성인 제 브라 피시 하트 연구를 위한 흉부 내 주사

Biology
 

Summary

이 방법은 성인 zebrafish의 흉부에 용액의 0.5-3 μ l의 주입에 의존 한다. 이 절차는 장기를 손상 시 키 지 않고 제 브라 피쉬 심장의 근접으로 단백질과 화학 물질을 효율적으로 전달 합니다. 접근법은 심장의 다양 한 조직에 대 한 외 인 성 인자의 효과를 테스트 하는 데 적합 합니다.

Cite this Article

Copy Citation | Download Citations

Bise, T., Jaźwińska, A. Intrathoracic Injection for the Study of Adult Zebrafish Heart. J. Vis. Exp. (147), e59724, doi:10.3791/59724 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

성인 zebrafish 심장은 심장 재생 연구에서 강력한 모델을 제공 합니다. 이 시스템의 강도는 형질 전환 접근법을 기반으로 하지만, 외 인 성 인자의 급속 한 전달은 기능적 연구에서 상보적 인 기술을 제공 한다. 여기에서, 우리는 심근 손상을 초래 하지 않고 심 낭 구멍으로 용액의 몇 마이크로 리터의 투여에 의존 하는 방법을 제시 한다. 흉부 (그것) 주사는 효과적으로 심장 표면에 직접 단백질과 화학 물질을 전달할 수 있습니다. 주입 된 물질은 기본 심장 조직으로 미식가를 통해 확산. 복 강 내 (IP) 주사와 비교 하 여 흉부 내 주사의 주요 이점은 표적 장기에 대 한 시험 된 인자의 초점 관리입니다. 심 낭에 직접 분자의 전달은 성인 제 브라 피쉬의 심장 전처리 및 재생에 대 한 연구에 적합 한 전략 이다.

Introduction

척추 동물 중에서, 제 브라 피쉬는 그들의 마음을 재생성 하는 놀라운 능력을가지고 있습니다1,2. 이 능력은 몇몇 상해 모형, 즉 심 실 꼭대기 절제술, 저온 손상 (CI) 및 유전 심근 세포 절제3,5,7에서 보고 되었습니다. 침 습성 부상 후, 뇌 실의 손상 된 벽은 섬유 성 조직에 의해 일시적으로 치유 되 고,이는 점진적으로 새로운심근 8,10,11으로 대체 된다. 초기 상처 치유 반응은 면역 세포의 활성화 및 채용을 포함 한다12,13,14,15. 부수적, 부 상당한 심근 근처에 심근 세포로 활성화 되 고, 제거, 증식 및 점진적으로 부상 영역을 대체 30-90일 16,18, 19. 심장 재생의 분자 및 세포 기전을 해독 하는 실질적인 진보는 세포 계통 추적 분석, 유도성 유전자과 발현과 같은 유전 도구의 가용성 덕분에 달성 되었습니다. 형광 조직 리포터 라인 및 CRISPR/Cas9 유전자 돌연변이 유발20,21.

우리는 최근 성인 제 브라 피시22,23에 의해 심장 프리 컨디셔닝 모델을 확립 했습니다. 프리 컨디셔닝은 심장 보호 유전자의 발현을 증가 시키고 온전한 상태로 세포 순환에 재 진입 하 여 마음을 재생 시킨다. 이러한 과정은 면역 세포 및 매트릭스 리 모델링22,24의 모집과 관련 된다. 사전 컨디셔닝의 메커니즘은 제대로 이해 되지 않으며,이 연구 영역을 조성 하기 위해 새로운 기술의 확립이 필요 합니다. 특히, 분 비 된 시그널링 단백질 또는 다른 화학적 화합물의 최적화 된 투여는이 주제를 더 조사 하기 위해 필수적 이다.

수생 동물 인 zebrafish는 아가미와 피부를 통해 물에 녹아 있는 다양 한 물질을 자연적으로 흡수 할 수 있습니다. 이는 약리학 적 억제제, 스테로이드 호르몬, 타 목 시 펜, BrdU 및 항생제와 같은 다양 한 화학 물질을 가진 용액에 생선을 침 지 하 여 비 침 습 적 약물 전달을 가능 하 게 합니다. 실제로 , 우리의25,26,27를 포함 하 여 각종 실험실에서 수많은 연구 결과는, 재생 생물학6의 분야에서 특히 귀중 한이 방법을 이용 했습니다, 이 접근법은 그러나 제한 된 조직 투과성을 갖는 펩타이드, DNA, RNA, morpholinos 또는 분자의 전달에 적합 하지 않다. 이러한 경우에, 보다 효율적인 전달은 체 내에 미세 주입 함으로써, 예를 들어, 복 강 내 또는 intrapericardial 캐비티 (29)에 모세 혈관을 레트로-궤도 정 맥 내로 삽입 하 여, 31. 여기서, 우리는 성인 제 브라 피시에서 심장 재생 및 사전 컨디셔닝 연구를 하기에 적합 한 방법으로 소량의 용액을 흉부 내 주사 하는 절차를 설명 합니다.

Protocol

다음 의정서에 기술 된 동물 관리 및 모든 동물 절차는 스위스 프리 부르의 토 널 수의학 사무소에 의해 승인 되었다.

1. 도구 및 주사를 위한 솔루션

  1. 도 1a에 따른 바늘 끌어당기는 사람을 사용 하 여 마이크로 인젝션에 적합 한 붕 규 산 유리 모 세관을 잡아 당깁니다. 모델링 점토 또는 접착 테이프의 레일 9 cm 페 트리 접시에 뽑아 모세 혈관을 저장 합니다.
  2. 일반적인가 위를 사용 하 여 스펀지 조각 (7cm × 3cm × 1cm)을 잘라서 중간에 물고기 같은 실루엣을 개척.
  3. 테스트 된 단백질 또는 다른 화합물을 사용 하 여 소량의 주입 용액을 준비 하십시오. 1 배의 균형 잡힌 염 용액 (HBSS)에 있는 물질을 10% 페 놀 레드로 희석 하 여 분석 법에 따라 농도를 조절 합니다.
    참고: 여기서, 시험 된 단백질의 농도는 100 ng/m l 이었다.
  4. 완충 된 트리 네 마 취 제의 원 액을 제조 하기 위해, 980 mL의 증류수 4 g을 녹 이세요. 1 M의 트리-HCl을 사용 하 여 ph를 7.0-7.4로 조정 하 고 물로 1000 mL로 채웁니다. 용액을 4 ° c에서 어두운 곳에 보관 하십시오.
  5. 마 취 제의 작동 농도를 얻으려면, 1-2 mL의 트리 네 스톡 용액을 비 커에 생선 물 50 mL에 추가 하십시오.
    참고: 트리 네 마이 저의 작동 농도는 사용 하기 전에 신선 하 게 준비 해야 합니다.

2. 주사 스테이션의 제조

  1. 위쪽에서 빛을 사용 하 여 실체 현미경을 켜고 배율을 16x로 조정 합니다.
  2. 물고기 물과 스폰지를 담가, 현미경 단계에 9cm 페 트리 접시에 배치 하 고 초점을 조정.
  3. 실체 현미경의 밑에, 도 1a에 도시 된 바와 같이가 위를 사용 하 여 기초 로부터 ~ 7mm에 미세 모 세관의 말단을 절단 한다. 이상적인 팁 지름은 ~ 20 µm 것입니다.
    참고: 모 세관의 끝을 비스듬한 방법으로 절단 하는 것은 조직에 삽입 하는 데 최적입니다.
  4. 마이크로 모 세관을 마이크로 인젝터 장치의 니 들 홀더에 삽입 합니다.
  5. 마이크로 로더 팁을 사용 하 여 주입 압력을 설정 하기 위해 제어 솔루션 (예: 1x HBSS)을 로드 하 여 0.3 µ 및 0.5 µ의 적절 한 유량 범위를 확보 하십시오. 바늘을 비웁니다.
  6. 주사 용액의 선택 된 부피를 로드 합니다 (예를 들어, 모양 체의 신경 영양 인자 [CNTF]를 모 세관의 끝으로 희석 한다). 모 세관에 기포가 없어야 합니다.
    참고: 주사 용액의 최대 부피는 어류의 크기에 따라 달라진 다. 2.5-3cm의 표준 길이의 경우, exessive 흉부 팽 윤 및 출혈을 방지 하는 최대 주입 량은 5 µ L (그림 1f)로 결정 되었습니다. 더 큰 볼륨은 더 큰 물고기에 게 주입 될 수 있습니다.

3. 흉부 내 주사를 위한 어류의 제조

  1. 그물을 가진 성인 제 브라 피시 (Danio 재기록)를 잡아 마 취 용액으로 전송 합니다.
  2. 1-2 분 후에 물고기가 수영을 멈추고 운영의 움직임이 감소 하면 플라스틱 스푼으로 물고기를 터치 하 여 접촉에 반응 하지 않는지 확인 하십시오.
  3. 신속 하 고 신중 하 게 복 부 측면 위로, 젖은 스폰지의 홈에 숟가락으로 물고기를 전송 합니다. 물고기의 머리는 연산자의 지배적 인 손에서 멀리 해야 합니다.

4. 심 낭에 마이크로 주입

  1. 실체 현미경의 밑에, 물고기의 피부 밑에 박동 하는 심 혼의 운동을 주의깊게 관찰 하십시오. 심 복 부 연골 판에 의해 정의 된 삼각형의 중간 및 박동 심장 위의 주사 지점을 시각적으로 결정 합니다 (그림 1d). 모 세관의 끝을 몸체 축에 대해 30-45도 각도로 삽입 합니다 (그림 1e). 미세 모세 혈관의 팁으로 피부를 부드럽게 침투 합니다 (그림 1c). 최적의 진입 지점은 머리 보다 복 부에 더 가깝습니다.
    참고: 신체와 심장에 모 세관을 너무 깊게 삽입 하지 마십시오 .이로 인해 장기에 부상을 입을 수 있습니다. 심장 천자의 경우, 바늘은 일반적으로 혈액으로 채워집니다. 이런 일이 발생 하면 모 세관을 제거 하 고 실험에서 물고기를 배제 하십시오.
  2. 바늘이 심 낭 안쪽에 일단, 마이크로 인젝터 장치의 페달을 눌러 주입을 완료 하십시오.
    참고: 흉부 구멍에 공기를 주입 하지 않도록 주의 하십시오.
  3. 주사 후 흉부에서 모 세관을 조심 스럽게 철회 하 고 즉시 물고기를 시스템 물이 있는 탱크로 옮겨 회복 시킵니다.
  4. 마 취에서 총 회복 될 때까지 물고기를 모니터링 합니다.
  5. 원하는 시간 지점에서 마음을 수집 하 고 추가 분석을 위해 준비 합니다.
    참고: 물고기가 30 초 내에 작전의 움직임을 재개 하지 않는 경우 플라스틱 피 펫으로 아가미에 물을 압착 하 여 물고기를 다시 움직입니다.

Representative Results

흉 곽 (그것) 주사 후 외 인 성 용액의 효과를 분석 할 수 있습니다. 이 목적을 위해, 물고기는 안락사 시키고, 이전에 출판 된 프로토콜32,33에 따라 마음을 수집, 고정 및 조직 학적으로 처리 해야 한다.

이 방법을 검증 하기 위해 먼저 컬러 및 형광 염료를 주입 하 여 두 가지 테스트 실험을 수행 했습니다. 첫째, 우리는 물고기를 안락사 시키고, 흉부에 3 µ의 잉크를 주입 했습니다. 마음은 5 분 후에 수집 되었고, 인산 완충 식 염 액 (PBS)에서 세척 하 고, 2% 포 르 말린으로 고정 하 고, PBS로 세척 하 고 현미경으로 촬영 하였다. 둘째, 생체 내에서 1 µ µ, 6-디 아미노 노 제 2 페 린 돌 (DAPI)을 3 개 주입 하 고 2 시간 후에 심장을 고정 시켰다. 두 가지 분석 법 모두에서, 전체 산 분석이 심 실, 아 트리 움 및 불 버스 동정을 포함 한 전체 심장의 라벨링을 밝혀 내었다 (도 2a, B). 이러한 결과는 심장 표면에 주입 된 용액의 효율적인 확산을 보여줍니다.

성인 어류에 외 인 성 물질을 전달 하기 위한 일반적인 프로토콜은 복 강 내 (IP) 주사 이다. 심장 연구를 위한 IP 주사와의 적합성을 비교 하기 위해 우리는 두 방법을 사용 하 여 유사한 양의 DAPI를 주입 하 고 5 분 120 분 후에 마음을 고정 시켰습니다 (그림 3a). 심장 근육에 액 틴 라벨을 부착 하는 phalloidin 알 렉 사 플 라 이나 (AF) 568으로 마음을 단면화 하 고 염색 했습니다. 두 시간 지점에서 IP 주입 후 심장에서 DAPI 양성 세포가 관찰 되지 않았다 (도 3b). 대조적으로,이 주입은 심근에서 DAPI로 표시 된 핵의 존재를 가져왔다 (그림 3b). 이러한 결과는 주입이 IP 주입에 비하여 심장에 대 한 화합물의 전달을 향상 시켰다는 것을 입증 한다.

심장 재생 연구를 위한이 방법의 적합성을 테스트 하기 위해, 우리는 3및 7 일 후 저온 손상 (dapi)에서 1 µ g/ML dapi 및 1 µ g/ml phalloidin AF649의 3 µ l의 주사를 수행 했습니다. 1 시간 후 주입, 마음을 수집, 고정, 단면화 하 고 손상 된 심근를 시각화 하기 위해 phalloidin AF568으로 스테인드 했다. 우리는 심근와 부 상당한 조직이 다 수의 DAPI 양성 세포를 포함 하 여, 온전한 심장과 섬유 성 조직으로이 염료의 효과적인 침투를 나타내는 것을 발견 했습니다 (도 4b). 더욱이, 주입 된 phalloidin AF649는 또한 부 상당한 지역의 peri-부상 지역 및 몇몇 모집 한 섬유 아 세포의 심근 세포로에 의해 통합 되었습니다. 이 실험은 약물이 미식가를 교차 하 고 근본적인 심근 침투 할 수 있음을 보여줍니다.

염료를 사용 하 여 그것의 효율성을 테스트 한 후, 우리는 심장에 주입 된 단백질의 효과 분석. 우리는 CNTF 라고 불리는 사이토카인을 합성 하 여 thoracotomy24후에 상향 조정 됩니다. 우리는 다양 한 프로세스, 즉 심근 세포 증식, 세포 외 기질 증 착, 면역 세포 모집 및 심장 보호 유전자 발현에 대 한 외 인 성 CNTF의 효과를 조사 했습니다. 우리는이 모든 생물학적 측면이 제어 면역 글로불린과 비교 하 여 CNTF 주입에 의해 활성화 되었다는 것을 발견 했습니다 (그림 5)24. 이러한 결과는 흉부 내 주사의 방법이 다양 한 분석에서 뚜렷한 심장 조직에 미치는 영향을 연구 하기 위해 단백질의 표적 전달을 위한 적절 한 전략을 제공 한다는 것을 입증 합니다.

Figure 1
그림 1: 성인 제 브라 피시에 주입 하는 것입니다. (A) 필 라 멘 트 (6mm), 직경 1.0) 및 바늘 풀러 프로그램의 값이 있는 당겨 지는 미세 주입 모 세관의 사진. (B) 10% 페 놀 레드를 포함 하는 용액의 2.5 µ l로 채워진 필 라 멘 트 (6mm(1.0 mm)가 있는 뽑아 진 미세 주입 모 세관의 사진. 바늘의 당겨 끝은 최대로 7mm 길이입니다. (C) IT 주입 절차의 개략 표현. (D) IT 주입 절차의 사진. 이 수치는 비 세 외24에서 수정 되었습니다. 패널 C와 D의 숫자는 절차의 동일한 단계에 해당 합니다. (1) 물고기는가 습 된 스폰지에 복 부 쪽을 올려 둡니다. 펑크 사이트 (삼각형의 빨간색 점)는 아가미 근처의 가슴 중앙에 있습니다. (2) 심 낭에 바늘의 침투. 빨간색 점은 펑크 사이트를 나타냅니다. (3) 주사는 심 막 구멍의 적색 용액의 확산을 관찰 하 여 모니터링 한다. (E)이를 주입 하는 방식. 주사 모세 혈관과 몸체 축 사이의 각도는 심장 천자를 피하기 위해 30 ° ~ 45 ° 사이 여야 합니다. (F) 표시 된 부피를 주입 한 후 1 시간에 물고기 흉부 사진. 흰색 화살표는 내부 출혈을 나타낼 수 있는 redish 조직을 가리킵니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 주입 된 용액은 심장 표면에 거의 균일 하 게 퍼집니다. (A) 입체 이미지 2.5 µ l hbss 또는 2.5 µ l 잉크를 사용 하 여 사후 모 르 템 주사를 실시 한 물고기의 전체 심장. 잉크는 심 실 (V), 아 트리 움 (A) 및 구 근 동맥 (Ba)의 표면을 염색 하였다. 스케일 바 = 300 µm (B)이를 위해 hbss를 주입 하 고 1 µ G/ml dapi의 3 µ l을 사용 하 여 물고기의 전체 마음의 밝은 필드와 형광 실체 현미경 이미지. DAPI 형광 주사 직후 심장 부분에 검출 된다. 축척 막대 = 300 µm 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오 .

Figure 3
그림 3: DAPI를 심장에 전달 하기 위한 두 가지 주입 방법 비교 (A) 실험 설계의 계획. 복 강 내 (IP) 및 골 내 식 (IT) 주사는 동일한 양의 1 µ g/mL DAPI (3 µ L)로 수행 하였다. 마음은 주사 후 5 및 120 분에 수집 되었다. (B) 근육 섬유에 풍부 하 게 부착 된 형광 phalloidin (적색)으로 얼룩진 심장 단면의 공초점 현미경 사진. 주입 된 DAPI는 녹색으로 표시 된 적절 한 채널에서 시각화 되었습니다. IP 주입 후, DAPI는 언제 든 지 심장에서 감지 되지 않습니다. 주입 후, DAPI 양성 세포는 두 시간 지점 후에 심 실에 존재 한다. 축척 막대 = 500 µm 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오 .

Figure 4
그림 4: 그것은 심장 재생을 연구 하는 주입. (A) 실험 설계의 계획. 냉동 손상 후 3 일에서 7 일간 DAPI와 phalloidin AF649의 혼합이 주입 되었습니다 (µ µ 1). 하트는 주입 후 1 시간 후에, 고정, 단면화 및 phalloidin AF568 (적색)로 얼룩진 채 수집 되었다. (B) 3 및 7 dpci에서 세로 심장 부분의 공초점 현미경 이미지. 주입 된 DAPI (녹색) 및 phalloidin AF649 (파란색) 레이블 셀 손상 된 영역 (흰색 파선으로 구분) 및 손상 되지 않은 심근 (빨간색 염색). 흰색 화살표는 온전 하 게 콤팩트 하 고 섬유의 myocardia과 미식가를 통해 DAPI (녹색) 분포를 가리킵니다. 축척 막대 = 500 µm 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오 .

Figure 5
그림 5: 외 인 성 주입 CNTF는 심장에 있는 몇몇 생물학 과정을 자극 합니다. (A) 실험 설계의 계획. 먼저, 제 브라 피시 CNTF 또는 대조 면역 글로불린의 250 ng를 함유 하는 용액의 2.5 µ L을 심근 세포로에서 핵 DsRed2 발현 하는 형질 전환 어류의 심 낭 내로 주입 하였다. 하트는 7 및 1 일 후 주사 (dpi)에 수집 하 고 면역 형광 및 현장 혼성 화에 의해 각각 분석 하였다. (D&B) 제어 및 CNTF 주입 마음의 심 실 섹션의 공초점 현미경 이미지. (B) 세포 주기 마커에 대 한 면역 염색, minichromosome 일부 유지 보수 복합 성분 5 (MCM5; 녹색)은 외 인 성 CNTF에 반응 하 여 더 많은 증식 심근 세포로을 보여준다. 스케일 바 = 500 µm 콜라겐에대 한 면역 염색은 CNTF 주입 후 심근에서 콜라겐 xii의 증 착을 증가 보여준다. 제어 심장에서, 콜라겐 XII는 미식가34에 국한 된다. 스케일 바 = 500 µm 면역 세포마커 L-plastin에 대 한 면역 염색은 CNTF 주입 된 어류에서 면역 세포의 강화 된 모집을 검출 한다. 축척 막대 = 500 µm. (E) 심 실 횡단면의 밝은 시야 현미경 이미지 시 스타 틴에 대항하는 안티 센스 mRNA 프로브를 사용한 혼성 화, 심장 보호 인자,이 유전자의 전사 상향 조절을 심 혼에 표시 CNTF 주입 생선의. 축척 막대 = 500 µm. 이 수치는 비 세 외24에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Discussion

여기서, 우리는 성인 제 브라 피시에서 심장에 미치는 영향을 연구 하기 위해 외 인 성 화합물과 단백질을 심 막 캐비티에 전달 하는 방법을 설명 합니다. 절차는 흉부 내 주사를 기반으로 하며,이는 장기 부근에서 소량의 용액을 전달 하는 결과를 초래 합니다. 이 기술은 심장 프리 컨디셔닝 및 재생을 연구 하기 위해 개발 및 기술 되었다.

이 절차의 중요 한 단계는 유리 모 세관을 흉 강 내로 침투 하는 것입니다. 이 단계는 세 가지 매개 변수에 따라 달라 집니다: 모 세관 팁의 강성과 선명도, 관통 각도, 펑크 부위. 피부를 통한 침투를 최적화 하기 위해 모 세관의 당겨 지는 부분은 너무 유연 하 고 피부와 접촉 하 여 구부러질 수 있으므로 너무 길지 않아야 합니다. 이를 방지 하기 위해, 강성은 창포 절제술가 위를 사용 하 여 팁 크기를 줄여 조정할 수 있습니다. 침투 각도는 30 °와 45 ° 사이에서 다양할 수 있지만, 팁의 강성에 맞게 조정할 수 있습니다. 실제로 얇은 팁은 더 좁은 각도로 피부에 더 잘 침투 합니다.

바늘 관통을 최적화 하기 위해 삽입 부위는 심 박동 바로 위에 있어야 합니다. 심장 천자의 위험은 일반적으로 5 ~ 8%의 낮은 범위입니다. 심 혼에 바늘 후부의 삽입은 향상 한 출혈에 의해 보인 심 혼 천자의 리스크를 증가 합니다. 이러한 경우에, 동물 실험에서 제거 되어야 한다.

IT 주입 중에 또 다른 문제의 원인이 모 세관 수준에서 발생 합니다. 실제로 모 세관은 횡 력이가 해 졌을 때 깨질 수 있습니다. 이를 방지 하기 위해 바늘은 주사 축을 따라 직선으로 이동 해야 합니다. 때때로, 모 세관은 액체가 흐르는 것을 막는 조직 잔류물에 의해 막힐 수 있습니다. 주사 하는 동안 팁을 부드럽게 철수 하 여 바늘 차단을 해제할 수 있습니다. 이 흐름을 개선 하지 않는 경우, 우리는 완전히 흉부에서 바늘을 철회 하 고 바늘을 교체 하는 것이 좋습니다.

병 변은 심 낭에서 너무 깊이 삽입 된 바늘에 의해 발생할 수 있습니다. 심 막 낭에 있는 병 변을 피하기 위하여는, 바늘은 흉부에 너무 많이 (1-2mm) 삽입 되 면 안됩니다. 주입 볼륨이 8 µ L 보다 크면 일부 누수가 관찰 되었습니다.

제 브라 피시에서 심 막 유체의 정확한 구성은 알 수 없습니다. 그러나, 심 막 구멍의 부피는 ~ 10 µ L31에서 추정 된다. 성인 zebrafish 심 실의 부피가 약 1-2mm 인 것을 감안할 때,우리는 그에 따라 심 낭 구멍은 주사 전에 고려 되어야 하는 작은 부피를가지고 있다고 가정 합니다. 우리의 예비 연구에서, 우리는 주입 된 볼륨의 최적의 범위는 0.5와 3 µ l 사이에 있다 결정 2.5-2.8 센티미터 (거리 주 둥이에서 꼬리 peduncle). 이 볼륨은 물고기의 크기에 따라 조정할 수 있습니다. 최대의 주입 5 µ L이 크기의 물고기에 어떤 병 변을 유도 하지 않았다. 그러나, 8 µ L에서 볼륨은 그림 1f에 도시 된 바와 같이 부풀어 오른 내부 출혈을 일으킬 정도로 충분 했다. 이 데이터를 토대로, 우리는 3 µ L 보다 큰 용액의 양이 장기에 신체적, 생리 적 스트레스를 유발할 수 있다고 추정 합니다. 이 제한은 주입 된 용액의 양을 증가 시키는 대신 분자의 높은 농도를 선택할 필요성을 유추 한다.

또 다른 중요 한 요인은 주입 된 용액의 삼 투 성질은 생리 적 범위 내에 있어야 한다. 실제로, 삼투성 스트레스의 위험을 방지 하기 위해, 우리는 주입 매체로 HBSS를 추천 합니다.

제 브라 피시에서 약물을 전달 하는 데 사용 되는 일반적인 방법은 수 처리 및 복 강 내 주입30,35을 통해 서입니다. 이러한 기술 모두 많은 응용 프로그램에 적합 한, 그것은 주사 실험 및 경제적 이점을 제공 합니다, 원치 않는 전신 부작용의 위험을 감소 하 고 비용이 많이 드는 분자의 사용을 감소, 각각. 이 방법은 세포 계보 추적 분석에 사용 되는 ERT2 형질 전환 시스템을 활성화 시키기 위해 타 목 시 펜의 전달에 적합할 수 있으며, 재생 연구에서 기능적 연구를 위해 RNAs를 수정 하 여 가이드 한다.

제 브라 피시의 IT 인젝션 방법은 이전에31,36에 설명 되어 있다. 그 보고에서, 흉부 내 주사는 인슐린 바늘, 전방 측에서 천공을 수행 하였다. 대조적으로, 우리의 프로토콜은 후방 방향에서 삽입 된 뽑아 유리 모 세관을 가진 대체 전략을 제시 합니다. 특히, 우리의 접근은 심장 천자의 감소 된 위험으로 주사를 최적화 하기 위해 물고기 심 낭의 해부학을 고려 합니다. 또한, 절차 동안, 물고기는 금속 집게에 의해 개최 되지 않습니다, 하지만 촉촉한 부드러운 스폰지,이는 물고기의 외부 부상을 방지 하기 위해 더 적합 한 방법입니다. 따라서, 제시 된 방법은 성인 제 브라 피시에서 심장 항상성, 전처리 및 재생에 대 한 연구에 더 적합할 수 있습니다.

그것은 이미 포유류 모델 유기 체에서 확립 된 주사. 실제로,이 방법은 또한 인간37,38에서 돼지 및 임상 연구와 실험에 적용 되었다. 쥐에서, 초음파에 의해 유도 된 경 흉부 intramyocardial 주사는 그들의 심장39에 도전 하는 데 사용 되었습니다. 이 문서 내에서 우리는 zebrafish에 대 한 그것의 사용을 완화 하기 위해 자세한 프로토콜을 제안. 이것은 심장 항상성, 사전 컨디셔닝 및 재생 연구에서 유전 접근법을 보완 하기 위해 필드에 특히 유용 합니다.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

훌륭한 기술 지원과 피시 케어를 위한, d. 쾨니히 (프리 부르 대학교) 원고를 비판적으로 판독 하기 위해, d. 크 레 슬 러 (프리 부르 대학교)는 zCNTF 단백질 합성에 도움을 주셔서 감사 합니다. Fonctionnelle 드 리옹) L-플라스 틴 항 체에 대 한 ColXII 항 체 및 p. 마틴 (브리스톨 대학) 제공. 프리 부르 대학의 이미징 코어 시설과 프로 테오 믹스 플랫폼에 감사 드립니다. 이 작품은 스위스 국립 과학 재단, 보조금 번호 310030_179213, 그리고 스위스 헤르츠 Stif퉁 (스위스 심장 재단)에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
Hanks Balanced Salt Solution Gibco by Life technology 14065-056
Iridectomy scissor Roboz Surgical Instruments Co RS-5602
Macroscope (binocular) M400 with Apozoom
Micro-injector femtojet Eppendorf 5247 0034 77
Microloaders femtotips Eppendorf 5242 956.003
Micropipette glass needles type C WPI TW100F-6 thin-wall capillary
Micropipette puller model P-87 Flaming/Brown 20081016 filament box 2.5 mm x 4.5 mm
Sponge any any dim. carved sponge 7cm x 3 cm x 1 cm
Tricaine (Anestethic) Sigma E10521
Dyes and Antibodies Company Catalog Number Comments
anti-Chicken Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Guinea pig Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
anti-Rabbit Cy5 Jackson ImmunoResearch Laboratories Concentration: 1/500
Chicken l-plastin gift from P. Martin, Bristol Concentration: 1/1,000
DAPI Sigma 10236276001 Concentration: 1/2,000 (1µg/ml); 1/100 IT injected
Guinea pig anti-ColXII gift from Florence Ruggerio, Lyon Concentration: 1/500
Phalloidin-Atto-565 (F-actin) Sigma 94072 Concentration: 1/500
Phalloidin-Atto-647 (F-actin) Sigma 95906 Concentration: 1/50 IT injected
Rabbit anti-MCM5 gift from Soojin Ryu, Heidelberg Concentration: 1/500
Stamping Ink 4K Pelikan 1 4k 351 197 Concentration: 1/1
ISH probe primers
Cystatin gene number: ENSDARG00000074425
fw primer: GATTCACTGTCGGGTTTGGG
Rev primer: ATTGGGTCCATGGTGACCTC

DOWNLOAD MATERIALS LIST

References

  1. Tzahor, E., Poss, K. D. Cardiac regeneration strategies: Staying young at heart. Science. 356, (6342), 1035-1039 (2017).
  2. Iismaa, S. E., et al. Comparative regenerative mechanisms across different mammalian tissues. npj Regenerative Medicine. 3, (1), (2018).
  3. Xiang, M. S. W., Kikuchi, K. Endogenous Mechanisms of Cardiac Regeneration. Int Rev Cell Mol Biol. 326, 67-131 (2016).
  4. González-Rosa, J. M., Burns, C. E., Burns, C. G. Zebrafish heart regeneration: 15 years of discoveries. Regeneration. 4, (3), 105-123 (2017).
  5. Jazwinska, A., Sallin, P. Regeneration versus scarring in vertebrate appendages and heart. The Journal of Pathology. 238, (2), 233-246 (2016).
  6. Sehring, I. M., Jahn, C., Weidinger, G. Zebrafish fin and heart: what's special about regeneration? Current Opinion in Genetics & Development. 40, 48-56 (2016).
  7. Rubin, N., Harrison, M. R., Krainock, M., Kim, R., Lien, C. L. Recent advancements in understanding endogenous heart regeneration-insights from adult zebrafish and neonatal mice. Seminars in Cell and Developmental Biology. 58, 34-40 (2016).
  8. Chablais, F., Veit, J., Rainer, G., Jazwinska, A. The zebrafish heart regenerates after cryoinjury-induced myocardial infarction. BMC Developmental Biology. 11, 21 (2011).
  9. Schnabel, K., Wu, C. C., Kurth, T., Weidinger, G. Regeneration of cryoinjury induced necrotic heart lesions in zebrafish is associated with epicardial activation and cardiomyocyte proliferation. PLoS One. 6, (4), e18503 (2011).
  10. Gonzalez-Rosa, J. M., Martin, V., Peralta, M., Torres, M., Mercader, N. Extensive scar formation and regression during heart regeneration after cryoinjury in zebrafish. Development. 138, (9), 1663-1674 (2011).
  11. Poss, K. D., Wilson, L. G., Keating, M. T. Heart regeneration in zebrafish. Science. 298, (5601), 2188-2190 (2002).
  12. Cao, J., Poss, K. D. The epicardium as a hub for heart regeneration. Nature Reviews Cardiology. 15, (10), 631-647 (2018).
  13. Andres-Delgado, L., Mercader, N. Interplay between cardiac function and heart development. Biochim Biophys Acta. 1863, 1707-1716 (2016).
  14. Richardson, R. J. Parallels between vertebrate cardiac and cutaneous wound healing and regeneration. npj Regenerative Medicine. 3, 21 (2018).
  15. Lai, S. -L., Marín-Juez, R., Stainier, D. Y. R. Immune responses in cardiac repair and regeneration: a comparative point of view. Cellular and Molecular Life Sciences. (2018).
  16. Kikuchi, K., et al. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature. 464, (7288), 601-605 (2010).
  17. Jopling, C., et al. Zebrafish heart regeneration occurs by cardiomyocyte dedifferentiation and proliferation. Nature. 464, (7288), 606-609 (2010).
  18. Pfefferli, C., Jaźwińska, A. The careg element reveals a common regulation of regeneration in the zebrafish myocardium and fin. Nature Communications. 8, 15151 (2017).
  19. Sánchez-Iranzo, H., et al. Tbx5a lineage tracing shows cardiomyocyte plasticity during zebrafish heart regeneration. Nature Communications. 9, (1), (2018).
  20. Wang, J., Poss, K. D. Methodologies for Inducing Cardiac Injury and Assaying Regeneration in Adult Zebrafish. Methods In Molecular Medicine. 1451, 225-235 (2016).
  21. Gut, P., Reischauer, S., Stainier, D. Y. R., Arnaout, R. Little Fish, Big Data: Zebrafish as a Model for Cardiovascular and Metabolic Disease. Physiological Reviews. 97, (3), 889-938 (2017).
  22. de Preux Charles, A. S., Bise, T., Baier, F., Marro, J., Jazwinska, A. Distinct effects of inflammation on preconditioning and regeneration of the adult zebrafish heart. Open Biology. 6, (7), (2016).
  23. de Preux Charles, A. S., Bise, T., Baier, F., Sallin, P., Jazwinska, A. Preconditioning boosts regenerative programmes in the adult zebrafish heart. Open Biology. 6, (7), (2016).
  24. Bise, T., de Preux Charles, A. S., Jazwinska, A. Ciliary neurotrophic factor stimulates cardioprotection and the proliferative activity in the zebrafish adult heart. npj Regenerative Medicine. 4, (2019).
  25. Thorimbert, V., Konig, D., Marro, J., Ruggiero, F., Jazwinska, A. Bone morphogenetic protein signaling promotes morphogenesis of blood vessels, wound epidermis, and actinotrichia during fin regeneration in zebrafish. The FASEB Journal. 29, (10), 4299-4312 (2015).
  26. König, D., Page, L., Chassot, B., Jaźwińska, A. Dynamics of actinotrichia regeneration in the adult zebrafish fin. Developmental Biology. 433, (2), 416-432 (2018).
  27. Sallin, P., Jaźwińska, A. Acute stress is detrimental to heart regeneration in zebrafish. Open Biology. 6, (3), 160012 (2016).
  28. Mokalled, M. H., Poss, K. D. A Regeneration Toolkit. Developmental Cell. 47, (3), 267-280 (2018).
  29. Pugach, E. K., Li, P., White, R., Zon, L. Retro-orbital Injection in Adult Zebrafish. Journal of Visualized Experiments. (34), e1645 (2009).
  30. Kinkel, M. D., Eames, S. C., Philipson, L. H., Prince, V. E. Intraperitoneal Injection into Adult Zebrafish. Journal of Visualized Experiments. (42), (2010).
  31. Xiao, C., et al. Nanoparticle-mediated siRNA Gene-silencing in Adult Zebrafish Heart. Journal of Visualized Experiments. (137), (2018).
  32. Chablais, F., Jazwinska, A. Induction of myocardial infarction in adult zebrafish using cryoinjury. Journal of Visualized Experiments. (62), (2012).
  33. Gonzalez-Rosa, J. M., Mercader, N. Cryoinjury as a myocardial infarction model for the study of cardiac regeneration in the zebrafish. Nature Protocols. 7, (4), 782-788 (2012).
  34. Marro, J., Pfefferli, C., de Preux Charles, A. S., Bise, T., Jazwinska, A. Collagen XII Contributes to Epicardial and Connective Tissues in the Zebrafish Heart during Ontogenesis and Regeneration. PLoS One. 11, (10), e0165497 (2016).
  35. Ma, X., Ding, Y., Wang, Y., Xu, X. A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish. Journal of Visualized Experiments. (136), (2018).
  36. Diao, J., et al. PEG-PLA nanoparticles facilitate siRNA knockdown in adult zebrafish heart. Developmental Biology. 406, (2), 196-202 (2015).
  37. Lloyd, L. C., Etheridge, J. R. The pathological and serological response induced in pigs by parenteral inoculation of Mycoplasma hyopneumoniae. Journal of Comparative Pathology. 91, (1), 77-83 (1981).
  38. Zhou, A., Guo, L., Tang, L. Effect of an intrathoracic injection of sodium hyaluronic acid on the prevention of pleural thickening in excess fluid of tuberculous thoracic cavity. Clinical and Experimental Pharmacology and Physiology. 30, (3), 203-205 (2003).
  39. Prendiville, T. W., et al. Ultrasound-guided Transthoracic Intramyocardial Injection in Mice. Journal of Visualized Experiments. (90), (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics