Isolation of Retinal Pigment Epithelial Cells from Guinea Pig Eyes

Summary

We describe a simple and efficient method for isolating cells of the retinal pigment epithelium (RPE) cells from the eyes of young pigmented guinea pigs. This procedure allows for follow-up molecular biology studies on the isolated RPE, including gene expression analyses.

Abstract

This protocol describes the isolation of cells of the retinal pigment epithelium (RPE) from the eyes of young pigmented guinea pigs for potential application in molecular biology studies, including gene expression analyses. In the context of eye growth regulation and myopia, the RPE likely plays a role as a cellular relay for growth modulatory signals, as it is located between the retina and the two walls of the eye, such as the choroid and sclera. While protocols for isolating the RPE have been developed for both chicks and mice, these protocols have proven not to be directly translatable to the guinea pig, which has become an important and widely used mammalian myopia model. In this study, molecular biology tools were used to examine the expression of specific genes to confirm that the samples were free of contamination from the adjacent tissues. The value of this protocol has already been demonstrated in an RNA-Seq study of RPE from young pigmented guinea pigs exposed to myopia-inducing optical defocus. Beyond eye growth regulation, this protocol has other potential applications in studies of retinal diseases, including myopic maculopathy, one of the leading causes of blindness in myopes, in which the RPE has been implicated. The main advantage of this technique is that it is relatively simple and once perfected, yields high-quality RPE samples suitable for molecular biology studies, including RNA analysis.

Introduction

The RPE comprises a unique monolayer of pigmented cells located between the neural retina and the vascular choroid, and the RPE has well-recognized roles in the development and maintenance of normal retinal function, including phototransduction^1,2. More recently, the RPE has been assigned an additional key role in eye growth regulation³ and, thus, the development of myopia⁴. This assignment is based on the RPE's critical location, interposed between the retina and choroid and the now broad acceptance that eye growth and, thus, refractive errors are regulated locally⁵. The RPE is believed to play a key role as a signal relay, linking the retina, the assumed source of growth modulatory signals, to the choroid and sclera, the two targets of the relayed signals^6,7,8.

The increase in axial length that characterizes most myopia cannot be considered benign, with pathophysiological changes involving the retina, choroid, and/or sclera representing unavoidable and now well-recognized consequences of excessive ocular elongation^7,9. In this context, the RPE is perhaps the most vulnerable, since, being a nonmitotic tissue, it is only able to accommodate the expanding vitreous chamber by the stretching and thinning of individual cells. While its role in myopia-related pathologies, such as myopic macular degeneration, is yet to be fully understood, the RPE has been implicated in the pathogenesis of a number of other retinal diseases, including geographic atrophy, one of the leading causes of blindness, which is associated with documented abnormalities in the retina, RPE, and choroid^10,11,12.

The successful isolation of RPE cells, free from contamination from adjacent ocular tissues, potentially opens up many research opportunities to gain new insights into the mechanisms underlying a variety of eye/retinal diseases. However, the isolation of the RPE has proven challenging, with many published studies making use of combined retina/RPE or RPE/choroid samples for this reason^13,14,15. Studies involving the successful isolation of the RPE of a quality suitable for molecular biology studies has been limited to chick and mouse eyes^16,17. For example, the simultaneous RPE isolation and RNA stabilization (SRIRS) method described by Wang et al.¹⁸. To isolate RPE cells in mice does not appear to work well in guinea pig eyes. The protocol described here represents a refinement of an approach that was initially prototyped with tree shrew eyes by one of the authors (M.F.) and has proven to yield high-quality RPE samples, appropriate for RNA and other molecular biology analyses, from the eyes of young pigmented guinea pigs¹⁹.

Protocol

All animal care and treatments used in this study conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The experimental protocols were approved by the Animal Care and Use Committee of the University of California, Berkeley.

1. Enucleation of the guinea pig eye

1. Euthanize a guinea pig with an intracardiac injection of sodium pentobarbital delivered under anesthesia (5% isoflurane in oxygen).
2. Enucleate the eyes with the aid of forceps and scissors, and immediately transfer them to a 10 cm Petri dish with sterile phosphate-buffered saline (PBS) for washing. Transfer the eyes to fresh PBS solution.
   ​NOTE: A 6-well plate containing 4 mL of solution per well is recommended.

2. Isolation of the ocular posterior eye cup and RPE/choroid/sclera complex

1. With the aid of a dissecting microscope, use an 18 G needle to make an initial small incision in the sclera, approximately 1.0 mm behind the limbal boundary (i.e., between the cornea and sclera) (Figure 1A); then use scissors to remove the anterior segment, including the cornea, iris, ciliary body, and crystalline lens.
2. Next, working with the remaining posterior ocular segment eye cup, detach the retina from the RPE/choroid/sclera complex; use forceps to first grasp and then gently tug on the zonule of Zinn and then to progressively peel away the retina without fragmentation (Figure 1B).
   ​NOTE: The retina must not be directly grasped to avoid retinal fragmentation and incomplete retinal tissue isolation. The use of a microscope is essential for this dissection step.

3. Isolation of the RPE from the choroid

1. After the retina has been completely removed, immerse the remaining posterior eye cup, which includes the RPE, choroid, and sclera, in tissue storage reagent for 5 min (see the Table of Materials).
   NOTE: Use a 12-well plate with identified wells, each filled with 2 mL of the tissue storage reagent.
2. Transfer the eye cup to another well filled with 4 mL of PBS for 10 s before moving it to a third well filled with 2 mL of PBS.
3. Attach a 30 G needle to a 1 mL syringe filled with PBS for the final RPE isolation step. Gently push on the syringe to create a jet stream of PBS; first, aim this stream at the RPE to make a small tear or hole in it, and then direct the stream of PBS into the created opening to detach the RPE as a sheet from the choroid (Figure 1C).
   NOTE: The detachment of the RPE as a sheet yields the largest RPE sample. Again, the use of a microscope is essential for this step.
4. After detaching the RPE from the choroid (Figure 1D), collect the RPE tissue in a needleless 1 mL syringe, and then transfer the collected sample to a 1.5 mL tube.
5. Centrifuge the 1.5 mL tube with the collected RPE at 8,000 × g for 1 min to obtain an RPE pellet (Figure 2A).
6. Discard the PBS solution, and replace it with 350 mL of lysis buffer, as included in RNA isolation kits (see the Table of Materials); pipette 20x to mix and, thus, preserve the quality of the sample. For longer-term storage and preservation, transfer the samples to a −80 °C freezer.
   ​NOTE: The lysis buffer is a proprietary component of the RNA isolation kit for cell and tissue lysis before RNA isolation and simultaneous RNA/DNA/protein isolation. To inactivate the RNAses in the lysate, be sure to add β-mercaptoethanol to the lysis buffer (10 µL of β-mercaptoethanol per 1 mL of lysis buffer).

4. RPE-RNA extraction

1. Use an RNA isolation kit (see the Table of Materials) to isolate and collect the RNA from the RPE samples following the manufacturer's instructions provided. Evaluate the quality of the sample via electrophoresis.
   NOTE: The described protocol yielded a good-quality product (i.e., RNA integrity number [RIN] over 8.0).

Representative Results

The analysis of the RPE samples collected using the above protocol showed well-preserved RNA (RIN >8.0, Figure 2B), with 240.2 ng ± 35.1 ng per eye (n = 8, NanoDrop, Figure 2B). To further evaluate the quality of the isolated RPE samples, particularly the absence of choroidal and scleral contaminants, we examined the expression of representative genes for each of the latter tissues in the RPE samples¹⁹. The RPE samples demonstrated a significantly higher expression of Rpe65 (an RPE-specific gene) compared with the Rpe65 expression levels in the choroid and sclera (Table 1 and Figure 2C). In contrast, the RPE samples showed minimal expression of Col1a1, the selected choroid-sclera-specific gene (Figure 2D).

Figure 1: Procedure for collecting the RPE sheets. (A) A 2-week-old guinea pig eye with the first incision. (B) The anterior segment (cornea, iris, and lens), vitreous,and retina are then separated from the posterior eye cup (RPE, choroid, and sclera). (C) A jet stream of PBS, delivered via a 30 G needle, is used detach the RPE (D) as a sheet (black arrows) from the choroid. The procedure from the first incision to the RPE collection takes 5-7 min. Abbreviation: RPE = retinal pigment epithelium. Please click here to view a larger version of this figure.

Figure 2: Procedure for assessing the quality of the isolated RPE samples. (A) Representative image of an RPE sample in a 1.5 mL microcentrifuge tube after being spun down. (B) Representative bioanalyzer output for RNA extracted from the collected RPE samples. (C,D) The gene expression levels of Rpe65, an RPE-specific gene, and Col1a1, which is not or minimally expressed in the RPE, measured by RT-qPCR in the RPE, choroid, and scleral samples from n = 3 untreated animals; both data sets were normalized to β-actin. ** P < 0.01; *** P < 0.001. This figure has been modified from Goto et al.¹⁹. Abbreviations: RPE = retinal pigment epithelium; β-actin = beta-actin; Col1a1 = collagen type-I alpha-1 chain; Rpe65 = retinoid isomerohydrolase; RT-qPCR = reverse-transcription quantitative polymerase chain reaction. Please click here to view a larger version of this figure.

Gene	Forward Primer (5' to 3')			Reverse Primer (5' to 3')
Col1a1	GCCTCAGGCAAGACAGTCATT			GCTAACGGTAAAGCCGAATTCC
Rpe65	GCCCTTCTGCACAAGTTTGAC			CAGTGCGGATGAACCTTCTGT
β-actin	GGCCGAGCGGGAAATT			CCAGGGCAACATAGCATAGCTT

Table 1: Nucleotide sequences of the primers used for PCR amplification in the sample quality analysis. Abbreviations: β-actin = Beta-actin; Col1a1 = collagen type I alpha 1 chain; Rpe65 = retinoid isomerohydrolase.

Discussion

In this article, we describe a method for isolating RPE, appropriate for RPE gene expression analyses, from the eyes of young, pigmented guinea pigs. The merits of this protocol are that it yields high-quality RPE samples that are relatively free from contamination, with RNA suitably preserved for RNA-specific analyses and, yet, is relatively simple and efficient. While in the example provided here, the RPE samples were collected from the eyes of a young (2 weeks old) guinea pig, the protocol has also been used successfully to collect RPE samples from older (young adult) animals.

For researchers with minimal prior experience with ocular surgery or dissection, protocol step 2.1 and step 2.2 can be challenging. The critical detail in step 2.1 is the location of the initial incision in the sclera, which should be accurately placed 1.0 mm behind the limbus so that the iris and lens are removed together with the cornea when detaching the anterior segment. If, instead, the iris remains attached to the posterior ocular segment, it is challenging to find the zonule of Zinn, which is key to successfully detaching the retina in the next step. As noted in the protocol, for the successful detachment of the retina, it is also critical that the retina not be grasped directly with the forceps to avoid its fragmentation. The guinea pig retina appears more fragile than the mouse retina, likely because of its avascular nature²⁰. Ideally, the isolated posterior eye cup, comprising the RPE, choroid, and sclera, should be immersed in tissue storage reagent within 5 min of eye enucleation to ensure the adequate preservation of RNA in the collected RPE sample.

The SRIRS method, which was developed for the specific purpose of collecting high-quality samples of RPE from the eyes of mice, appears to have achieved that goal for mouse eyes; it is reported to be both efficient and effective¹⁸. This technique has also been successfully used to collect RPE from healthy human donor eyes²¹. However, based on the authors' experience, this SRIRS method is not suitable for collecting RPE from the eyes of the guinea pig, tree shrew, and opossum, although the underlying reasons for this are not clear. By reporting the technique described here to isolate and collect RPE from the eyes of young guinea pigs, we hope to address an important unmet need in the myopia research field.

In terms of the limitations of the protocol described, the main one is the need for a period of hands-on training to ensure the efficient collection of samples, as the time to completion is key, in addition to the purity of the collected RPE samples. Researchers who have no experience with ocular micro-dissection or surgery will be most in need of training. Although several RPE isolation methods have been reported^22,23, the method as described here is not suitable for RPE cell cultures or protein analyses due to the use of an RNA stabilizing reagent.

The RPE has long been recognized to play critical roles not only in maintaining the health and function of the retina but also in related diseases. The fact that the RPE is now also recognized to play a key role in ocular growth regulation and myopia development has considerably broadened the scope of research questions, for which the ability to collect high-quality RPE samples from either the eyes of guinea pigs, as described here, or other mammals used as animal models may be key to providing new insights. Such studies may also offer new insights into the pathological complications of myopia, including myopic maculopathy, for which the prevalence figures can be expected to rise in parallel with myopia prevalence figures per se.

Materials

Name	Company	Catalog Number	Comments
1 mL Syringe with Slip Tip	Bd Vacutainer Labware Medical	22-253-260
2-Mercaptoethanol	Invitrogen	21985-023
6 Well Tissue Culture Plate with Lid, Flat Bottom, Sterile	pectrum Chemical Mfg. Corp	970-95008
12 Well Tissue Culture Plate with Lid, Individual, Sterile	Thomas Scientific LLC	1198D72
Agilent 2100 Bioanalyzer			automated electrophoresis to check RNA quality
Balanced Salt Solutions	Gibco	10010031
Bonn Micro Forceps, Straight Smooth, 0.3 mm Tip, 7 cm	Fine Science Tools, Inc.	11083-07
Dumont forceps no. 5	ROBOZ	RS-5045
Hypodermic disposable needles	Exelint International, Co.	26419
Hypodermic disposable needles	Exelint International, Co.	26437
MiniSpin Microcentrifuges	Eppendorf	540108	Max. Speed: 8,000 g
RNAlater Stabilization Solution	Invitrogen	AM7020	tissue storage reagent
RNeasy Mini kits	Qiagen	74104	RNA isolation kit
Student Vannas Spring Scissors	Fine Science Tools, Inc.	91500-09