, resuspendre dans 40 ml de tampon, et les cellules de comptage.
    3. Isoler les lymphocytes T des PBMC via un kit de perles magnétiques de sélection négative à l'aide d'un séparateur cellulaire entièrement automatisé selon le protocole du fabricant.
    4. Pour la culture des lymphocytes T isolés, préparer le milieu cellulaire T (TCM) qui se compose de 10% de sérum HUMAIN AB (v/v), 1% pénicilline-streptomycine-glutamine (v/v), et milieu cellulaire hématopoïétique sans sérum. Stérilisez le milieu en filtrant à travers un filtre à vide stérile de 0,45 m, puis avec un filtre à vide stérile de 0,22 m.
    5. Le jour 0 (le jour de la stimulation des lymphocytes T), lavez les perles CD3/CD28 avant la stimulation des lymphocytes T. Pour laver, placez le volume requis de perles (utiliser suffisamment de perles CD3/CD28 pour un rapport de 3:1 perles:T cellules; notez la concentration de perles peut être variable) dans un tube stérile de 1,5 mL microcentrifuge et resuspend dans 1 ml de TCM.
    6. Placer en contact avec un aimant.
    7. Après 1 min, aspirer le MTC et resuspendre dans 1 ml de TCM frais pour laver les perles.
    8. Répétez cette procédure pour un total de trois lavages.
    9. Après le troisième lavage, resuspendre les perles dans 1 ml de ML de MTC.
    10. Comptez les lymphocytes T.
    11. Transférer les perles aux lymphocytes T à un rapport de 3:1 perles:cellules.
    12. Diluer les cellules jusqu'à une concentration finale de 1 x 106 cellules/mL.
    13. Incuber à 37 oC, 5 % de CO2 pour 24 h.
  2. Transfection et transduction des lymphocytes T
    1. Effectuez des travaux lentiviraux en utilisant les précautions BSL-2MD, y compris les hottes de culture cellulaire, l'équipement de protection individuelle et la désinfection des matériaux usagés avec de l'eau de Javel avant l'élimination.
    2. Acquérir une construction CART19 dans un vecteur lentiviral.
      REMARQUE : La construction CART19 utilisée ici a été conçue puis synthétisée de novo à l'aide d'un fournisseur de synthèse de protéines disponible dans le commerce. La construction de la RCA a ensuite été clonée en lentivirus de troisième génération sous le contrôle d'un promoteur EF-1. Le fragment de région variable à chaîne unique est dérivé du clone FMC63 et reconnaît le CD19 humain. La construction CAR19 possède un domaine costimulatoire 4-1BB de deuxième génération et une stimulation CD3MD (FMC63-41BBz). 12 Ans, états-unis
    3. Effectuer la production de lentivircomme tel que décrit précédemment. 12 Ans, états-unis
      1. En bref, pour produire le lentivirus, utilisez des cellules 293T qui ont atteint 70-90% de confluence.
      2. Autoriser l'incubation de 30 min à température ambiante des réactifs de transfection, y compris 15 g du plasmide lentiviral d'intérêt, 18 g d'un vecteur d'emballage gag/pol/tat/rev, 7 g d'un vecteur d'enveloppe VSV-G, 111 oL du réactif précomplexe, 129 oL de l'emballage réactif de transfection, et 9,0 ml du milieu de transfection avant d'ajouter aux cellules 293T. Puis la culture des cellules transfectées à 37 oC, 5% CO2.
      3. Récolte, centrifugeuse (900 x g pour 10 min), filtre (filtre en nylon de 0,45 M) et supernatant concentré à 24 et 48 h par ultracentrifugation à 13 028 x g pour 18 h ou 112 700 x g pour 2 h.
      4. Congeler à -80 oC pour une utilisation future.
    4. Le jour 1, resuspendre doucement les lymphocytes T pour briser les rosettes des lymphocytes T qui avaient été stimulées à 1 x 106/mL le jour 0.
    5. En vertu des précautions appropriées de BSL-2MD pour tous les travaux lentiviraux, ajouter le virus récolté frais ou congelé aux lymphocytes T stimulés à une multiplicité d'infection (MOI) de 3,0.
  3. Expansion des cellules CAR-T
    1. Pendant la phase d'expansion, continuer à incuber les lymphocytes T transductés à 37 oC, 5 % CO2. Comptez les cellules CAR-T les jours 3 et 5, et ajoutez du MTC frais et préréchauffé à la culture pour maintenir une concentration de cellules CAR-T de 1 x 106/mL.
    2. Enlever les perles des lymphocytes T transductés 6 jours après la stimulation (Jour 6) à l'aide d'un aimant. Récoltez, suspendez et placez les lymphocytes T dans des tubes coniques de 50 ml dans un aimant pendant 1 min. Puis recueillir le supernatant (contient les cellules CAR-T), et jeter les perles.
    3. Placez les cellules CAR-T collectées en culture à une concentration de 1 x 106 cellules/mL pour reprendre l'expansion.
    4. Le jour 6, évaluer l'expression de surface de la RCA par cytométrie d'écoulement.
      REMARQUE : Plusieurs méthodes peuvent être utilisées pour détecter l'expression de surface de la RCA, comme la coloration d'un anticorps secondaire à adsorbe croisé s'il y a de la chèvre igG (H-L) ou en tachant avec un peptide spécifique CD19, conjugué à un fluorochrome. Ici, prenez un aliquot (environ 100 000 lymphocytes T) de la culture et lavez-le avec un tampon d'écoulement préparé avec la saline tamponnée de phosphate de Dulbecco, 2 % de sérum bovin fœtal et 1 % d'azide de sodium. Tainer les cellules avec l'anticorps anti-CAR et laver deux fois. Tainer les cellules avec une tache vivante/morte et un anticorps monoclonal CD3 (OKT3). Laver les cellules et resuspendre dans le tampon d'écoulement. Acquérir sur un cytomètre pour déterminer l'efficacité de la transduction.
  4. Cryoconservation des cellules CAR-T
    1. Pour récolter et cryoconserver les cellules CAR-T 8 jours après la stimulation (Jour 8 de l'expansion des lymphocytes T), récoltez les cellules de la culture.
    2. Faites tourner vers le bas pendant 5 min à 300 x g.
    3. Resuspendre dans le milieu de congélation à 10 millions de cellules par ml par flacon dans le milieu de congélation composé de 10% de sulfoxure de diméthyle et 90% de sérum bovin fœtal.
    4. Congeler dans un récipient de congélation pour obtenir un taux de refroidissement de -1 oC/min dans un congélateur de -80 oC, puis transférer à l'azote liquide après 48 h.
    5. Avant leur utilisation pour des expériences in vitro ou in vivo, décongeler les cellules CAR-T dans la MTC chaude.
    6. Laver les cellules pour diluer et enlever le sulfoxide de diméthyle et resuspendre à une concentration de 2 x 106 cellules/mL en TCM chaud. Reposez-vous toute la nuit à 37 oC, 5 % CO2.

2. Production GM-CSF k/o CART19

  1. Pour perturber GM-CSF, utilisez un ARN guide (gRNA) ciblant l'exon 3 de l'homme GM-CSF (CSF2) sélectionné par l'intermédiaire de gARN de dépistage précédemment signalés pour avoir une efficacité élevée pour le gène CSF2 qui code pour la cytokine humaine GM-CSF. 14 (en)
    REMARQUE : Une construction lentivirale de troisième génération de troisième génération de troisième génération de troisième génération de catégorie de recherche commercialement synthétisée contenant ce gRNA (sous un promoteur de U6) a été employée. La construction contient un gène de résistance à la puromycine. La séquence de l'ARNc est GACCTGCCTACAGACCCCCCGCC. 12 Ans, états-unis
  2. Pour produire le lentivirus, utilisez des cellules 293T qui ont atteint 70-90% de confluence.
  3. Autoriser 15 g du plasmide lentiviral d'intérêt, 18 g d'un vecteur d'emballage gag/pol/tat/rev, 7 g d'un vecteur d'enveloppe VSV-G, 111 l du réactif précomplexe, 129 oL du réactif de transfection et 9,0 mL du milieu de transfection pour incuber pendant 30 min à la pièce te mperature.
  4. Ajouter des réactifs de transfection aux cellules 293T. Puis la culture à 37 oC, 5% CO2.
  5. Récolte, centrifugeuse (900 x g pour 10 min), filtre (filtre en nylon de 0,45 m) et supernatant concentré à 24 et 48 h par ultracentrifugation à 13 028 x g pour 18 h ou 112 700 x g pour 2 h et congeler à -80 oC pour une utilisation future.
  6. Le jour 1, resuspendre doucement les lymphocytes T pour briser les rosettes.
  7. Dans un laboratoire approuvé par le BSL-2MD, ajouter le virus congelé ou fraîchement récolté aux lymphocytes T stimulés pour générer des cellules CAR-T. Transduce les lymphocytes T avec le lentivirus CAR19 et GM-CSF ciblant le lentivirus CRISPR. Ajouter le lentivirus CAR19 à un MOI de 3. Puisque la titration du lentivirus de CRISPR n'était pas faisable, utilisez des particules de virus générées à partir d'une préparation plasmide de 15 ug pour transduire 10 x 106 lymphocytes T.
  8. Voir les étapes restantes de la stimulation, de l'expansion et de la cryoconservation des lymphocytes T, telles qu'il est discuté à l'étape 1.
  9. Pour les lymphocytes T édités par lentiCRISPR porteurs de résistance à la puromycine, traiter les cellules avec du dihydrochlorure de puromycine à une concentration de 1 g de puromycine par 1 ml le jour 3 et le jour 5.

3. Efficacité des perturbations GM-CSF et évaluation fonctionnelle de GM-CSF k/o CART19

  1. Efficacité des perturbations GM-CSF : suivi des indels par décomposition (TIDE) séquençage et analyse
    1. Pour séquencer l'exon de l'intérêt pour le gène GM-CSF, utilisez les amorces suivantes. Utilisez une séquence d'apprêt vers l'avant pour GM-CSF (CSF2) de TGACTACAGAGAGGCACAGA, et une séquence d'amorce inversée de TCACCTCTGACCTCATTAACC.
    2. Extraire l'ADN de jusqu'à 5 millions de cellules CAR-T avec un kit d'extraction génomique. Pour la réaction pcR, utilisez 25 L d'un mastermix Taq par réaction avec une concentration finale de chaque amorce dans la réaction PCR de M, 0,1-0,5 g d'ADN de modèle, et un volume total de la réaction PCR porté à 50 'L avec de l'eau sans nucléane.
    3. Voir les conditions de cyclisme PCR décrites dans le tableau 1.
    4. Exécuter des échantillons de PCR sur un gel d'agarose de 1-2% à 100 V pendant 30 min et extraire à l'aide d'un kit d'extraction de gel.
    5. Séquence AMPlicons PCR. Calculez la fréquence de modification de l'allele en téléchargeant des données brutes dans un logiciel TIDE approprié. 15 Annonces
  2. Production GM-CSF et évaluation fonctionnelle de GM-CSFk/o CART19
    1. Pour déterminer la production de cytokine des cellules CAR-T, incuber les cellules cart19 de type sauvage et GM-CSFk/o CART19 avec le CD19 exprimant la lignée de cellules lymphoblastiques aigues DE la leucémie NALM6 à un rapport de 1:5 pour 4 h à 37 oC, 5% CO2 en présence de monensine c'est-à-contre, c'est anti-humain CD49d, CD28 anti-humain et CD107a anti-humain.
    2. Récolte des cellules de la culture pour la cytométrie de flux. Laver les cellules avec un tampon de cytométrie d'écoulement. Tainer les cellules avec un kit de coloration vivant/mort. Incuber dans l'obscurité à température ambiante pendant 15 min. Fixer les cellules avec un milieu de fixation et incuber dans l'obscurité à température ambiante pendant 15 min.
    3. Après le lavage, tacher les cellules intracellulairement avec le milieu de perméabilisation en combinaison avec l'anticorps monoclonal anti-humain IFNMD, l'anti-humain GM-CSF, le MIP-1, l'IL-2 anti-humain et le CD3 antihumain et incuber dans l'obscurité à température ambiante pendant 30 min. Laver et resuspendre les échantillons. Acquérir des échantillons sur un cytomètre de débit et analysé pour le pourcentage d'expression intracellulaire GM-CSF.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figure 1 montre la réduction de GM-CSF dans les cellules GM-CSFk/o CART19. Pour vérifier que le génome des lymphocytes T a été modifié pour koiller GM-CSF, le séquençage TIDE a été utilisé dans les cellules GM-CSFk/o CART19 (figure 1A). La coloration de la surface des cellules CAR-T vérifie que les lymphocytes T expriment avec succès le récepteur de surface de la RCA in vitro en gating sur des cellules CD3 MD vivantes (figure 1B). La coloration intracellulaire de GM-CSF par cytométrie de flux démontre l'expression diminuée de GM-CSF dans les cellules de GM-CSFk/o CART19 en gating sur les cellules CD3 MD en direct, vérifiant le succès fonctionnel du knock-out (Figure 1C). Les cellules GM-CSFk/o CAR-T présentent une diminution des cellules GM-CSF par rapport aux cellules anti-CD19 CAR-T de type sauvage (CART19) par l'intermédiaire de coloration intracellulaire (figure1B). En outre, nous avons précédemment montré que les cellules DE CAR-T de GM-CSFréduisent la production de GM-CSF tout en améliorant l'activité et la survie d'antitumorale comparées aux cellules sauvages de CAR-T in vivo. 12 Ans, états-unis 

pas Température (C) temps Cycles
Dénaturation initiale 94, en plus 3 min 1 Fois
Dénaturation 94, en plus 45 sec 35 Annonces
Recuit 60 Annonces 30 sec
prolongation 72 Annonces 2 min
Post-élongation 72 Annonces 10 min 1 Fois
4 ( en plus)

Tableau 1 : Conditions de cycle PCR pour le séquençage TIDE des cellules GM-CSFk/o CART19.

Figure 1
Figure 1 : GM-CSFk/o Les cellules CART19 montrent une réduction de GM-CSF. A) Une séquence TIDE représentative vérifie l'altération du génome des cellules GM-CSF CRISPR/Cas9 GM-CSFk/o CART19 avec une efficacité de perturbation de 71 %. B) Les parcelles de flux représentatives représentent une production réussie de cellules CAR-T avec une expression CAR similaire sur le type sauvage CART19 et GM-CSFk/o CART19. C) Comme l'a dit la coloration intracellulaire, les cellules GM-CSFk/o CART19 montrent une réduction du GM-CSF par rapport au type sauvage CART19 lorsqu'elle est stimulée avec la lignée cellulaire POSITIVE CD19 NALM6. Veuillez cliquer ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dans ce rapport, nous décrivons une méthodologie pour employer la technologie DE CRISPR/Cas9 pour induire des modifications secondaires dans les cellules de CAR-T. Plus précisément, cela est démontré à l'aide de la transduction lentivirale avec un vecteur viral qui contient du gRNA ciblant le gène d'intérêt et Cas9 pour générer des cellules GM-CSFk/o CART19. Nous avions précédemment montré que la neutralisation de GM-CSF améliore CRS et NT dans un modèle de xénogreffe. 12 Comme nous l'avons déjà décrit, les cellules GM-CSFk/o CAR-T permettent l'inhibition de GM-CSF pendant le processus de fabrication, réduisent efficacement la production de GM-CSF tout en maintenant d'autres fonctions critiques de cellules T, et ont comme conséquence l'amélioration l'activité antitumorale in vivo comparée aux cellules carturies de type sauvage DE CAR-T. 12 Ans, états-unis

Étant donné que l'intégration permanente de Cas9 dans le génome pourrait être associée à des effets indésirables lorsqu'elle est traduite vers un produit cliniquement viable, nous proposons cette méthodologie spécifique comme un moyen de générer la qualité de recherche CRISPR/Cas9 modifié CART19 pour la preuve de concept Expériences.

Tandis que les cellules de CAR-T tiennent proprometteuse dans la thérapie de cancer,1,2 leur efficacité peut continuer à être augmentée et leurs toxicités associées mieux commandées. La technologie CRISPR/Cas9 fournit une stratégie pour cibler directement le génome des cellules CAR-T afin de concevoir des solutions aux lacunes cliniques actuelles. Dans cet article, nous décrivons la génération des cellules DE GM-CSFk/o CART19.

Les cellules GM-CSFk/o CAR-T ont été générées par transduction avec un vecteur lentiviral pour le plasmide de cellules CAR-T et une construction de lentivirus contenant un ARN guide pour GM-CSF et Cas9. Pour générer le GM-CSFk/o, une construction de lentivirus de troisième génération (lentiCRISPRv2) contenant Cas9 et un ARN guide à haut rendement signalé (gRNA) ciblant exon 3 de GM-CSF humain (CSF2)14 sous le contrôle d'un promoteur U6 a été utilisé. Un soin particulier doit être pris pendant les étapes de transduction de la procédure car elles sont les plus critiques pour le développement des cellules CAR-T modifiées. L'efficacité de Knockout peut être vérifiée et évaluée par le suivi des indels par des séquences de décomposition (TIDE). L'activité fonctionnelle des cellules CAR-T est étudiée par la stimulation spécifique à l'antigène de la construction cararie avec des cellules cibles CD19MD, suivie par la mesure de différentes fonctions des lymphocytes T, y compris la production de GM-CSF. 12 Il convient de noter que la coloration de l'expression carRAC avec un anticorps antisouris de chèvre devrait se produire avant que d'autres anticorps ne se colorent avec deux lavages avant la coloration de surface en raison du fragment de région variable à chaîne unique du CART19 étant d'origine de souris. Il s'agit d'un point d'accent dans le tir de difficulté si une bonne expression DE la RCA n'est pas initialement observée.

Ces cellules CAR-T modifiées peuvent être utilisées dans des études in vitro et des modèles in vivo de xénogreffe pour des expériences de preuve de concept. Un avantage de cette technique est que la production de cellules CAR-T et la manipulation génétique peuvent se produire en une seule étape avec une bonne efficacité par rapport à d'autres techniques. 10 Ans et plus , 11 Bien que la double transduction lentivirale soit une méthode pratique et efficace pour générer des cellules GM-CSFk/o CART19 de qualité de recherche, l'ADN est incorporé dans le génome et l'expression prolongée de Cas9 peut déstabiliser le génome et augmenter le risque d'effets hors cible. Une limitation de cette technique est que les KO de qualité de bonne pratique exigeraient la modification de la technique à un système CRISPR/Cas9 de ribonucleoprotein car cette méthodologie n'a pas comme conséquence l'incorporation permanente de Cas9 dans le génome et réduit le risque d'effets hors cible. La méthodologie décrite dans le protocole ici peut potentiellement être appliquée à une variété de gènes pour modifier génétiquement les cellules CAR-T via CRISPR/Cas9 pour aider à générer des cellules CAR-T moins toxiques ou plus efficaces.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

SSK est un inventeur de brevets dans le domaine de la thérapie à cellule T CAR qui sont sous licence à Novartis (en vertu d'un accord entre Mayo Clinic, Université de Pennsylvanie, et Novartis). Ces études ont été financées en partie par une subvention de Humanigen (SSK). RMS, MJC, RS et SSK sont des inventeurs de brevets liés à ce travail. Le laboratoire (SSK) reçoit des fonds de Tolero, Humanigen, Kite, Lentigen, Morphosys et Actinium.

Acknowledgments

Ce travail a été soutenu par des subventions de K12CA090628 (SSK), du National Comprehensive Cancer Network (SSK), du Mayo Clinic Center for Individualized Medicine (SSK), de la Predolin Foundation (SSK), du Mayo Clinic Office of Translation to Practice (SSK) et le Mayo Clinic Medical Scientist Training Program Robert L. Howell Physician-Scientist Scholarship (RMS).

Materials

Name Company Catalog Number Comments
CD3 Monoclonal Antibody (OKT3), PE, eBioscience Invitrogen 12-0037-42
CD3 Monoclonal Antibody (UCHT1), APC, eBioscience Invitrogen 17-0038-42
Choice Taq Blue Mastermix Denville Scientific C775Y51
CTS (Cell Therapy Systems) Dynabeads CD3/CD28 Gibco 40203D
CytoFLEX System B4-R2-V2 Beckman Coulter C10343 flow cytometer
dimethyl sulfoxide Millipore Sigma D2650-100ML
Dulbecco's Phosphate-Buffered Saline Gibco 14190-144 
Dynabeads MPC-S (Magnetic Particle Concentrator) Applied Biosystems A13346
Easy 50 EasySep Magnet STEMCELL Technologies 18002
EasySep Human T Cell Isolation Kit  STEMCELL Technologies 17951 negative selection magnetic beads; 17951RF includes tips and buffer
Fetal bovine serum Millipore Sigma F8067
FITC Mouse Anti-Human CD107a  BD Pharmingen 555800
Fixation Medium (Medium A) Invitrogen GAS001S100
GenCRISPR gRNA Construct: Name: CSF2
CRISPR guide RNA 1; Species: Human, Vector:
pLentiCRISPR v2; Resistance: Ampicillin; Copy number:
High; Plasmid preparation: Standard delivery: 4 μg (Free
of charge)
GenScript N/A custom order
Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 Invitrogen A-21235
https://tide.nki.nl. Desktop Genetics
Human AB Serum; Male Donors; type AB; US Corning 35-060-CI
IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience Invitrogen 47-7319-42
Lipofectamine 3000 Transfection Reagent Invitrogen L3000075
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation Invitrogen L34966
Lymphoprep STEMCELL Technologies 07851
Monensin Solution, 1000X BioLegend 420701
Mouse Anti-Human CD28 Clone CD28.2 BD Pharmingen 559770
Mouse Anti-Human CD49d Clone 9F10 BD Pharmingen 561892
Mouse Anti-Human MIP-1β PE-Cy7 BD Pharmingen 560687
Mr. Frosty Freezing Container Thermo Scientific 5100-0001
NALM6, clone G5  ATCC CRL-3273 acute lymphoblastic leukemia cell line
Nuclease Free Water Promega P119C
Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile Genesee Scientific 25-227
Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM Thermo Scientific Nalgene 450-0045
Opti-MEM I Reduced-Serum Medium (1X), Liquid Gibco 31985-070
PE-CF594 Mouse Anti-Human IL-2 BD Horizon 562384
Penicillin-Streptomycin-Glutamine (100X), Liquid Gibco 10378-016
Permeabilization Medium (Medium B) Invitrogen GAS002S100
PureLink Genomic DNA Mini Kit Invitrogen K182001
Puromycin Dihydrochloride MP Biomedicals, Inc. 0210055210
QIAquick Gel Extraction Kit QIAGEN 28704
Rat Anti-Human GM-CSF BV421 BD Horizon 562930
RoboSep-S STEMCELL Technologies 21000 Fully Automated Cell Separator
SepMate-50 (IVD) STEMCELL Technologies 85450
Sodium Azide, 5% (w/v) Ricca Chemical 7144.8-16
X-VIVO 15 Serum-free Hematopoietic Cell Medium Lonza 04-418Q

DOWNLOAD MATERIALS LIST

References

  1. Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. Chimeric antigen receptor T-cell therapy to target hematologic malignancies. Cancer Research. 74, (22), 6383-6389 (2014).
  2. Lim, W. A., June, C. H. The Principles of Engineering Immune Cells to Treat Cancer. Cell. 168, (4), 724-740 (2017).
  3. Neelapu, S. S., et al. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. The New England Journal of Medicine. 377, (26), 2531-2544 (2017).
  4. Maude, S. L., et al. Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. The New England Journal of Medicine. 378, (5), 439-448 (2018).
  5. Schuster, S. J., et al. Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas. The New England Journal of Medicine. 377, (26), 2545-2554 (2017).
  6. Grupp, S. A., et al. Chimeric antigen receptor-modified T cells for acute lymphoid leukemia. The New England Journal of Medicine. 368, (16), 1509-1518 (2013).
  7. Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. The New England Journal of Medicine. 365, (8), 725-733 (2011).
  8. Gust, J., et al. Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells. Cancer Discovery. 7, (12), 1404-1419 (2017).
  9. Fitzgerald, J. C., et al. Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia. Critical Care Medicine. 45, (2), e124-e131 (2017).
  10. Liu, X., Zhao, Y. CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy. Current Research in Translational Medicine. 66, (2), 39-42 (2018).
  11. Ren, J., Zhao, Y. Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9. Protein Cell. 8, (9), 634-643 (2017).
  12. Sterner, R. M., et al. GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts. Blood. (2018).
  13. Dietz, A. B., et al. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion. 46, (12), 2083-2089 (2006).
  14. Sanjana, N. E., Shalem, O., Zhang, F. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods. 11, (8), 783-784 (2014).
  15. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Research. 42, (22), e168 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics