JoVE Visualize What is visualize?
Stop Reading. Start Watching.
Advanced Search
Stop Reading. Start Watching.
Regular Search
Find video protocols related to scientific articles indexed in Pubmed.
Self-assembly of NIR luminescent 30-metal drum-like and 12-metal rectangular d-f nanoclusters with long-chain Schiff base ligands.
Chem. Commun. (Camb.)
PUBLISHED: 10-30-2014
Show Abstract
Hide Abstract
Two classes of heterobimetallic d-f nanoclusters [Ln6Cd24(L(1))11(OAc)43(OH)] and [Ln4Zn8(L(2))2(OAc)20(OH)4] (Ln = Nd and Yb) were prepared using flexible long-chain Schiff base ligands which have (CH2)6 backbones. Their NIR luminescence properties were determined.
Related JoVE Video
Comparison of clinical outcomes of Chinese men and women after coronary stenting for coronary artery disease: a multi-center retrospective analysis of 4,334 patients.
J Biomed Res
PUBLISHED: 10-22-2014
Show Abstract
Hide Abstract
The outcome differences between Chinese male and female patients within one-year follow-up after percutaneous coronary intervention (PCI) with stent remain unclear. The present study was aimed to compare clinical outcomes in such two populations. From May 1999 to December 2009, 4,334 patients with acute myocardial infarction (MI), unstable angina, stable angina, or silent ischemia, who underwent PCI, were registered at our centers. Among these, 3,089 were men and 1,245 were women. We compared these groups with respect to the primary outcomes of MI and secondary outcomes including a composite of major adverse cardiac events (MACE) including cardiac death, MI, target lesion revascularization, target vessel revascularization (TVR), stent thrombosis (ST), definite ST and probable ST at one-year follow-up. Chinese male patients had a higher MACE rate (13% vs. 10.7%, P ?=? 0.039), mainly led by TVR (9.09% vs. 6.98%, P?=?0.024) at one year, which was significantly different than female patients. Chinese male and female patients showed a significant difference on MACEs. However, there was no significant difference with respect to MI between these groups.
Related JoVE Video
Enhancement of 1.53???m emission in erbium/cerium-doped germanosilicate glass pumped by common 808??nm laser diode.
Appl Opt
PUBLISHED: 10-17-2014
Show Abstract
Hide Abstract
Erbium-doped germanosilicate glasses with various cerium ions contents have been prepared. Optical absorption and 1.53 ?m emission spectra were measured to characterize the spectroscopic performances of prepared samples. A detailed study of 1.53 ?m spectroscopic properties was carried out when pumped by an 808 nm laser diode. Moreover, an energy level diagram and an energy transfer mechanism between Er3+ and Ce3+ were proposed to elucidate the enhanced 1.53 ?m fluorescence. It is found that the prepared samples have optimal spectroscopic properties when the Ce3+ concentration is fixed to 0.5 mol. %. High spontaneous radiative transition probability (172.66??s-1), large effective emission bandwidth (74 nm), and emission cross section (9.49×10-21??cm2 indicate that 808 nm pumped Er3+/Ce3+ codoped germanosilicate glass might be a suitable material for a broadband optical amplifier.
Related JoVE Video
Consensus of clinical neurorestorative progresses in patients with complete chronic spinal cord injury.
Cell Transplant
PUBLISHED: 10-11-2014
Show Abstract
Hide Abstract
Currently, there are lack effective therapeutic methods to restore neurological function for chronic complete spinal cord injury (SCI) by conventional treatment. Neurorestorative strategies with positive preclinical results have been translated to the clinic and some patients have gotten benefits and their quality of life has improved. These strategies include cell therapy, neurostimulation or neuromodulation, neuroprosthesis, neurotization or nerve bridging, and neurorehabilitation. The aim of this consensus by thirty one experts from 20 countries is to show the objective evidence of clinical neurorestoration for chronic complete SCI by the above mentioned neurorestorative strategies. Complete chronic SCI patients may no longer be told "nothing can be done". The translation to the clinic of more effective preclinical neurorestorative strategies should be encouraged as fast as possible in order to benefit patients with incurable CNS diseases. This manuscript is published as part of the International Association of Neurorestoratology (IANR) special issue of Cell Transplantation.
Related JoVE Video
[Meilian Xiaoke capsule combined with metformin for protecting islet cells and lowering blood glucose in diabetic rats].
Nan Fang Yi Ke Da Xue Xue Bao
PUBLISHED: 09-30-2014
Show Abstract
Hide Abstract
To study the effects of Meilian Xiaoke capsule (a traditional Chinese medicinal preparation) combined with metformin for protecting islet cells and lowering blood glucose in diabetic rats.
Related JoVE Video
Systematically labeling developmental stage-specific genes for the study of pancreatic ?-cell differentiation from human embryonic stem cells.
Cell Res.
PUBLISHED: 09-05-2014
Show Abstract
Hide Abstract
The applications of human pluripotent stem cell (hPSC)-derived cells in regenerative medicine has encountered a long-standing challenge: how can we efficiently obtain mature cell types from hPSCs? Attempts to address this problem are hindered by the complexity of controlling cell fate commitment and the lack of sufficient developmental knowledge for guiding hPSC differentiation. Here, we developed a systematic strategy to study hPSC differentiation by labeling sequential developmental genes to encompass the major developmental stages, using the directed differentiation of pancreatic ? cells from hPSCs as a model. We therefore generated a large panel of pancreas-specific mono- and dual-reporter cell lines. With this unique platform, we visualized the kinetics of the entire differentiation process in real time for the first time by monitoring the expression dynamics of the reporter genes, identified desired cell populations at each differentiation stage and demonstrated the ability to isolate these cell populations for further characterization. We further revealed the expression profiles of isolated NGN3-eGFP(+) cells by RNA sequencing and identified sushi domain-containing 2 (SUSD2) as a novel surface protein that enriches for pancreatic endocrine progenitors and early endocrine cells both in human embryonic stem cells (hESC)-derived pancreatic cells and in the developing human pancreas. Moreover, we captured a series of cell fate transition events in real time, identified multiple cell subpopulations and unveiled their distinct gene expression profiles, among heterogeneous progenitors for the first time using our dual reporter hESC lines. The exploration of this platform and our new findings will pave the way to obtain mature ? cells in vitro.
Related JoVE Video
Producing more grain with lower environmental costs.
Nature
PUBLISHED: 09-03-2014
Show Abstract
Hide Abstract
Agriculture faces great challenges to ensure global food security by increasing yields while reducing environmental costs. Here we address this challenge by conducting a total of 153 site-year field experiments covering the main agro-ecological areas for rice, wheat and maize production in China. A set of integrated soil-crop system management practices based on a modern understanding of crop ecophysiology and soil biogeochemistry increases average yields for rice, wheat and maize from 7.2 million grams per hectare (Mg ha(-1)), 7.2 Mg ha(-1) and 10.5 Mg ha(-1) to 8.5 Mg ha(-1), 8.9 Mg ha(-1) and 14.2 Mg ha(-1), respectively, without any increase in nitrogen fertilizer. Model simulation and life-cycle assessment show that reactive nitrogen losses and greenhouse gas emissions are reduced substantially by integrated soil-crop system management. If farmers in China could achieve average grain yields equivalent to 80% of this treatment by 2030, over the same planting area as in 2012, total production of rice, wheat and maize in China would be more than enough to meet the demand for direct human consumption and a substantially increased demand for animal feed, while decreasing the environmental costs of intensive agriculture.
Related JoVE Video
Guided bone regeneration with tripolyphosphate cross-linked asymmetric chitosan membrane.
J Dent
PUBLISHED: 09-02-2014
Show Abstract
Hide Abstract
The objective of this study was to prepare a novel asymmetric chitosan guided bone regeneration (GBR) membrane, which is composed of a dense layer isolating the bone defect from the invasion of surrounding connective fibrous tissue and a loose layer which can improve cell adhesion and stabilize blood clots, thus guided bone regeneration.
Related JoVE Video
[Effect of N-acetylcysteine on intestinal injury induced by cardiopulmonary bypass in rats].
Nan Fang Yi Ke Da Xue Xue Bao
PUBLISHED: 09-02-2014
Show Abstract
Hide Abstract
To observe the effect of N-acetylcysteine (NAC) on intestine injury induced by cardiopulmonary bypass (CPB) in rats.
Related JoVE Video
Enantioselective Synthesis of Chiral Isotopomers of 1-Alkanols by a ZACA-Cu-Catalyzed Cross-Coupling Protocol.
Chemistry
PUBLISHED: 08-29-2014
Show Abstract
Hide Abstract
Chiral compounds arising from the replacement of hydrogen atoms by deuterium are very important in organic chemistry and biochemistry. Some of these chiral compounds have a non-measurable specific rotation, owing to very small differences between the isotopomeric groups, and exhibit cryptochirality. This particular class of compounds is difficult to synthesize and characterize. Herein, we present a catalytic and highly enantioselective conversion of terminal alkenes to various ? and more remote chiral isotopomers of 1-alkanols, with ?99?% enantiomeric excess (ee), by the Zr-catalyzed asymmetric carboalumination of alkenes (ZACA) and Cu-catalyzed cross-coupling reactions. ZACA-in?situ iodinolysis of allyl alcohol and ZACA-in?situ oxidation of TBS-protected ?-alkene-1-ols protocols were applied to the synthesis of both (R)- and (S)-difunctional intermediates with 80-90?% ee. These intermediates were readily purified to provide enantiomerically pure (?99?% ee) compounds by lipase-catalyzed acetylation. These functionally rich intermediates serve as very useful synthons for the construction of various chiral isotopomers of 1-alkanols in excellent enantiomeric purity (?99?% ee) by introducing deuterium-labeled groups by Cu-catalyzed cross-coupling reactions without epimerization.
Related JoVE Video
Association study of TPH2 polymorphisms and bipolar disorder in the Han Chinese population.
Prog. Neuropsychopharmacol. Biol. Psychiatry
PUBLISHED: 08-21-2014
Show Abstract
Hide Abstract
Bipolar disorder (BPD) is a serious and common mental disorder with high heritability. The serotonergic system is known to be implicated in the etiology of the disorder. Tryptophan hydroxylase isoform-2 (TPH2), which controls the synthesis of serotonin in the brain, has been suggested as a candidate gene for BDP. The aim of this study was to examine the association between the polymorphisms in TPH2 and BPD.
Related JoVE Video
[Comparison of total disc replacement versus fusion for lumbar degenerative disc disease: a Meta-analysis of randomized controlled trials].
Zhonghua Wai Ke Za Zhi
PUBLISHED: 07-19-2014
Show Abstract
Hide Abstract
To compare the related clinical outcomes of total disc replacement (TDR) versus fusion in management of lumbar degenerative disc disease (LDDD)and provid available basis for choice of surgical procedure.
Related JoVE Video
[Effects of pyrroloquinoline quinine on oxidative stress-induced apoptosis of Schwann cells and its mechanism].
Zhonghua Zheng Xing Wai Ke Za Zhi
PUBLISHED: 06-20-2014
Show Abstract
Hide Abstract
To investigate the effects of Pyrroloquinoline quinine (PQQ) on hydrogen peroxide-induced apoptosis of Schwann cells (SCs) and its mechanism.
Related JoVE Video
Mid-infrared fluorescence, energy transfer process and rate equation analysis in Er(3+) doped germanate glass.
Sci Rep
PUBLISHED: 05-30-2014
Show Abstract
Hide Abstract
Er(3+) doped Y2O3 and Nb2O5 modified germanate glasses with different Er(3+) concentrations were prepared. J-O intensity parameters were computed to estimate the structural changes due to the additions of Y2O3 and Nb2O5. The main mid-infrared spectroscopic features were investigated. To shed light on the observed mid-infrared radiative behavior, 975?nm and 1.53??m emission spectra along with their decay lifetimes were also discussed. Moreover, the energy transfer processes of (4)I11/2 and (4)I13/2 level were quantitatively analyzed. In view of the experimental lifetimes, the simplified rate equation was utilized to calculate the energy transfer upconversion processes of upper and lower laser level of 2.7??m emission. The theoretical calculations are in good agreement with the observed 2.7??m fluorescence phenomena. Finally, the stimulated emission and gain cross sections were calculated and the results indicate that Er(3+) doped germanate glasses have great potential for mid-infrared application.
Related JoVE Video
Highly enantioselective synthesis of ?-, ?-, and ?-chiral 1-alkanols via Zr-catalyzed asymmetric carboalumination of alkenes (ZACA)-Cu- or Pd-catalyzed cross-coupling.
Proc. Natl. Acad. Sci. U.S.A.
PUBLISHED: 05-27-2014
Show Abstract
Hide Abstract
Despite recent advances of asymmetric synthesis, the preparation of enantiomerically pure (?99% ee) compounds remains a challenge in modern organic chemistry. We report here a strategy for a highly enantioselective (?99% ee) and catalytic synthesis of various ?- and more-remotely chiral alcohols from terminal alkenes via Zr-catalyzed asymmetric carboalumination of alkenes (ZACA reaction)-Cu- or Pd-catalyzed cross-coupling. ZACA-in situ oxidation of tert-butyldimethylsilyl (TBS)-protected ?-alkene-1-ols produced both (R)- and (S)-?,?-dioxyfunctional intermediates (3) in 80-88% ee, which were readily purified to the ?99% ee level by lipase-catalyzed acetylation through exploitation of their high selectivity factors. These ?,?-dioxyfunctional intermediates serve as versatile synthons for the construction of various chiral compounds. Their subsequent Cu-catalyzed cross-coupling with various alkyl (primary, secondary, tertiary, cyclic) Grignard reagents and Pd-catalyzed cross-coupling with aryl and alkenyl halides proceeded smoothly with essentially complete retention of stereochemical configuration to produce a wide variety of ?-, ?-, and ?-chiral 1-alkanols of ?99% ee. The M?NP ester analysis has been applied to the determination of the enantiomeric purities of ?- and ?-chiral primary alkanols, which sheds light on the relatively undeveloped area of determination of enantiomeric purity and/or absolute configuration of remotely chiral primary alcohols.
Related JoVE Video
Full-scale blending treatment of fresh MSWI leachate with municipal wastewater in a wastewater treatment plant.
Waste Manag
PUBLISHED: 05-26-2014
Show Abstract
Hide Abstract
Fresh leachate, generated in municipal solid waste incineration (MSWI) plants, contains various pollutants with extremely high strength organics, which usually requires expensive and complex treatment processes. This study investigated the feasibility of blending treatment of MSWI leachate with municipal wastewater. Fresh MSWI leachate was pretreated by coagulation-flocculation with FeCl3 2 g/L and CaO 25 g/L, plate-and-frame filter press, followed by ammonia stripping at pH above 12. After that, blending treatment was carried out in a full-scale municipal wastewater treatment plant (WWTP) for approximately 3 months. Different operational modes consisting of different pretreated leachate and methanol addition levels were tested, and their performances were evaluated. Results showed that throughout the experimental period, monitored parameters in the WWTP effluent, including COD (<60 mg/L), BOD5 (<20 mg/L), ammonium (<8 mg/L), phosphorus (<1.5 mg/L) and heavy metals, generally complied with the Chinese sewage discharged standard. Under the experimental conditions, a certain amount of methanol was needed to fulfill TN removal. An estimation of the operation cost revealed that the expenditure of blending treatment was much lower than the total costs of respective treatment of MSWI leachate and municipal wastewater. The outcomes indicated that blending treatment could not only improve the treatability of the MSWI leachate, but also reduce the treatment cost of the two different wastewaters.
Related JoVE Video
Biological evaluation of halogenated thiazolo[3,2-a]pyrimidin-3-one carboxylic acid derivatives targeting the YycG histidine kinase.
Eur J Med Chem
PUBLISHED: 05-20-2014
Show Abstract
Hide Abstract
With an intention to potent inhibitors of YycG histidine kinase, a series of halogenated thiazolo[3,2-a]pyrimidin-3-one carboxylic acid derivatives were synthesized and evaluated for their antibacterial, antibiofilm and hemolytic activities. The majority of the compounds showed good activity against Staphylococcus epidermidis and Staphylococcus aureus, with MIC values of 1.56-6.25 ?M, simultaneously presented promising antiobifilm activity against S. epidermidis ATCC35984 at 50 ?M. The test of inhibitory activity on YycG kinase suggested the antibacterial activities of these derivatives are based on inhibiting the enzyme activity of the YycG HK domain. The hemolytic activity test suggested these compounds exhibited in vitro antibacterial activity at non-hemolytic concentrations.
Related JoVE Video
Necrotizing Esophagitis and Bleeding Associated With Cefazolin.
Ann Pharmacother
PUBLISHED: 05-20-2014
Show Abstract
Hide Abstract
To report the case of a patient who presented with rare necrotizing esophagitis related to cefazolin-associated coagulopathy. A review of the literature is also provided.
Related JoVE Video
Numerical well testing interpretation model and applications in crossflow double-layer reservoirs by polymer flooding.
ScientificWorldJournal
PUBLISHED: 05-19-2014
Show Abstract
Hide Abstract
This work presents numerical well testing interpretation model and analysis techniques to evaluate formation by using pressure transient data acquired with logging tools in crossflow double-layer reservoirs by polymer flooding. A well testing model is established based on rheology experiments and by considering shear, diffusion, convection, inaccessible pore volume (IPV), permeability reduction, wellbore storage effect, and skin factors. The type curves were then developed based on this model, and parameter sensitivity is analyzed. Our research shows that the type curves have five segments with different flow status: (I) wellbore storage section, (II) intermediate flow section (transient section), (III) mid-radial flow section, (IV) crossflow section (from low permeability layer to high permeability layer), and (V) systematic radial flow section. The polymer flooding field tests prove that our model can accurately determine formation parameters in crossflow double-layer reservoirs by polymer flooding. Moreover, formation damage caused by polymer flooding can also be evaluated by comparison of the interpreted permeability with initial layered permeability before polymer flooding. Comparison of the analysis of numerical solution based on flow mechanism with observed polymer flooding field test data highlights the potential for the application of this interpretation method in formation evaluation and enhanced oil recovery (EOR).
Related JoVE Video
Chlorination and chloramination of tetracycline antibiotics: disinfection by-products formation and influential factors.
Ecotoxicol. Environ. Saf.
PUBLISHED: 05-08-2014
Show Abstract
Hide Abstract
Formation of disinfection by-products (DBPs) from chlorination and chloramination of tetracycline antibiotics (TCs) was comprehensively investigated. It was demonstrated that a connection existed between the transformation of TCs and the formation of chloroform (CHCl3), carbon tetrachloride (CCl4), dichloroacetonitrile (DCAN) and dichloroacetone (DCAce). Factors evaluated included chlorine (Cl2) and chloramine(NH2Cl) dosage, reaction time, solution pH and disinfection modes. Increased Cl2/NH2Cl dosage and reaction time improved the formation of CHCl3 and DCAce. Formation of DCAN followed an increasing and then decreasing pattern with increasing Cl2 dosage and prolonged reaction time. pH affected DBPs formation differently, with CHCl3 and DCAN decreasing in chlorination, and having maximum concentrations at pH 7 in chloramination. The total concentrations of DBPs obeyed the following order: chlorination>chloramination>pre-chlorination (0.5h)>pre-chlorination (1h)>pre-chlorination (2h).
Related JoVE Video
Antioxidative properties of 4-methylumbelliferone are related to antibacterial activity in the silkworm (Bombyx mori) digestive tract.
J. Comp. Physiol. B, Biochem. Syst. Environ. Physiol.
PUBLISHED: 04-21-2014
Show Abstract
Hide Abstract
Umbelliferones have gained significant attention due to their tumor-inhibitory effects in vitro. This study was undertaken to examine the impact of umbelliferones in an invertebrate model organism, Bombyx mori, to assess the underlying antimicrobial activities via antioxidation in vivo. Oral administration of 4 mM 4-methylumbelliferone (4-MU), a model umbelliferone drug, in B. Mori larvae caused a rapid increase in reactive oxygen species, such as hydrogen peroxide (H2O2) and antimicrobial activity in the digestive tract. In addition, a significant increase in total antioxidant capacity as well as superoxide anion radical-inhibiting activity and reduced glutathione were detected. The antioxidant defense system was activated following induction of H2O2, resulting in a significant rise in catalase (50-66 %) and glutathione peroxidase (175 %) activities, which were helpful in defending digestive tract cells against oxidative injury. These results help in understanding the anticancer mechanism of 4-MU based on its antioxidation in organisms.
Related JoVE Video
On-line reaction monitoring and mechanistic studies by mass spectrometry: Negishi cross-coupling, hydrogenolysis, and reductive amination.
Angew. Chem. Int. Ed. Engl.
PUBLISHED: 04-17-2014
Show Abstract
Hide Abstract
Reaction monitoring using inductive ESI mass spectrometry allows chemical reactions to be tracked in real time, including air- and moisture-sensitive as well as heterogeneous reactions. Highly concentrated solutions can also be monitored for long periods without emitter clogging. Sheath gas assists in nebulization and a sample splitter reduces the delay time and minimizes contamination of the instrument. Short-lived intermediates (ca.?5?s) were observed in Pd/C-catalyzed hydrogenolysis, and several intermediates were seen in Negishi cross-coupling reactions.
Related JoVE Video
[Risk evaluation of schistosomiasis japonica input to potential endemic areas in Anhui province].
Zhonghua Yu Fang Yi Xue Za Zhi
PUBLISHED: 04-10-2014
Show Abstract
Hide Abstract
To analyze the impact of water transfer project from the Yangtze River to the Huaihe River on schistisomiasis transmission, and to evaluate the risk of the disease input to the potential endemic area in Anhui Province, namely the Chaohu Lake region.
Related JoVE Video
Chronic Digoxin Toxicity Precipitated by Dronedarone.
Ann Pharmacother
PUBLISHED: 03-31-2014
Show Abstract
Hide Abstract
To report the case of a patient who presented with chronic symptoms attributable to dronedarone-induced digoxin toxicity. A review of the literature is also provided.
Related JoVE Video
Isolation and characterization of a cryptogein-like gene from drought and salt-treated Alternanthera philoxeroides roots.
Biotechnol. Lett.
PUBLISHED: 03-19-2014
Show Abstract
Hide Abstract
Alligator weed, Alternanthera philoxeroides (Mart.) Grisb, is an amphibious plant with long thick fleshy roots that develop from adventitious roots under drought conditions. To clone differentially-expressed genes from the roots of A. philoxeroides we applied both mRNA differential display and rapid amplification of cDNA ends techniques. A cryptogein-like gene of A. philoxeroides, designated as ApCL, was cloned. On the basis of semi-quantitative RT-PCR analysis results, we demonstrated that the ApCL gene was upregulated under drought and salt stress conditions. After ApCL was transferred to Pichia pastoris GS115 and its resistance to drought and salt then increased by >100 %. Therefore, the ApCL gene of A. philoxeroides was likely involved in drought and salt tolerance responses.
Related JoVE Video
Radical induced degradation of acetaminophen with Fe3O4 magnetic nanoparticles as heterogeneous activator of peroxymonosulfate.
J. Hazard. Mater.
PUBLISHED: 03-12-2014
Show Abstract
Hide Abstract
Magnetic nano-scaled particles Fe3O4 were studied for the activation of peroxymonosulfate (PMS) to generate active radicals for degradation of acetaminophen (APAP) in water. The Fe3O4 MNPs were found to effectively catalyze PMS for removal of APAP, and the reactions well followed a pseudo-first-order kinetics pattern (R(2)>0.95). Within 120min, approximately 75% of 10ppm APAP was accomplished by 0.2mM PMS in the presence of 0.8g/L Fe3O4 MNPs with little Fe(3+) leaching (<4?g/L). Higher Fe3O4 MNP dose, lower initial APAP concentration, neutral pH, and higher reaction temperature favored the APAP degradation. The production of sulfate radicals and hydroxyl radicals was validated through two ways: (1) indirectly from the scavenging tests with scavenging agents, tert-butyl alcohol (TBA) and ethanol (EtOH); (2) directly from the electron paramagnetic resonance (ESR) tests with 0.1M 5,5-dimethyl-1-pyrrolidine N-oxide (DMPO). Plausible mechanisms on the radical generation from Fe3O4 MNP activation of PMS are proposed based on the results of radical identification tests and XPS analysis. It appeared that Fe(2+)Fe(3+) on the catalyst surface was responsible for the radical generation. The results demonstrated that Fe3O4 MNPs activated PMS is a promising technology for water pollution caused by contaminants such as pharmaceuticals.
Related JoVE Video
Efficacy of novel antibacterial compounds targeting histidine kinase YycG protein.
Appl. Microbiol. Biotechnol.
PUBLISHED: 03-11-2014
Show Abstract
Hide Abstract
Treating staphylococcal biofilm-associated infections is challenging. Based on the findings that compound 2 targeting the HK domain of Staphylococcus epidermidis YycG has bactericidal and antibiofilm activities against staphylococci, six newly synthesized derivatives were evaluated for their antibacterial activities. The six derivatives of compound 2 inhibited autophosphorylation of recombinant YycG' and the IC50 values ranged from 24.2 to 71.2 ?M. The derivatives displayed bactericidal activity against planktonic S. epidermidis or Staphylococcus aureus strains in the MIC range of 1.5-3.1 ?M. All the derivatives had antibiofilm activities against the 6- and 24-h biofilms of S. epidermidis. Compared to the prototype compound 2, they had less cytotoxicity for Vero cells and less hemolytic activity for human erythrocytes. The derivatives showed antibacterial activities against clinical methicillin-resistant staphylococcal isolates. The structural modification of YycG inhibitors will assist the discovery of novel agents to eliminate biofilm infections and multidrug-resistant staphylococcal infections.
Related JoVE Video
Synthesis of unsymmetrical imidazolium salts by direct quaternization of N-substituted imidazoles using arylboronic acids.
Chem. Commun. (Camb.)
PUBLISHED: 03-05-2014
Show Abstract
Hide Abstract
Imidazolium salts were conveniently prepared by direct aryl quaternization using arylboronic acids. This process features the tolerance of a broad range of functional groups and excellent chemoselectivity, and is especially effective for the synthesis of unsymmetrical imidazolium salts.
Related JoVE Video
Association of red blood cell transfusion and in-hospital mortality in patients admitted to intensive care unit: a systematic review and meta-analysis.
Crit Care
PUBLISHED: 03-04-2014
Show Abstract
Hide Abstract
IntroductionPrevious research has debated whether red blood cell (RBC) transfusion is associated with decreased or increased mortality in patients admitted to the intensive care unit (ICU). We conducted a systematic review and meta-analysis to assess the relationship of RBC transfusion with in-hospital mortality in ICU patients.MethodsWe carried out a literature search on Medline (1950 through May 2013), Web of Science (1986 through May 2013) and Embase (1980 through May 2013). We included all prospective and retrospective studies on the association between RBC transfusion and in-hospital mortality in ICU patients. The relative risk for the overall pooled effects was estimated by random effect model. Sensitivity analyses were conducted to assess potential bias.ResultsThe meta-analysis included 28,797 participants from 18 studies. The pooled relative risk for transfused versus non-transfused ICU patients was 1.431 (95% CI, 1.105 to 1.854). In sensitivity analyses, the pooled relative risk was 1.211 (95% CI, 0.975 to 1.505) if excluding studies without adjustment for confounders, 1.178 (95% CI, 0.937 to 1.481) if excluding studies with relative high risk of bias, and 0.901 (95% CI, 0.622 to 1.305) if excluding studies without reporting hazard ratio (HR) or relative risk (RR) as an effect size measure. Subgroup analyses revealed increased risks in studies enrolling patients from all ICU admissions (RR 1.513, 95%CI 1.123 to 2.039), studies without reporting information on leukoreduction (RR 1.851, 95%CI 1.229 to 2.786), studies reporting unadjusted effect estimates (RR 3.933, 95%CI 2.107 to 7.343), and studies using Odds ratio as an effect measure (RR 1.465, 95%CI 1.049 to 2.045). Meta-regression analyses showed that RBC transfusion could decrease risk of mortality in older patients (slope coefficient ¿0.0417, 95%CI ¿0.0680 to ¿0.0154).ConclusionsThere is lack of strong evidence to support the notion that ICU patients with RBC transfused have an increased risk of in-hospital death. In studies adjusted for confounders, we found that RBC transfusion does not increase the risk of in-hospital mortality in ICU patients. Type of patient, information on leukoreduction, statistical method, mean age of patient enrolled and publication year of the article may account for the disagreement between previous studies.
Related JoVE Video
Transcriptome analysis of the Bombyx mori fat body after constant high temperature treatment shows differences between the sexes.
Mol. Biol. Rep.
PUBLISHED: 02-25-2014
Show Abstract
Hide Abstract
Ambient temperature plays a large role in insect growth, development and even their distribution. The elucidation of the associated molecular mechanism that underlies the effect of constant high temperature will enables us to further understand the stress responses. We constructed four digital gene expression libraries from the fat body of female and male Bombyx mori. Differential gene expression was analyzed after constant high temperature treatment. The results showed that there were significant changes to the gene expression in the fat body after heat treatment, especially in binding, catalytic, cellular and metabolic processes. Constant high temperature may induce more traditional cryoprotectants, such as glycerol, glycogen, sorbitol and lipids, to protect cells from damage, and induce heat oxidative stress in conjunction with the heat shock proteins. The data also indicated a difference between males and females. The heat shock protein-related genes were up-regulated in both sexes but the expression of Hsp25.4 and DnaJ5 were down-regulated in the male fat body of B. mori. This is the first report of such a result. Constant high temperature also affected the expression of other functional genes and differences were observed between male and female fat bodies in the expression of RPS2, RPL37A and MREL. These findings provide abundant data on the effect of high temperature on insects at the molecular level. The data will also be beneficial to the study of differences between the sexes, manifested in variations in gene expression under high temperature.
Related JoVE Video
Astrocyte transplantation for spinal cord injury: current status and perspective.
Brain Res. Bull.
PUBLISHED: 02-22-2014
Show Abstract
Hide Abstract
Spinal cord injury (SCI) often causes incurable neurological dysfunction because axonal regeneration in adult spinal cord is rare. Astrocytes are gradually recognized as being necessary for the regeneration after SCI as they promote axonal growth under both physiological and pathophysiological conditions. Heterogeneous populations of astrocytes have been explored for structural and functional restoration. The results range from the early variable and modest effects of immature astrocyte transplantation to the later significant, but controversial, outcomes of glial-restricted precursor (GRP)-derived astrocyte (GDA) transplantation. However, the traditional neuron-centric view and the concerns about the inhibitory roles of astrocytes after SCI, along with the sporadic studies and the lack of a comprehensive review, have led to some confusion over the usefulness of astrocytes in SCI. It is the purpose of the review to discuss the current status of astrocyte transplantation for SCI based on a dialectical view of the context-dependent manner of astrocyte behavior and the time-associated characteristics of glial scarring. Critical issues are then analyzed to reveal the potential direction of future research.
Related JoVE Video
Treatment of symptomatic fusiform aneurysm in basilar artery by stenting following coiling technique.
Turk Neurosurg
PUBLISHED: 02-19-2014
Show Abstract
Hide Abstract
The present stent-assisted coil technique has many limitations especially in treating fusiform aneurysms. We aimed to introduce stenting following coiling technique to treat fusiform aneurysms.
Related JoVE Video
Tunable mid-infrared luminescence from Er(3+) -doped germanate glass.
Luminescence
PUBLISHED: 02-13-2014
Show Abstract
Hide Abstract
Er(3+) -doped germanate glasses with superior thermal stability were prepared. Judd-Ofelt intensity parameters and important spectroscopic properties were discussed in detail. Upon 800 nm and 980 nm LD pumping, 2.7 µm fluorescence characteristics were investigated and it was found that the effective 2.7 µm emission bandwidth can reach to 101.79 nm in prepared glasses. The tunability of the 2.7 µm emission band can be realized by adjusting the Er(3+) content. Moreover, a high-emission cross-section (11.09 ×10(-21) cm(2) ), large gain bandwidth (772.30 ×10(-28) cm(3) ) and gain coefficient (6.72 cm(-1) ) were obtained in the prepared sample. Hence, Er(3+) -doped germanate glass might be a promising mid-infrared material for tunable amplifiers or lasers. Copyright © 2014 John Wiley & Sons, Ltd.
Related JoVE Video
Chitin synthase A: a novel epidermal development regulation gene in the larvae of Bombyx mori.
Mol. Biol. Rep.
PUBLISHED: 02-13-2014
Show Abstract
Hide Abstract
Chitin synthase is the key regulatory enzyme for chitin synthesis and excretion in insects, as well as a specific target of insecticides. The chitin synthase A gene (BmChsA) cloned from Bombyx mori, the model species of lepidopteran, is an epidermis-specific expressed gene during the molting stage. Knockdown BmChsA gene in 3rd instar larvae increased the number of non-molting and abnormal molting larvae. Exposure to nikkomycin Z, a chitin synthase inhibitor downregulated the expression of BmChsA and decreased the amount of epidermis chitin during the molting process. The thickness of the new epidermis and its dense structure varied greatly. The exogenous hormones significantly upregulated the expression of BmChsA with low levels of endogenous MH and high levels of endogenous JH immediately after molting. With low levels of endogenous hormones during the mulberry intake process, BmChsA was rarely upregulated by exogenous hormones. With high levels of endogenous MH and low levels of endogenous JH during the molting stage, we did not detect the upregulation of BmChsA by exogenous hormones. The expression of BmChsA was regulated by endocrine hormones, which directly affected the chitin synthesis-dependent epidermal regeneration and molting process.
Related JoVE Video
TRIB3 alters endoplasmic reticulum stress-induced ?-cell apoptosis via the NF-?B pathway.
Metab. Clin. Exp.
PUBLISHED: 02-06-2014
Show Abstract
Hide Abstract
To examine the effect of TRIB3 on endoplasmic reticulum stress induced ?-cell apoptosis and to investigate the mechanism with a specific emphasis on the role of NF-?B pathway.
Related JoVE Video
Protective effect of carboxymethylated chitosan on hydrogen peroxide-induced apoptosis in nucleus pulposus cells.
Mol Med Rep
PUBLISHED: 02-01-2014
Show Abstract
Hide Abstract
Although the etiology of intervertebral disc degeneration is poorly understood, one approach to prevent this process may be to inhibit apoptosis. In the current study, the anti?apoptotic effects of carboxymethylated chitosan (CMCS) in nucleus pulposus (NP) cells were investigated with the aim to enhance disc cell survival. Rat NP cells were isolated and cultured in vitro, and hydrogen peroxide (H2O2) was used to build the NP cell apoptosis model. Cell viability was assessed with a cell counting kit?8 assay. The ratio of apoptotic cells was surveyed by annexin V?fluorescein isothiocyanate (FITC) and propidium iodide (PI) double staining analysis, and the morphology was observed by Hoechst 33342 staining. The mitochondrial membrane potential of NP cells was evaluated by rhodamine 123 fluorescence staining. Reverse transcription (RT)?quantitative polymerase chain reaction (qPCR) was performed to measure mRNA levels of inducible nitric oxide synthase (iNOS), caspase?3, B?cell lymphoma (Bcl)?2, type II collagen and aggrecan. Western blot analysis was performed to detect protein levels of iNOS and Bcl?2. The annexin V?FITC/PI and Hoechst 33342 staining results indicated that CMCS was able to prevent NP cells from apoptosis in a dose?dependent manner. Rhodamine 123 staining clarified that CMCS reduced the impairment of the mitochondrial membrane potential in H2O2?treated NP cells. Reduced caspase?3 and increased Bcl?2 activity were detected in CMCS?treated NP cells by RT?qPCR and western blot analysis. CMCS also promoted the proliferation and secretion of type II collagen and aggrecan in H2O2?treated NP cells. CMCS was indicated to be effective in preventing apoptotic cell death in vitro, demonstrating the potential advantages of this therapeutic approach in regulating disc degeneration.
Related JoVE Video
Surgical strategies for ossified ligamentum flavum associated with dural ossification in thoracic spinal stenosis.
J Clin Neurosci
PUBLISHED: 01-31-2014
Show Abstract
Hide Abstract
We describe two surgical strategies for treating thoracic spinal stenosis (TSS) with ossification of the ligamentum flavum (OLF) and dural ossification (DO), and discuss their postoperative efficacy. From January 2004 to June 2008, 147 patients underwent TSS surgery. Thirty three of those with intraoperative evidence of OLF and DO were included in the present study. Based on the different intraoperative treatment of the dura, these 33 patients were divided into two groups: Group A, 17 patients who had their dura slit and the ossification excised, and Group B, 16 patients treated by floating the ossified dura by thinning it with a drill. All patients underwent outpatient follow-up. Pre- and postoperative Japanese Orthopaedic Association (JOA) scores and recovery rates were evaluated. The mean follow-up period was 42months. The incidence of DO with OLF in TSS was 22%. At 1 year follow-up, the mean JOA score improved from 5.12±1.17 to 6.94±0.90 in Group A and from 5.25±1.34 to 7.13±1.41 in Group B. Additionally, the mean JOA score improved from 5.18±1.24 to 7.03±1.16 in TSS patients with DO and from 5.52±1.21 to 7.21±1.18 in TSS patients without DO. The increased cross-sectional area of the pre- and postoperative dural sac at the level of stenosis suggested that decompression was complete. Both decompression methods are feasible for curing TSS with OLF and DO. Moreover, slitting the dura for ossified dura and ligamentum flavum removal to relax the spinal cord is a safe and reliable method. Even though it increased the surgical difficulties and risks, DO did not affect postoperative neurological recovery.
Related JoVE Video
Effect of chlorine dioxide on cyanobacterial cell integrity, toxin degradation and disinfection by-product formation.
Sci. Total Environ.
PUBLISHED: 01-31-2014
Show Abstract
Hide Abstract
Bench scale tests were conducted to study the effect of chlorine dioxide (ClO2) oxidation on cell integrity, toxin degradation and disinfection by-product formation of Microcystis aeruginosa. The simulated cyanobacterial suspension was prepared at a concentration of 1.0×10(6)cells/mL and the cell integrity was measured with flow cytometry. Results indicated that ClO2 can inhibit the photosynthetic capacity of M. aeruginosa cells and almost no integral cells were left after oxidation at a ClO2 dose of 1.0mg/L. The total toxin was degraded more rapidly with the ClO2 dosage increasing from 0.1mg/L to 1.0mg/L. Moreover, the damage on cell structure after oxidation resulted in released intracellular organic matter, which contributed to the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) as disinfection by-products. Therefore, the use of ClO2 as an oxidant for treating algal-rich water should be carefully considered.
Related JoVE Video
Identification and characterization of a subset of microRNAs in wheat (Triticum aestivum L.).
Genomics
PUBLISHED: 01-29-2014
Show Abstract
Hide Abstract
MicroRNAs (miRNAs) represent a class of endogenous regulator for post-transcriptionally modulating gene expression. Elucidating complete miRNA repertoires for individual species is a long-desired goal in miRNA research. So far only 42 have been annotated for common wheat (Triticum aestivum) due to its large genome. Here, we employed miRDeep-P, a program developed previously for retrieving miRNAs from deep sequencing data in plants, to parse 14 sequenced small RNA libraries of wheat using expression sequence tags (ESTs) as the reference in lieu of a complete genome sequence. This effort identified 145 miRNAs along with the corresponding stem-looped precursors with many differentially expressed in development and associated with powdery mildew infection. Examination of the phylogenetic distribution of these miRNAs and their target genes revealed that many are conserved in monocots. The set of miRNAs identified in this study is thus useful to further miRNA research in wheat and other important cereal crop species.
Related JoVE Video
Broadband near-infrared emission property in Er3+/Ce3+ co-doped silica-germanate glass for fiber amplifier.
Spectrochim Acta A Mol Biomol Spectrosc
PUBLISHED: 01-25-2014
Show Abstract
Hide Abstract
Er(3+) doped and Er(3+)/Ce(3+) co-doped silica-germanate glasses were synthesized by high-temperature melt-quenching technique. A detailed study of the 1.53?m spectroscopic properties and thermal stability was presented in this work. The absorption spectra, 1.53?m emission spectra and fluorescence lifetimes were measured and investigated, along with the quantitative calculations and analyses of Judd-Ofelt intensity parameters, stimulated absorption and emission cross-sections and the product of FWHM×?em(p). It was found that the prepared samples have outstanding thermal stability (Tg=585°C), large FWHM (77nm and 108nm) and high stimulated emission cross-sections (9.55×10(-28)cm(3) and 8.72×10(-28)cm(3)) of Er(3+). The 1.53?m fluorescence intensity improved significantly with the introduction of Ce(3+). Furthermore, the wavelength dependent gain coefficient G(?) of (4)I13/2?(4)I15/2 transition of Er(3+) was determined by means of the absorption and emission cross-sections. The results indicate that the developed glass co-doped with Er(3+)/Ce(3+) is a promising gain medium applied for broadband amplifier pumped with a 980nm laser diode.
Related JoVE Video
Sensitive pseudobienzyme electrocatalytic DNA biosensor for mercury(II) ion by using the autonomously assembled hemin/G-quadruplex DNAzyme nanowires for signal amplification.
Anal. Chim. Acta
PUBLISHED: 01-25-2014
Show Abstract
Hide Abstract
Herein, a novel sensitive pseudobienzyme electrocatalytic DNA biosensor was proposed for mercury ion (Hg(2+)) detection by using autonomously assembled hemin/G-quadruplex DNAzyme nanowires for signal amplification. Thiol functionalized capture DNA was firstly immobilized on a nano-Au modified glass carbon electrode (GCE). In presence of Hg(2+), the specific coordination between Hg(2+) and T could result in the assembly of primer DNA on the electrode, which successfully triggered the HCR to form the hemin/G-quadruplex DNAzyme nanowires with substantial redox probe thionine (Thi). In the electrolyte of PBS containing NADH, the hemin/G-quadruplex nanowires firstly acted as an NADH oxidase to assist the concomitant formation of H2O2 in the presence of dissolved O2. Then, with the redox probe Thi as electron mediator, the hemin/G-quadruplex nanowires acted as an HRP-mimicking DNAzyme that quickly bioelectrocatalyzed the reduction of produced H2O2, which finally led to a dramatically amplified electrochemical signal. This method has demonstrated a high sensitivity of Hg(2+) detection with the dynamic concentration range spanning from 1.0 ng L(-1) to 10 mg L(-1) Hg(2+) and a detection limit of 0.5 ng L(-1) (2.5 pM) at the 3Sblank level, and it also demonstrated excellent selectivity against other interferential metal ions.
Related JoVE Video
Analysis of structure origin and luminescence properties of Yb(3+)-Er(3+) co-doped fluorophosphate glass.
Spectrochim Acta A Mol Biomol Spectrosc
PUBLISHED: 01-17-2014
Show Abstract
Hide Abstract
The near infrared luminescence properties of Yb(3+)-Er(3+) co-doped fluorophosphate glasses have been investigated. The various effects on structure and 1.53 ?m emission were analyzed as a function of Yb(3+) concentration. The energy transfer mechanism was proposed. High measured lifetime (10.75 ms), large effective full widths at half maximum (73.71 nm) and large gain per unit length (62.8 × 10(-)(24)cm(2)s) have been achieved in prepared glass. The present glass co-doped with 6mol% YbF3 and 2 mol% ErF3 showed magnificent luminescence properties for telecommunication application.
Related JoVE Video
Overexpression of DCF1 inhibits glioma through destruction of mitochondria and activation of apoptosis pathway.
Sci Rep
PUBLISHED: 01-16-2014
Show Abstract
Hide Abstract
Gliomas are the most common brain tumors affecting the central nervous system and are associated with a high mortality rate. DCF1 is a membrane protein that was previously found to play a role in neural stem cell differentiation. In the present study, we found that overexpression of dcf1 significantly inhibited cell proliferation, migration, and invasion and dramatically promoted apoptosis in the glioblastoma U251 cell line. DCF1 deletion mutations in the functional region showed that the complete structure of DCF1 was necessary for apoptosis. Furthermore, significantly lower tumorigenicity was observed in athymic nude mice by transplanting U251 cells overexpressing dcf1. To decode the apoptosis induced by dcf1, mitochondrial structure and membrane potential in glioma cells were investigated and the results indicated obvious mitochondrial swelling, destruction of cristae, and a significant decline in membrane potential. Mechanismly, caspase-3 signaling was activated. Finally, endogenous dcf1 silence in U251 cells was investigated. Results showed a highly methylation at -1339 and -1322 position at dcf1 promoter sequence, revealing the causal relationship between dcf1 gene and tumorigencicity. The present study identified a previously unknown cancer apoptosis mechanism involving dcf1 overexpression and provided a novel approach to potentially treat glioma patients.
Related JoVE Video
ERK2 small interfering RNAs prevent epidural fibrosis via the efficient inhibition of collagen expression and inflammation in laminectomy rats.
Biochem. Biophys. Res. Commun.
PUBLISHED: 01-09-2014
Show Abstract
Hide Abstract
Laminectomy is a widely accepted treatment for lumbar disorders. Epidural Fibrosis (EF) is a common post-laminectomy or post-discectomy complication, which is thought to cause recurrent pain. RNA interference (RNAi) is a process by which double-stranded RNA triggers the destruction of mRNAs sharing the same sequence. Previously, extra-cellular signal-regulated kinase (ERK) 2 plays crucial roles in suppressing the collagen expression. To investigate the effects of lentiviral ERK2 siRNA on the prevention of post-laminectomy EF formation in a rat model, a controlled double-blinded study was conducted in 75 healthy adult Wistar rats that underwent laminectomy. They were divided randomly into 3 groups according to the treatment method: (1) control group; (2) ERK scrRNA group; (3) ERK siRNA group. All rats were euthanized humanely 4 weeks post-laminectomy. The hydroxyproline content, Rydell score, vimentin cells density, fibroblasts density, inflammatory cells density and inflammatory factors expressions were performed. The hydroxyproline content, Rydell score, vimentin cells density, fibroblasts density, inflammatory cells density and inflammatory factors expressions all suggested better results in ERK siRNA group than other two groups. None of the rats expired and no obvious adverse effects were observed. Local delivery of a lentiviral siRNA targeting ERK2 can prevent epidural scar adhesion in post-laminectomy rat via inhibiting collagen expression and inflammation.
Related JoVE Video
Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.
Gene
PUBLISHED: 01-06-2014
Show Abstract
Hide Abstract
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.
Related JoVE Video
Retreatment and outcomes of recurrent intracranial vertebral artery dissecting aneurysms after stent assisted coiling: a single center experience.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
The retreatment of recurrent intracranial vertebral artery dissecting aneurysms (VADAs) after stent assisted coiling (SAC) has not yet been studied. The purpose of this study was to evaluate the strategies and outcomes for retreatment of recurrent VADAs after SAC.
Related JoVE Video
Cloning of insertion site flanking sequence and construction of transfer DNA insert mutant library in stylosanthes colletotrichum.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Stylosanthes sp. is the most important forage legume in tropical areas worldwide. Stylosanthes anthracnose, which is mainly caused by Colletotrichum gloeosporioides, is a globally severe disease in stylo production. Little progress has been made in anthracnose molecular pathogenesis research. In this study, Agrobacterium tumefaciens-mediated transformation was used to transform Stylosanthes colletotrichum strain CH008. The major factors of the genetic transformation system of S. colletotrichum were optimized as follows: A. tumefaciens' AGL-1 concentration (OD600), 0.8; concentration of Colletotrichum conidium, 1×106 conidia/mL; acetosyringone concentration, 100 mmol/L; induction time, 6 h; co-culture temperature, 25°C; and co-culture time, 3 d. Thus, the transformation efficiency was increased to 300-400 transformants per 106 conidia. Based on the optimized system, a mutant library containing 4616 mutants was constructed, from which some mutants were randomly selected for analysis. Results show that the mutants were single copies that could be stably inherited. The growth rate, spore amount, spore germination rate, and appressorium formation rate in some mutants were significantly different from those in the wild-type strain. We then selected the most appropriate method for the preliminary screening and re-screening of each mutant's pathogenic defects. We selected 1230 transformants, and obtained 23 strains with pathogenic defects, namely, 18 strains with reduced pathogenicity and five strains with lost pathogenicity. Thermal asymmetric interlaced PCR was used to identify the transfer DNA (T-DNA) integration site in the mutant that was coded 2430, and a sequence of 476 bp was obtained. The flanking sequence of T-DNA was compared with the Colletotrichum genome by BLAST, and a sequence of 401 bp was found in Contig464 of the Colletotrichum genome. By predicting the function of the flanking sequence, we discovered that T-DNA insertion in the promoter region of the putative gene had 79% homology with the aspartate aminotransferase gene in Magnaporthe oryzae (XP_003719674.1).
Related JoVE Video
TRB3 is involved in free fatty acid-induced INS-1-derived cell apoptosis via the protein kinase C ? pathway.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Chronic exposure to free fatty acids (FFAs) may induce ? cell apoptosis in type 2 diabetes. However, the precise mechanism by which FFAs trigger ? cell apoptosis is still unclear. Tribbles homolog 3 (TRB3) is a pseudokinase inhibiting Akt, a key mediator of insulin signaling, and contributes to insulin resistance in insulin target tissues. This paper outlined the role of TRB3 in FFAs-induced INS-1 ? cell apoptosis. TRB3 was promptly induced in INS-1 cells after stimulation by FFAs, and this was accompanied by enhanced INS-1 cell apoptosis. The overexpression of TRB3 led to exacerbated apoptosis triggered by FFAs in INS-1-derived cell line and the subrenal capsular transplantation animal model. In contrast, cell apoptosis induced by FFAs was attenuated when TRB3 was knocked down. Moreover, we observed that activation and nuclear accumulation of protein kinase C (PKC) ? was enhanced by upregulation of TRB3. Preventing PKC? nuclear translocation and PKC? selective antagonist both significantly lessened the pro-apoptotic effect. These findings suggest that TRB3 was involved in lipoapoptosis of INS-1 ? cell, and thus could be an attractive pharmacological target in the prevention and treatment of T2DM.
Related JoVE Video
Climate and land use controls on soil organic carbon in the loess plateau region of China.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
The Loess Plateau of China has the highest soil erosion rate in the world where billion tons of soil is annually washed into Yellow River. In recent decades this region has experienced significant climate change and policy-driven land conversion. However, it has not yet been well investigated how these changes in climate and land use have affected soil organic carbon (SOC) storage on the Loess Plateau. By using the Dynamic Land Ecosystem Model (DLEM), we quantified the effects of climate and land use on SOC storage on the Loess Plateau in the context of multiple environmental factors during the period of 1961-2005. Our results show that SOC storage increased by 0.27 Pg C on the Loess Plateau as a result of multiple environmental factors during the study period. About 55% (0.14 Pg C) of the SOC increase was caused by land conversion from cropland to grassland/forest owing to the government efforts to reduce soil erosion and improve the ecological conditions in the region. Historical climate change reduced SOC by 0.05 Pg C (approximately 19% of the total change) primarily due to a significant climate warming and a slight reduction in precipitation. Our results imply that the implementation of "Grain for Green" policy may effectively enhance regional soil carbon storage and hence starve off further soil erosion on the Loess Plateau.
Related JoVE Video
Association between soy isoflavone intake and breast cancer risk for pre- and post-menopausal women: a meta-analysis of epidemiological studies.
PLoS ONE
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Conclusions drawn from meta-analyses on the association between soy isoflavone intake and breast cancer risk for pre- and post-menopausal women are not fully consistent. These meta-analyses did not explore the influence of different study designs on the pooled results on the basis of distinguishing between pre- and post-menopausal women.
Related JoVE Video
Characterization of algal organic matters of Microcystis aeruginosa: biodegradability, DBP formation and membrane fouling potential.
Water Res.
PUBLISHED: 01-01-2014
Show Abstract
Hide Abstract
Algal organic matters (AOM), including extracellular organic matters (EOM) and intracellular organic matters (IOM), were comprehensively studied in terms of their biodegradability, disinfection byproduct (DBP) formation potentials and membrane fouling. EOM and IOM were fractionated into hydrophobic (HP), transphilic (TP) and hydrophilic (HL) constituents. The HP, TP and HL fractions of EOM and IOM were highly biodegradable with BDOC/DOC ranging from 52.5% to 67.4% and the DBP formation potentials followed the order of HP > TP > HL, except of IOM-HL. Biodegradable process proved very effective in removing the DBP formation potentials. Moreover, the AOM characteristics were also evaluated during ultrafiltration (UF) treatment. Results demonstrated that UF favourably remove DOC and DBP formation potential of IOM than those of EOM. And the HL constituents played a more important role in membrane fouling than HP and TP. The UF foulants exhibited higher BDOC/DOC than AOM, suggesting EOM and IOM might enhance biofouling because more biodegradable proteins and polysaccharides were found in membrane foulants. Therefore, appropriate biological treatment, ultrafiltration, or combination of the both are potential options to address these algae-caused water quality issues.
Related JoVE Video
Enrichment of human osteosarcoma stem cells based on hTERT transcriptional activity.
Oncotarget
PUBLISHED: 12-17-2013
Show Abstract
Hide Abstract
Telomerase is crucial for the maintenance of stem/progenitor cells in adult tissues and is detected in most malignant cancers, including osteosarcoma. However, the relationship between telomerase expression and cancer stem cells remains unknown. We observed that sphere-derived osteosarcoma cells had higher telomerase activity, indicating that telomerase activity might be enriched in osteosarcoma stem cells. We sorted subpopulations with high or low telomerase activity (TEL) using hTERT transcriptional promoter-induced green fluorescent protein (GFP). The TELpos cells showed an increased sphere and tumor propagating capacity compared to TELneg cells, and enhanced stem cell-like properties such as invasiveness, metastatic activity and resistance to chemotherapeutic agents both in vitro and in vivo. Furthermore, the telomerase inhibitor MST312 prevented tumorigenic potential both in vitro and in vivo, preferentially targeting the TELpos cells. These data support telomerase inhibition as a potential targeted therapy for osteosarcoma stem-like cells.
Related JoVE Video
CHITIN SYNTHASE B: A MIDGUT-SPECIFIC GENE INDUCED BY INSECT HORMONES AND INVOLVED IN FOOD INTAKE IN Bombyx mori LARVAE.
Arch. Insect Biochem. Physiol.
PUBLISHED: 12-13-2013
Show Abstract
Hide Abstract
Chitin synthase (CHS) is the key regulatory enzyme in chitin synthesis and excretion in insects, and a specific target of insecticides. We cloned a CHS B gene of Bombyx mori (BmChsB) and showed it to be midgut specific, highly expressed during the feeding process in the larva. Knockdown of BmChsB expression in the third-instar larvae increased the number of nonmolting and abnormally molting larvae. Exposure to nikkomycin Z, a CHS inhibitor, reduced the amount of chitin in the peritrophic membrane of molted larvae, whereas abnormally elevated BmChsB mRNA levels were readily detected from the end of molting and in the newly molted larvae. Exogenous 20-hydroxyecdysone (20E) and methoprene, a juvenile hormone analogue, significantly upregulated the expression of BmChsB when the levels of endogenous molting hormone (MH) were low and the levels of endogenous juvenile hormone (JH) were high immediately after molting. When levels of endogenous MH were high and those of endogenous JH were low during the molting stage, exogenous 20E did not upregulate BmChsB expression and exogenous methoprene upregulated it negligibly. When the endogenous hormone levels were low during the mulberry-leaf intake process, BmChsB expression was upregulated by exogenous methoprene. We conclude that the expression of BmChsB is regulated by insect hormones, and directly affects the chitin-synthesis-dependent form of the peritrophic membrane and protects the food intake and molting process of silkworm larvae.
Related JoVE Video
[Effect of carboxymethylated chitosan on proliferation and synthesis of neurotrophic factors in Schwann cells in vitro].
Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi
PUBLISHED: 11-01-2013
Show Abstract
Hide Abstract
To investigate the effect of carboxymethylated chitosan (CMCS) on the proliferation, cell cycle, and secretion of neurotrophic factors in cultured Schwann cells (SCs).
Related JoVE Video
Highly selective fluorescent recognition of sulfate in water by two rigid tetrakisimidazolium macrocycles with peripheral chains.
J. Am. Chem. Soc.
PUBLISHED: 09-27-2013
Show Abstract
Hide Abstract
The reinforced molecular recognition of two rigid tetrakisimidazolium macrocycles resulted in highly selective fluorescent recognition of sulfate dianion in water with an unprecedentedly high association constant of 8.6 × 10(9) M(-2). Besides the electrostatic interaction, the single crystal X-ray analysis revealed that sulfate was encapsulated in a pseudohexahedral cavity of a sandwich structure by two orthogonally packed macrocycles via eight hydrogen bonds between the C2 hydrogen atoms of the imidazolium units and the oxygen atoms of sulfate. This sandwich structure was reinforced by the ?-? stacking between the phenyl and the triazinonide rings and multiple charge-assisted hydrogen bonds between the peripheral chains and the rigid backbones. Notably, these peripheral-backbone hydrogen bonds rendered the flexible peripheral chains to coil around the sandwich structure to shield sulfate inaccessible to water. This binding process was visible by fluorescence enhancement, which was attributed to a restrained rotation and better conjugation of the macrocycle backbone upon binding to sulfate.
Related JoVE Video
Characterization of aroma compounds of Chinese famous liquors by gas chromatography-mass spectrometry and flash GC electronic-nose.
J. Chromatogr. B Analyt. Technol. Biomed. Life Sci.
PUBLISHED: 08-30-2013
Show Abstract
Hide Abstract
Aroma composition of five Chinese premium famous liquors with different origins and liquor flavor types was characterized by gas chromatography-mass spectrometry (GC-MS) and flash gas chromatographic electronic nose system. Eighty-six aroma compounds were identified, including 5 acids, 34 esters, 10 alcohols, 9 aldehydes, 4 ketones, 4 phenols, and 10 nitrous and sulfuric compounds. To investigate possible correlation between aroma compounds identified by GC-MS and sensory attributes, multivariate ANOVA-PLSR (APLSR) was performed. It turned out that there were 30 volatile composition, ethyl acetate, ethyl propanoate, ethyl 2-methyl butanoate, ethyl 3-methyl butanoate, ethyl lactate, ethyl benzenacetate, 3-methylbutyl acetate, hexyl acetate, 3-methyl-1-butanol, 1-heptanol, phenylethyl alcohol, acetaldehyde, 1,1-diethoxy-3-methyl butane, furfural, benzaldehyde, 5-methyl-2-furanal, 2-octanone, 2-n-butyl furan, dimethyl trisulfied and 2,6-dimethyl pyrazine, ethyl nonanoate, isopentyl hexanoate, octanoic acid, ethyl 5-methyl hexanoate, 2-phenylethyl acetate,ethyl oleate, propyl hexanoate, butanoic acid and phenol, ethyl benzenepropanoate, which showed good coordination with Chinese liquor characteristics. The multivariate structure of this electronic nose responses was then processed by principal component analysis (PCA) and hierarchical cluster analysis (HCA). According to the obtained results, GC-MS and electronic nose can be used for the differentiation of the liquor origins and flavor types.
Related JoVE Video
Effect of enzymatic hydrolysis with subsequent mild thermal oxidation of tallow on precursor formation and sensory profiles of beef flavours assessed by partial least squares regression.
Meat Sci.
PUBLISHED: 08-27-2013
Show Abstract
Hide Abstract
Effects of different pretreatments of tallow on flavour precursor development and flavour profiles of beef flavours (BFs) were evaluated. Analysis of free fatty acids and volatiles of tallow by GC and GC-MS indicated that the enzymatic hydrolyzed-thermally oxidized tallow formed the most characteristic flavour precursors compared with others. The results of descriptive sensory analysis confirmed that beef flavour 4 from enzymatic hydrolyzed-thermally oxidized tallow had the strongest beefy, meaty and odour characteristics, followed by beef flavour 2 from oxidized tallow. Electronic nose data confirmed the accuracy of the sensory analysis results. The correlation analysis of 51 volatile compounds in tallow and sensory attributes of BFs showed that some compounds, especially aldehydes, made a significant contribution to sensory attributes. Correlation analysis of free fatty acids and sensory attributes through partial least squares regression (PLSR) confirmed that the moderate enzymatic hydrolysis-thermal oxidation pretreatment of tallow was necessary to achieve the characteristic beef flavour.
Related JoVE Video
All-trans retinoic acid prevents epidural fibrosis through NF-?B signaling pathway in post-laminectomy rats.
Neuropharmacology
PUBLISHED: 08-23-2013
Show Abstract
Hide Abstract
Laminectomy is a widely accepted treatment for lumbar disorders, and epidural fibrosis (EF) is a common complication. EF is thought to cause post-operative pain recurrence after laminectomy or discectomy. All-trans retinoic acid (ATRA) has shown anti-fibrotic, anti-inflammatory, and anti-proliferative functions. The object of this study was to investigate the effects of ATRA on the prevention of EF in post-laminectomy rats. In vitro, the anti-fibrotic effect of ATRA was demonstrated with cultured fibroblasts count, which comprised of those that were cultured with/without ATRA. In vivo, rats underwent laminectomy at the L1-L2 levels. We first demonstrated the beneficial effects using 0.05% ATRA compared to vehicle (control group). We found that a higher concentration of ATRA (0.1%) achieved dose-dependent results. Hydroxyproline content, Rydell score, vimentin-positive cell density, fibroblast density, inflammatory cell density and inflammatory factor expression levels all suggested better outcomes in the 0.1% ATRA rats compared to the other three groups. Presumably, these effects involved ATRAs ability to suppress transforming growth factor (TGF-?1) and interleukin (IL)-6 which was confirmed with reverse-transcriptase polymerase chain reaction (RT-PCR). Finally we demonstrated that ATRA down-regulated nuclear factor (NF)-?B by immunohistochemistry and western blotting for p65 and inhibition of ?B (I?B?), respectively. Our findings indicate that topical application of ATRA can inhibit fibroblast proliferation, decrease TGF-?1 and IL-6 expression level, and prevent epidural scar adhesion in rats. The highest concentration employed in this study (0.1%) was the most effective. ATRA suppressed EF through down-regulating NF-?B signaling, whose specific mechanism is suppression of I?B phosphorylation and proteolytic degradation.
Related JoVE Video
A simple spatial working memory and attention test on paired symbols shows developmental deficits in schizophrenia patients.
Neural Plast.
PUBLISHED: 08-20-2013
Show Abstract
Hide Abstract
People with neuropsychiatric disorders such as schizophrenia often display deficits in spatial working memory and attention. Evaluating working memory and attention in schizophrenia patients is usually based on traditional tasks and the interviewers judgment. We developed a simple Spatial Working Memory and Attention Test on Paired Symbols (SWAPS). It takes only several minutes to complete, comprising 101 trials for each subject. In this study, we tested 72 schizophrenia patients and 188 healthy volunteers in China. In a healthy control group with ages ranging from 12 to 60, the efficiency score (accuracy divided by reaction time) reached a peak in the 20-27 age range and then declined with increasing age. Importantly, schizophrenia patients failed to display this developmental trend in the same age range and adults had significant deficits compared to the control group. Our data suggests that this simple Spatial Working Memory and Attention Test on Paired Symbols can be a useful tool for studies of spatial working memory and attention in neuropsychiatric disorders.
Related JoVE Video
Antioxidative capacity in the fat body of Bombyx mori is increased following oral administration of 4-methylumbelliferone.
Comp. Biochem. Physiol. C Toxicol. Pharmacol.
PUBLISHED: 07-12-2013
Show Abstract
Hide Abstract
Plant sources of umbelliferones have tumor-inhibitory effects at the cellular level. However, their physiological functions in animals are largely unresolved. In this study, we provide evidence to show that 4-methylumbelliferone (4-MU) participates in the regulation of antioxidative capacity in the fat body of Bombyx mori, a tissue similar to mammalian liver in this model invertebrate. Larvae (3rd day of the 5th instar) were orally exposed to 4mM 4-MU, an umbelliferone, which swiftly induced the generation of a large number of ROS (e.g. H2O2 increased 6 to 8-fold), and 4-MU was detected in the fat body 8min after administration. In addition, the activities of CAT and GPx were up-regulated 4 to 11-fold and 2 to 16-fold, respectively, and were helpful in defending fat body cells against oxidative injury in combination with NADPH. Furthermore, significant increases in the contents of T-AOC (up to approx. 2-fold), antioxidants of ASAFR (by 2 to 4-fold) and GSH were detected.
Related JoVE Video
Influence of hydrophobic/hydrophilic fractions of extracellular organic matters of Microcystis aeruginosa on ultrafiltration membrane fouling.
Sci. Total Environ.
PUBLISHED: 06-29-2013
Show Abstract
Hide Abstract
Fouling is a major obstacle to maintain the efficiency of ultrafiltration-based drinking water treatment process. Algal extracellular organic matters (EOMs) are currently considered as one of the major sources of membrane fouling. The objective of this study was to investigate the influence of different hydrophobic/hydrophilic fractions of EOM extracted from Microcystis aeruginosa on ultrafiltration membrane fouling at lab scale. The experimental data indicated that EOM exhibited similar flux decline trends on polyethersulfone (PES) and regenerated cellulose (RC) membranes but caused greater irreversible fouling on PES membrane than RC membrane due to its hydrophobic property. It was also observed that charged hydrophilic (CHPI) and neutral hydrophilic (NHPI) fractions caused greater flux decline over hydrophobic (HPO) and transphilic (TPI) fractions. For PES membrane, the order of the irreversible fouling potentials for the four fractions was HPO>TPI>CHPI>NHPI, while the irreversible fouling potentials of RC membrane were tiny and could be ignored. Fluorescence excitation-emission matrix (EEM) spectra and Fourier transform infrared (FTIR) spectra suggested that protein-like, polysaccharide-like and humic-like substances were the major components responsible for membrane fouling. The results also indicated that the irreversible fouling increased as the pH decreased. The addition of calcium to feed solutions led to more severe flux decline and irreversible fouling.
Related JoVE Video
Search for highly efficient, stereoselective, and practical synthesis of complex organic compounds of medicinal importance as exemplified by the synthesis of the C21-C37 fragment of amphotericin?B.
Chemistry
PUBLISHED: 06-21-2013
Show Abstract
Hide Abstract
Highly stereoselective: A highly efficient, stereoselective and practical synthesis of the C21-C37 fragment of amphotericin?B was realized in 25?% overall yield in eight longest linear steps from commercially available ethyl (S)-3-hydroxybutyrate by using Fráter-Seebach alkylation, Brown crotylboration, Negishi coupling, Heck reaction, and Horner-Wadsworth-Emmons (HWE) olefination as key steps (see diagram).
Related JoVE Video
hTERT promoter activity identifies osteosarcoma cells with increased EMT characteristics.
Oncol Lett
PUBLISHED: 06-19-2013
Show Abstract
Hide Abstract
Epithelial-mesenchymal transition (EMT) is a critical step in order for epithelial-derived malignancies to metastasize, however, its role in mesenchymal-derived tumors, i.e., osteosarcoma, remains unclear. Cancer stem cells (CSCs) are enriched with cells that undergo EMT. The activity of telomerase is maintained in normal stem cells and a number of malignant tumors. The current study observed the heterogeneity of telomerase activity among individual osteosarcoma cells. We hypothesized that telomerase-positive (TELpos) cells are enriched for stem cell-like and EMT properties. A human telomerase reverse transcriptase (hTERT) promoter-reporter was applied to assess the telomerase activity of individual MG63 osteosarcoma cells and sort them into TELpos and telomerase-negative (TELneg) subpopulations. It was found that the TELpos cells exhibited an enhanced ability to form sarcospheres in vitro. In addition, TELpos cells exhibited a higher expression of vimentin, accompanied by an increased long/short axis ratio. A panel of EMT-related genes was evaluated by quantitative PCR and western blot analysis, and were found to be significantly upregulated in TELpos cells. Next, the in vitro migration capacity was examined by Transwell assay, which confirmed that TELpos cells are more prone to migration (2.6 fold). The results of the present study support the concept that EMT also applies to mesenchymal-derived osteosarcoma and draws a connection between telomerase and EMT characteristics.
Related JoVE Video
An Experimental Novel Study: Angelica sinensis Prevents Epidural Fibrosis in Laminectomy Rats via Downregulation of Hydroxyproline, IL-6, and TGF- ? 1.
Evid Based Complement Alternat Med
PUBLISHED: 05-25-2013
Show Abstract
Hide Abstract
With laminectomy being widely accepted as the treatment for lumbar disorders, epidural fibrosis (EF) is a common complication for both the patients and the surgeons alike. Currently, EF is thought to cause recurrent postoperative pain after laminectomy or after discectomy. Angelica sinensis is a traditional Chinese medicine which has shown anti-inflammatory, antifibrotic, and antiproliferative properties. The object of this study was to investigate the effects of Angelica sinensis on the prevention of post-laminectomy EF formation in a rat model. A controlled double-blinded study was conducted in sixty healthy adult Wistar rats that underwent laminectomy at the L1-L2 levels. They were divided randomly into 3 groups according to the treatment method, with 20 in each group: (1) Angelica sinensis treatment group, (2) saline treatment group, and (3) sham group (laminectomy without treatment). All rats were euthanized humanely 4 weeks after laminectomy. The hydroxyproline content, Rydell score, vimentin cells density, fibroblasts density, inflammatory cells density, and inflammatory factors expressions all suggested better results in Angelica sinensis group than the other two groups. Topical application of Angelica sinensis could inhibit fibroblasts proliferation and TGF- ? 1 and IL-6 expressions and prevent epidural scar adhesion in postlaminectomy rat model.
Related JoVE Video
Taibaiella smilacinae gen. nov., sp. nov., an endophytic member of the family Chitinophagaceae isolated from the stem of Smilacina japonica, and emended description of Flavihumibacter petaseus.
Int. J. Syst. Evol. Microbiol.
PUBLISHED: 05-03-2013
Show Abstract
Hide Abstract
A light-yellow-coloured bacterium, designated strain PTJT-5(T), was isolated from the stem of Smilacina japonica A. Gray collected from Taibai Mountain in Shaanxi Province, north-west China, and was subjected to a taxonomic study by using a polyphasic approach. The novel isolate grew optimally at 25-28 °C and pH 6.0-7.0. Flexirubin-type pigments were produced. Cells were Gram-reaction-negative, strictly aerobic, rod-shaped and non-motile. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain PTJT-5(T) was a member of the phylum Bacteroidetes, exhibiting the highest sequence similarity to Lacibacter cauensis NJ-8(T) (87.7?%). The major cellular fatty acids were iso-C15?:?0, iso-C15?:?1 G, iso-C17?:?0 and iso-C17?:?0 3-OH. The only polyamine was homospermidine and the major polar lipid was phosphatidylethanolamine. The only respiratory quinone was MK-7 and the DNA G+C content was 40.3 mol%. Based on the phenotypic, phylogenetic and genotypic data, strain PTJT-5(T) is considered to represent a novel species of a new genus in the family Chitinophagaceae, for which the name Taibaiella smilacinae gen. nov., sp. nov. is proposed. The type strain of Taibaiella smilacinae is PTJT-5(T) (?=?CCTCC AB 2013017(T)?=?KCTC 32316(T)). An emended description of Flavihumibacter petaseus is also proposed.
Related JoVE Video
CoFe2O4 magnetic nanoparticles as a highly active heterogeneous catalyst of oxone for the degradation of diclofenac in water.
J. Hazard. Mater.
PUBLISHED: 05-02-2013
Show Abstract
Hide Abstract
A magnetic nanoscaled catalyst cobalt ferrite (CoFe2O4) was successfully prepared and used for the activation of oxone to generate sulfate radicals for the degradation of diclofenac. The catalyst was characterized by transmission electron microscopy, X-ray diffractometry, Fourier transform infrared spectroscopy and vibrating sample magnetometer. The effects of calcination temperature, initial pH, catalyst and oxone dosage on the degradation efficiency were investigated. Results demonstrated that CoFe2O4-300 exhibited the best catalytic performance and almost complete removal of diclofenac was obtained in 15 min. The degradation efficiency increased with initial pH decreasing in the pH range of 5-9. The increase of catalyst and oxone dosage both had the positive effect on the degradation of diclofenac. Moreover, CoFe2O4 could retain high degradation efficiency even after being reused for five cycles. Finally, the major diclofenac degradation intermediates were identified and the primary degradation pathways were proposed.
Related JoVE Video
Prevalence and associated metabolic factors of fatty liver disease in the elderly.
Exp. Gerontol.
PUBLISHED: 05-02-2013
Show Abstract
Hide Abstract
The aim of this study was to investigate the metabolic risk factors for fatty liver disease in the elderly, and determine the prevalence of fatty liver disease in the elderly in Wuhan, central China.
Related JoVE Video
Human umbilical cord blood stem cells for spinal cord injury: early transplantation results in better local angiogenesis.
Regen Med
PUBLISHED: 05-01-2013
Show Abstract
Hide Abstract
We aim to explore the repair mechanism after the transplantation of CD34(+) human umbilical cord blood cells (HUCBCs) in traumatic spinal cord injury (SCI) in rats.
Related JoVE Video
Rapid measuring and modelling flavour quality changes of oxidised chicken fat by electronic nose profiles through the partial least squares regression analysis.
Food Chem
PUBLISHED: 04-11-2013
Show Abstract
Hide Abstract
The objective of this study was to investigate whether an electronic nose, comprising 18 metal oxide semiconductor gas sensors, could be used for measuring and modelling flavour quality changes of refined chicken fat during controlled oxidation. Partial least squares regression (PLSR) was applied to determine the predictive relationships between the chemical parameters, GC-MS data, free fatty acid profiles and electronic nose responses for controlled oxidation of refined chicken fat. The results showed that peroxide value (PV) and acid value (AV) were significantly well predicted by the electronic nose responses, whereas p-anisidine value (p-AV) was found to be fairly well predicted especially for deeply oxidised chicken fat. Thus, this study gave evidence of the electronic nose system to be a promising device for future at- or on-line implementation in oxidation control of chicken fat for producing meat flavourings.
Related JoVE Video

What is Visualize?

JoVE Visualize is a tool created to match the last 5 years of PubMed publications to methods in JoVE's video library.

How does it work?

We use abstracts found on PubMed and match them to JoVE videos to create a list of 10 to 30 related methods videos.

Video X seems to be unrelated to Abstract Y...

In developing our video relationships, we compare around 5 million PubMed articles to our library of over 4,500 methods videos. In some cases the language used in the PubMed abstracts makes matching that content to a JoVE video difficult. In other cases, there happens not to be any content in our video library that is relevant to the topic of a given abstract. In these cases, our algorithms are trying their best to display videos with relevant content, which can sometimes result in matched videos with only a slight relation.