Quantifizierung der ökologischen Mikroorganismen und Viren mit qPCR

Environmental Microbiology

Your institution must subscribe to JoVE's Environmental Sciences collection to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 1 hour trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Overview

Quelle: Labors von Dr. Ian Pfeffer und Dr. Charles Gerba - Arizona University
Demonstrierende Autor: Bradley Schmitz

Quantitative Polymerase-Kettenreaktion (qPCR), auch bekannt als Real-Time PCR ist eine weit verbreitete molekulare Technik zum Auflisten von Mikroorganismen in der Umwelt. Vor dieser Ansatz war die Quantifizierung von Mikroorganismen beschränkt sich weitgehend auf klassische Kultur-basierte Techniken. Jedoch die Kultivierung von Mikroorganismen aus Umweltproben besonders schwierig sein kann, und es wird in der Regel gehalten, die so wenig wie 1 bis 10 % der Mikroorganismen in Umweltproben nachweisbar mit diesen Techniken sind. Das Aufkommen der qPCR Umweltmikrobiologie Forschung hat daher erweiterte Bereich stark dadurch, dass für die genauere Bestimmung der Konzentration von Mikroorganismen wie z. B. die krankheitsverursachenden Erregern in Umweltproben. Eine wichtige Einschränkung der qPCR als angewandte mikrobiologische Technik ist jedoch, dass lebende, lebensfähige Populationen aus inaktiv oder nicht-lebenden Populationen unterscheiden lassen.

Dieses Video veranschaulicht die Verwendung der qPCR, Paprika mild Mottle Virus aus einer ökologischen Wasserprobe zu erkennen.

Cite this Video

JoVE Science Education Database. Grundlagen der Umwelt-Mikrobiologie. Quantifizierung der ökologischen Mikroorganismen und Viren mit qPCR. JoVE, Cambridge, MA, (2017).

Principles

Die grundlegenden Prinzipien hinter qPCR ist identisch mit der regulären PCR – wiederholte Zyklen der Grundierung glühen, Vorlage, Dehnung des PCR-Produktes und Denaturierung des Produkts aus Vorlage, führt zu die exponentielle Amplifikation des einer Zielsequenz von Interesse, bekannt als die "Amplikons", aus einem Pool von Ausgangsmaterial. Die Innovation der qPCR macht zusätzlich fluoreszierende Chemikalien in der Reaktion, die die Synthese von PCR-Produkt bei jedem Zyklus direkt in "Real Time" durch spezialisierte Thermocycler visualisiert werden kann, möglich, die Höhe der Vorlage Sequenz in der ursprünglichen Probe zu quantifizieren es. Die Menge wird in der Regel in Bezug auf die Schwelle-Zyklus (Ct, auch bekannt als Quantifizierung Zyklus oder C-Q), gemessen die PCR-Zyklus ist bei dem fluoreszierenden Produkte die Hintergrundkonzentration übersteigt.

Quantifizierung kann relativ, sein, wo der C-t -Wert von einer Sequenz mit der einer anderen Norm oder Control Sequence verglichen wird. Alternativ neben den Proben in der Reaktion verläuft eine Reihe von DNA der bekannten Menge "Standardkurve" Vergleich Fluoreszenz Wert auf DNA-Menge herstellbar und ermöglicht die Probe DNA, absolut quantitated.

In einer qPCR Methode soll ein kurzes Stück DNA, bekannt als Sonde, gegen eine bestimmte Ziel-Sequenz von Interesse. Die Sonde ist chemisch verbunden ein fluoreszierender Farbstoff sowie ein "Durstlöscher" Molekül, das unterdrückt das Fluoreszenzsignal von der Farbstoff in der Nähe. Die Polymerase-Enzym, das welches das Produkt DNA synthetisiert, hat eine DNA-abbauenden Aktivität, die das fluoreszierende Molekül von der Sonde, so trennt des Farbstoffs aus dem Quencher und ermöglicht das Fluoreszenzsignal erkannt werden freigegeben werden verursachen würde. Fluorophor Werte werden nach jeder PCR quantitativ gemessen-Zyklus, mit zunehmender Signal Stärke Korrelation zu höheren Ebenen der verstärkten Zielsequenzen (genannt "Amplifikate") in die Umwelt Probe vorhanden.

Procedure

1. die Probenahme

  1. Boden mit einer Schnecke zu sammeln oder zu einer bestimmten Tiefe Schaufel. Wenn Boden von der Rhizosphäre sammeln, sammeln Sie nur Boden innerhalb von 7 mm rund um Pflanzenwurzel, durch überschüssige Erde von der Wurzel schlagen und kratzen gewünschte Boden in ein Fass Sammlung.
  2. Legen Sie eine sterile Nalgene Flasche in DIP Stick. Halten Sie das Ende des Stockes und sammeln Sie Wasser durch Eintauchen der Flasche zu. Stellen Sie die Flasche in eine Kühlbox mit Eis.
  3. Übertragen Sie Proben an das Labor.

(2) Nukleinsäuren Extraktion

  1. Mikroorganismen aus den gesammelten Proben zu isolieren und zu DNA oder RNA extrahieren, bitte sehen Sie das Video Jupiter Science Education Community Nukleinsäure-Extraktion.

3. reverse Transkription

  1. Wenn das Erbgut untersucht wird RNA ist, muss es verwendet werden komplementäre DNA (cDNA) generieren über reverse Transkription vor der PCR. Für Details siehe Jupiter Science Education video auf RT-PCR.

4. Einstellen der qPCR

  1. Abrufen von Reagenzien, die bei-20 ° C gelagert und tauen sie auf Eis oder bei Raumtemperatur innerhalb eine cleane Motorhaube. In diesem Beispiel verwendete Reagenzien enthalten die qPCR Reaktion Mischung (abhängig von der qPCR-Maschine verwendet, enthält DNA-Polymerase), forward und reverse Primer und die TaqMan Sonde. Primer und Sonde Sequenzen sollen mit Sequenzen, die spezifisch für den Organismus, die aufgelistet werden. Beziehen sich auf aktuelle Literatur, Sequenzen von Interesse zu finden. In diesem Beispiel wird das Roche Light Cycler 480 Sonden Reagenz-System verwendet werden. Paprika mild Mottle Virus wird in der Wasserprobe aufgelistet werden. 1, 2 siehe Tabelle 1 für Primer und Sonde Sequenzen.
  2. Tauwetter extrahiert (c) DNA-Proben und die Positivkontrolle DNA (bestehend aus Organismus-spezifische Sequenzen in bakterielle Plasmide kloniert) bei Raumtemperatur.
  3. Vorbereiten einer 96-Zelle Tabellenvorlage, die die qPCR 96-Well-Platte ähnelt. Beschriften Sie jede Zelle mit der Reaktion, die auf der Platte geladen wird. Schließen Sie Reaktionen für jede Probe und Standard in dreifacher Ausfertigung sowie für die positive Kontrolle und Negativkontrolle, wie eine keine-DNA Reaktion.
  4. Berechnen Sie die Reagenz Bände für eine Reaktion "master-Mix", die alle Reagenzien, die konstant unter den Reaktionen umfasst, basierend auf Angaben des Herstellers und der Literatur sind erforderlich. Bereiten Sie genügend master-Mix für dreifacher Reaktionen für alle Proben sowie Kontrollen und zusätzlich 10 % zu pipettieren Fehler ausmachen. Für ein Probe-Master mix Rezept, siehe Tabelle 2.
  5. Arbeiten in einem sauberen Kapuze, sobald alle Reagenzien vollständig aufgetaut sind, fügen Sie berechneten Betrag jedes Reagenz zu einem Schlauch 1,5 mL niedrig-Bindung Microfuge master-Mix zu erstellen hinzu. Wirbel und kurz Minicentrifuge jedes Reagenz vor dem hinzufügen. Ändern Sie die Pipettenspitze zwischen jedes Reagens zu verhindern Kontamination und korrekte Konzentrationen zu gewährleisten. Nachdem alle Reagenzien hinzugefügt wurden, tube Wirbel und Minicentrifuge mit den master-Mix auf Homogenität zu gewährleisten.
  6. Aliquoten das entsprechende Volumen der master-Mix in jedes gut in 96-Well-PCR-Platte bezeichnet.
  7. Fügen Sie das entsprechende Volumen der (c) DNA-Probe, Positivkontrolle Plasmid und Negativkontrolle (molekulare Grad Wasser) in dafür vorgesehenen Vertiefungen.
  8. Nachdem alle Proben und Kontrollen hinzugefügt wurden, Dichtplatte mit Folie abdichten. Verwenden Sie ein Siegelwerkzeug Luft heraus von unterhalb der Folie und Luftblasen zu verhindern. Kanten der Folie vorsichtig abreißen.
  9. Zentrifugieren der versiegelten 96-Well-Platte in einer Zentrifuge mit Kennzeichenhalter Mischung am unteren Rand jedes gut zu sammeln. Achten Sie darauf, eine Gegengewicht-Platte zu verwenden, um sicherzustellen, dass die Zentrifuge richtig beim Drehen ausgeglichen wird. Impuls bis zu 1000 u/min Zentrifugieren, dann lassen Sie die Zentrifuge langsam ohne Bremsen stoppen.

5. qPCR Betrieb

  1. Platz 96-Well-Platte in qPCR Maschine versiegelt. Stellen Sie sicher, dass diese Maschine zeigt, dass es bereit ist.
  2. Nach den Anweisungen Sie qPCR Maschine richtig geben Sie alle Informationen von Software benötigt, dann setzen Sie qPCR Maschine laufen.
  3. Nach Abschluss der Maschine ausführen wird die Software die bekannten Konzentrationen der Positivkontrolle verwenden, um die Menge der cDNA in jeder Reaktion berechnen können. Die Menge des Virus in der ursprünglichen Probe kann dann berechnet werden, basierend auf der Verdünnung, Filtration, Konzentration, Verstärkung und/oder Abbauverfahren durchgeführt, um die DNA-Probe zu erhalten.
Reagenz Sequenz (5' → 3') Volumen (μL / gut) Endgültige Konz.
Forward Primer GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Rückwärts-Primer TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Sonde FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Tabelle 1. Probe-Primer und Sonde-Sequenzen zur Erkennung von Pfeffer mild Mottle Virus.

Reagenz Volumen (μL / gut) Anzahl der Bohrungen Master Mix Volume (μL)
LC 480 mischen 12.5 26 325
Molekulare H2O 4.5 117
Forward Primer 2.25 58,5
Rückwärts-Primer 2.25 58,5
Sonde 1.0 26
Insgesamt 22.5 585

Tabelle 2. Reagenz Bände für individuelle Reaktion und master-Mix.

Das Aufkommen der quantitative Polymerase-Kettenreaktion oder qPCR, machte es möglich, die Menge jeder Mikroorganismus in einer ökologischen Probe quantitativ zu bestimmen.

Wie standard-PCR identifiziert qPCR Mikroorganismen durch den Nachweis für das Vorhandensein oder Fehlen von DNA-Sequenzen, die spezifisch für die Organismen von Interesse. Dies ermöglicht die Erkennung von Mikroben, die im Labor, die es ermöglichen, ein viel breiteres Spektrum von Umweltorganismen assay kultiviert werden kann nicht. QPCR ermöglicht darüber hinaus die Menge von DNA quantitativ bewertet werden. Aber zur gleichen Zeit erkennen PCR Methoden DNA von allen Organismen tot oder lebendig, denen die Fähigkeit zu suchen nur aktiv wachsende Mikroben in der Probe.

Dieses Video wird die chemische Innovationen, die regulären PCR qPCR unterscheiden, erklären wie qPCR verwendet werden kann, um DNA, quantitativ zu messen überprüfen zeigen ein Protokoll für die Verwendung von qPCR eine RNA-Virus aus Bodenproben zu erkennen, und zu guter Letzt zeigen wie qPCR Umweltmikrobiologie heute angewendet wird.

Die grundlegenden Prinzipien hinter qPCR sind dasselbe wie regelmäßige PCR - wiederholte Zyklen der Grundierung glühen, Vorlage, Dehnung des PCR-Produktes und Denaturierung des Produkts aus Vorlage, führt zu die exponentielle Amplifikation des einer Zielsequenz von Interesse, bekannt als der Amplifikate aus einem Pool von Ausgangsmaterial.

Die Innovation der qPCR macht zusätzlich fluoreszierende Chemikalien in der Reaktion, die die Synthese von PCR-Produkt bei jedem Zyklus direkt in "Real Time" durch spezialisierte Thermocycler visualisiert werden kann, möglich, die Höhe der Vorlage Sequenz in der ursprünglichen Probe zu quantifizieren es. Die Menge ist in der Regel gemessen an der Schwelle-Zyklus, abgekürzt Ct, auch bekannt als die Quantifizierung Zyklus oder C,Q, das die PCR-Zyklus ist bei dem fluoreszierenden Produkte die Hintergrundkonzentration übersteigt.

Quantifizierung kann relativ, sein, wo der C-t -Wert von einer Sequenz mit der einer anderen Norm oder Control Sequence verglichen wird; die relative Menge entspricht zwei potenziert mit der Differenz in Ct. Alternativ eine Reihe von DNA der bekannten Menge neben den Proben in der Reaktion ausgeführt wird, eine Standardkurve Fluoreszenz Wert auf DNA-Menge verglichen hergestellt werden kann, und ermöglicht die Probe DNA, absolut quantitated.

Es gibt zwei Arten von fluoreszierenden Molekülen in qPCR verwendet. In einem Fall fluoreszierende Farbstoffe, die speziell an die doppelsträngige DNA binden ist enthalten in der Reaktion. Der Farbstoff fluoresziert nur, wenn Sie gebunden an der DNA, so dass die Höhe der doppelsträngigen DNA-Produkt zu quantitated werden.

Bei der anderen Methode soll ein kurzes Stück DNA, bekannt als Sonde, gegen eine bestimmte Ziel-Sequenz von Interesse. Die Sonde ist chemisch verbunden ein fluoreszierender Farbstoff sowie ein "Durstlöscher" Molekül, das unterdrückt das Fluoreszenzsignal von der Farbstoff in der Nähe. Die Polymerase-Enzym, das welches das Produkt DNA synthetisiert, hat eine DNA-abbauenden Aktivität, die das fluoreszierende Molekül "freigegeben" werden von der Sonde, so trennt des Farbstoffs aus dem Quencher und ermöglicht das Fluoreszenzsignal erkannt werden verursachen würde.

Nun, da Sie die Prinzipien hinter qPCR zu verstehen, betrachten wir ein Protokoll für die Verwendung dieser Technik zu identifizieren eine RNA-Virus, der Pflanzen, die Paprika mild Mottle Virus aus Bodenproben infiziert.

In dieser Demo werden Probe aus der Rhizosphäre, die Zone des Bodens ca. 7 mm rund um Pflanzenwurzeln gesammelt, die von den Wurzeln und ihre symbiotischen Mikroorganismen beeinflusst wird.

Rhizosphäre Boden zu sammeln, zunächst sorgfältig die Anlage von Interesse aus dem Boden zu extrahieren und traf es, so viel überschüssige Masse entfernen Boden wie möglich. Verpacken Sie die Pflanze für die weitere Verarbeitung im Labor.

Nach bringen die Proben zurück ins Labor, mit einem sterilen Spatel, den gewünschten Boden in ein Auffanggefäß abzuschaffen. Dann das Virus aus dem Boden zu sammeln und die RNA zu extrahieren.

Sobald die Probe RNA entnommen wird, umwandeln Sie es in komplementären oder cDNA über reverse Transkription. Entnehmen Sie bitte der Jupiter-SciEd video-on-reverse Transkription-PCR Einzelheiten dieses Verfahrens.

Wenn Sie bereit sind, die qPCR durchzuführen, Auftauen von gefrorenem Reagenzien bei Raumtemperatur in einer dedizierten Laminar-Flow-Kapuze, und auf Eis einmal aufgetaut. Reagenz-Komponenten, die das Enzym DNA-Polymerase enthalten sollte immer auf Eis gehalten werden.

Tauen Sie die Probe cDNA und eine Positivkontrolle DNA, wie z. B. ein rundes Stück DNA, bekannt als ein Plasmid, das der Amplifikate Interesse hinein geklont hat.

Vor der Montage der Reaktionen in einer 96-Well qPCR-Platte, Vorbereiten einer 96-Zelle Tabellenvorlage auf Papier und beschriften Sie jede Zelle mit der Reaktion, die in die Platte geladen wird. Schließen Sie Reaktionen für jede Probe und Standard in dreifacher Ausfertigung sowie für die positive Kontrolle und Negativkontrolle, wie eine keine-DNA Reaktion.

Berechnen Sie die Reagenz Bände für eine Reaktion "master-Mix", die alle Reagenzien umfasst, die konstant unter die Reaktionen sind erforderlich. Bereiten Sie genügend master-Mix für dreifacher Reaktionen für alle Proben sowie Kontrollen und zusätzlich 10 % zu pipettieren Fehler ausmachen.

Einmal die Reagenzien aufgetaut sind, montieren Sie den master-Mix in einem 1,5 mL niedrig-Adsorption Microfuge Rohr. Dies zu tun, kurz Wirbel jedes Reagenz mischen, sammeln Sie keine Flüssigkeit auf der Seite der Röhrchen mit einer Mini-Zentrifuge, und pipette das Reagenz in das Microfuge Rohr. Achten Sie darauf, neue Pipettenspitzen für jede Reaktion-Komponente verwenden. Nachdem alle Reagenzien sind hinzugekommen, Wirbel zu mischen und Zentrifugieren. Dann aliquoten die entsprechende Menge an master-Mix in die dafür vorgesehenen Vertiefungen auf der PCR-Platte.

Als nächstes Wirbel Zentrifuge jedes Rohr mit Probe und Kontrolle DNA und pipette den entsprechenden Betrag in die jeweiligen Vertiefungen auf der PCR-Platte. Nachdem Proben hinzugefügt wurden, Dichtplatte mit eine Siegelfolie, und verwenden Sie das Siegelwerkzeug zu vollständig glätten das Siegel und eventuelle Luftblasen herausdrücken. Reißen Sie die nichtklebenden Registerkarten von den Enden der Dichtung vorsichtig.

Um das Reaktionsgemisch vollständig in den Boden der Näpfchen zu sammeln, die Reaktion Platte in einer Zentrifuge mit einem Kennzeichenhalter und richtig balancieren des Rotors mit einem Gegengewicht Teller. Puls-Zentrifuge die Platte bis zu 1.000 u/min, dann lassen Sie die Zentrifuge kommen langsam zum Stillstand ohne Bremsen.

Platzieren Sie die Reaktion-Platte in die qPCR-Maschine. Stellen Sie das PCR-Programm entsprechend den Herstellerangaben, Einstellung der Schmelztemperatur nach der Primerpaar verwendet wird. Stellen Sie die Reaktion Programm laufen ein.

Sobald das qPCR-Programm abgeschlossen ist, wird die Software die bekannten Konzentrationen der Positivkontrolle verwenden, um die Menge der cDNA in jeder Reaktion berechnen können. Die Menge des Virus in der ursprünglichen Probe kann dann berechnet werden.

Sobald das qPCR-Programm abgeschlossen ist, wird die Software die bekannten Konzentrationen der Positivkontrolle verwenden, um die Menge der cDNA in jeder Reaktion berechnen können.

Mit den Ergebnissen aus der qPCR, die Lautstärke in den Brunnen, die Extraktion aus dem Boden und aus der reversen Transkription Faktor übertragen kann die Anzahl der Viren in der ersten Bodenprobe berechnet werden.

Nun, Sie wissen, wie qPCR durchgeführt wird, schauen wir wie es verwendet werden, um verschiedenen Umweltproben zu analysieren.

qPCR kann verwendet werden, um die Menge an Viren erholte sich von vielen verschiedenen Arten von Proben zu quantifizieren. In dieser Anwendung wurden zwei verschiedene Arten von Adenoviren konzentriert von Wasserproben durch eine Reihe von verschiedenen Methoden. DNA wurde dann extrahiert von den Viren und qPCR, ausgesetzt, um die relative Effizienz der Konzentration Methoden zu bewerten.

Eine weitere Anwendung für qPCR-basierten mikrobielle Aufzählung ist zu quantifizieren Bakteriengehalt in Lebensmitteln und landwirtschaftlichen Proben - in diesem Beispiel, fäkale und Proben von Hühnerfarmen Wurf. Anstatt auf einzelne Arten, die Wissenschaftler durchgeführt qPCR mit Primer gegen ein hoch konservierte gen in allen Bakterien gefunden und quantifiziert die gesamte Bakteriengemeinschaft in den Proben gefunden.

Schließlich, wie bereits erwähnt, ist ein Nachteil der traditionellen qPCR Methodik, dass lebende und Tote Mikroben unterschieden werden können. Jedoch konnten Forscher hier durch das Hinzufügen einer Chemikalie bekannt als Propidium Monoazide oder PMA, die nur abgestorbene Zellen eingeben können, wo es an DNA bindet, nachfolgende enzymatische Reaktionen wie PCR hemmen, Unterscheidung zwischen lebenden und Toten Kulturen von E. Coli O157: H7, einen gemeinsamen pathogenen Stamm gefunden in kontaminierte Lebensmittel und Wasser.

Sie habe nur Jupiters Einführung zur Quantifizierung der ökologischen Mikroorganismen und Viren mit qPCR beobachtet. Sie sollten jetzt verstehen, wie qPCR funktioniert, wie qPCR verwenden, um die Menge an eine Mikrobe in einem ökologischen Probe und einige Anwendungen dieser Technik messen. Danke fürs Zuschauen!

Applications and Summary

Die Fähigkeit zu quantifizieren gezielter genomische Segment, die Kopien mit der qPCR-Technik in einer Reihe von wissenschaftlichen Bereichen von Bedeutung ist. Anwendungsbeispiele sind:

(1) Krankheitserreger im Wasser, Boden, Nahrung, Oberflächen, etc.auflisten.

Real-Time PCR wird genutzt, um Krankheitserreger in verschiedenen Umgebungen aufgelistet werden. Während der Ausbrüche können die Erreger von Interesse, die Quelle verursacht Verbreitung finden Wasser-und Bodenproben analysiert werden. Die Quelle kann dann weiter analysiert werden, um die Konzentration des Erregers aufzählen und bestimmen die Höhe der Kontamination. Beispielsweise können bei einem Ausbruch des Norovirus auf einem Kreuzfahrtschiff, das schwere Gastroenteritis, Erbrechen und Durchfall, bei den Passagieren verursacht hat, Wasser und Nahrung Proben unterzogen werden Real-Time PCR, die Quelle des Virus, z.B., Wasser, das war nicht richtig behandelt und enthalten hohe fäkale Verunreinigungen zu identifizieren.

(2) messen die Reduktion von pathogenen Mikroben durch Abwasserbehandlung

Rohabwasser Wasser enthält eine Fülle von krankheitserregenden Mikroorganismen und daher muss behandelt werden, um die öffentliche Gesundheit zu schützen. Wasserproben können an verschiedenen Punkten entlang einer Abwasser-Behandlung-Zug abgeholt werden und mittels qPCR zu bestimmen, die Reduktion von pathogenen Mikroorganismen einschließlich Viren analysiert. Die berechnete Abschläge dann liefern wertvolle Informationen über die Wirksamkeit der Verfahren der Abwasser und Wasser Wiederverwendung Anwendungsmöglichkeiten.

(3) Messung der funktionellen Gen Marker in der Umgebung

Mikrobielle Gemeinschaften unterliegen Änderungen in Zusammensetzung und Schwankungen der Aktivität aufgrund von Umweltbelastungen. Diese Verschiebungen können durch Analyse der funktionalen Gene überwacht werden, die durch besondere ökologische Stressoren aktiviert werden könnte. Real-Time PCR lässt sich quantifizieren die Expression dieser Gene in Proben, Änderungen in mikrobiellen Gemeinschaft Aktivität zu überwachen. Beispielsweise kann qPCR mikrobiellen Ökologen, die Expression von Genen aktiviert für biologischen Abbau Bahnen in Anwesenheit von Menschen verursachten Schadstoffe in Böden zu quantifizieren.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

1. die Probenahme

  1. Boden mit einer Schnecke zu sammeln oder zu einer bestimmten Tiefe Schaufel. Wenn Boden von der Rhizosphäre sammeln, sammeln Sie nur Boden innerhalb von 7 mm rund um Pflanzenwurzel, durch überschüssige Erde von der Wurzel schlagen und kratzen gewünschte Boden in ein Fass Sammlung.
  2. Legen Sie eine sterile Nalgene Flasche in DIP Stick. Halten Sie das Ende des Stockes und sammeln Sie Wasser durch Eintauchen der Flasche zu. Stellen Sie die Flasche in eine Kühlbox mit Eis.
  3. Übertragen Sie Proben an das Labor.

(2) Nukleinsäuren Extraktion

  1. Mikroorganismen aus den gesammelten Proben zu isolieren und zu DNA oder RNA extrahieren, bitte sehen Sie das Video Jupiter Science Education Community Nukleinsäure-Extraktion.

3. reverse Transkription

  1. Wenn das Erbgut untersucht wird RNA ist, muss es verwendet werden komplementäre DNA (cDNA) generieren über reverse Transkription vor der PCR. Für Details siehe Jupiter Science Education video auf RT-PCR.

4. Einstellen der qPCR

  1. Abrufen von Reagenzien, die bei-20 ° C gelagert und tauen sie auf Eis oder bei Raumtemperatur innerhalb eine cleane Motorhaube. In diesem Beispiel verwendete Reagenzien enthalten die qPCR Reaktion Mischung (abhängig von der qPCR-Maschine verwendet, enthält DNA-Polymerase), forward und reverse Primer und die TaqMan Sonde. Primer und Sonde Sequenzen sollen mit Sequenzen, die spezifisch für den Organismus, die aufgelistet werden. Beziehen sich auf aktuelle Literatur, Sequenzen von Interesse zu finden. In diesem Beispiel wird das Roche Light Cycler 480 Sonden Reagenz-System verwendet werden. Paprika mild Mottle Virus wird in der Wasserprobe aufgelistet werden. 1, 2 siehe Tabelle 1 für Primer und Sonde Sequenzen.
  2. Tauwetter extrahiert (c) DNA-Proben und die Positivkontrolle DNA (bestehend aus Organismus-spezifische Sequenzen in bakterielle Plasmide kloniert) bei Raumtemperatur.
  3. Vorbereiten einer 96-Zelle Tabellenvorlage, die die qPCR 96-Well-Platte ähnelt. Beschriften Sie jede Zelle mit der Reaktion, die auf der Platte geladen wird. Schließen Sie Reaktionen für jede Probe und Standard in dreifacher Ausfertigung sowie für die positive Kontrolle und Negativkontrolle, wie eine keine-DNA Reaktion.
  4. Berechnen Sie die Reagenz Bände für eine Reaktion "master-Mix", die alle Reagenzien, die konstant unter den Reaktionen umfasst, basierend auf Angaben des Herstellers und der Literatur sind erforderlich. Bereiten Sie genügend master-Mix für dreifacher Reaktionen für alle Proben sowie Kontrollen und zusätzlich 10 % zu pipettieren Fehler ausmachen. Für ein Probe-Master mix Rezept, siehe Tabelle 2.
  5. Arbeiten in einem sauberen Kapuze, sobald alle Reagenzien vollständig aufgetaut sind, fügen Sie berechneten Betrag jedes Reagenz zu einem Schlauch 1,5 mL niedrig-Bindung Microfuge master-Mix zu erstellen hinzu. Wirbel und kurz Minicentrifuge jedes Reagenz vor dem hinzufügen. Ändern Sie die Pipettenspitze zwischen jedes Reagens zu verhindern Kontamination und korrekte Konzentrationen zu gewährleisten. Nachdem alle Reagenzien hinzugefügt wurden, tube Wirbel und Minicentrifuge mit den master-Mix auf Homogenität zu gewährleisten.
  6. Aliquoten das entsprechende Volumen der master-Mix in jedes gut in 96-Well-PCR-Platte bezeichnet.
  7. Fügen Sie das entsprechende Volumen der (c) DNA-Probe, Positivkontrolle Plasmid und Negativkontrolle (molekulare Grad Wasser) in dafür vorgesehenen Vertiefungen.
  8. Nachdem alle Proben und Kontrollen hinzugefügt wurden, Dichtplatte mit Folie abdichten. Verwenden Sie ein Siegelwerkzeug Luft heraus von unterhalb der Folie und Luftblasen zu verhindern. Kanten der Folie vorsichtig abreißen.
  9. Zentrifugieren der versiegelten 96-Well-Platte in einer Zentrifuge mit Kennzeichenhalter Mischung am unteren Rand jedes gut zu sammeln. Achten Sie darauf, eine Gegengewicht-Platte zu verwenden, um sicherzustellen, dass die Zentrifuge richtig beim Drehen ausgeglichen wird. Impuls bis zu 1000 u/min Zentrifugieren, dann lassen Sie die Zentrifuge langsam ohne Bremsen stoppen.

5. qPCR Betrieb

  1. Platz 96-Well-Platte in qPCR Maschine versiegelt. Stellen Sie sicher, dass diese Maschine zeigt, dass es bereit ist.
  2. Nach den Anweisungen Sie qPCR Maschine richtig geben Sie alle Informationen von Software benötigt, dann setzen Sie qPCR Maschine laufen.
  3. Nach Abschluss der Maschine ausführen wird die Software die bekannten Konzentrationen der Positivkontrolle verwenden, um die Menge der cDNA in jeder Reaktion berechnen können. Die Menge des Virus in der ursprünglichen Probe kann dann berechnet werden, basierend auf der Verdünnung, Filtration, Konzentration, Verstärkung und/oder Abbauverfahren durchgeführt, um die DNA-Probe zu erhalten.
Reagenz Sequenz (5' → 3') Volumen (μL / gut) Endgültige Konz.
Forward Primer GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Rückwärts-Primer TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Sonde FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Tabelle 1. Probe-Primer und Sonde-Sequenzen zur Erkennung von Pfeffer mild Mottle Virus.

Reagenz Volumen (μL / gut) Anzahl der Bohrungen Master Mix Volume (μL)
LC 480 mischen 12.5 26 325
Molekulare H2O 4.5 117
Forward Primer 2.25 58,5
Rückwärts-Primer 2.25 58,5
Sonde 1.0 26
Insgesamt 22.5 585

Tabelle 2. Reagenz Bände für individuelle Reaktion und master-Mix.

Das Aufkommen der quantitative Polymerase-Kettenreaktion oder qPCR, machte es möglich, die Menge jeder Mikroorganismus in einer ökologischen Probe quantitativ zu bestimmen.

Wie standard-PCR identifiziert qPCR Mikroorganismen durch den Nachweis für das Vorhandensein oder Fehlen von DNA-Sequenzen, die spezifisch für die Organismen von Interesse. Dies ermöglicht die Erkennung von Mikroben, die im Labor, die es ermöglichen, ein viel breiteres Spektrum von Umweltorganismen assay kultiviert werden kann nicht. QPCR ermöglicht darüber hinaus die Menge von DNA quantitativ bewertet werden. Aber zur gleichen Zeit erkennen PCR Methoden DNA von allen Organismen tot oder lebendig, denen die Fähigkeit zu suchen nur aktiv wachsende Mikroben in der Probe.

Dieses Video wird die chemische Innovationen, die regulären PCR qPCR unterscheiden, erklären wie qPCR verwendet werden kann, um DNA, quantitativ zu messen überprüfen zeigen ein Protokoll für die Verwendung von qPCR eine RNA-Virus aus Bodenproben zu erkennen, und zu guter Letzt zeigen wie qPCR Umweltmikrobiologie heute angewendet wird.

Die grundlegenden Prinzipien hinter qPCR sind dasselbe wie regelmäßige PCR - wiederholte Zyklen der Grundierung glühen, Vorlage, Dehnung des PCR-Produktes und Denaturierung des Produkts aus Vorlage, führt zu die exponentielle Amplifikation des einer Zielsequenz von Interesse, bekannt als der Amplifikate aus einem Pool von Ausgangsmaterial.

Die Innovation der qPCR macht zusätzlich fluoreszierende Chemikalien in der Reaktion, die die Synthese von PCR-Produkt bei jedem Zyklus direkt in "Real Time" durch spezialisierte Thermocycler visualisiert werden kann, möglich, die Höhe der Vorlage Sequenz in der ursprünglichen Probe zu quantifizieren es. Die Menge ist in der Regel gemessen an der Schwelle-Zyklus, abgekürzt Ct, auch bekannt als die Quantifizierung Zyklus oder C,Q, das die PCR-Zyklus ist bei dem fluoreszierenden Produkte die Hintergrundkonzentration übersteigt.

Quantifizierung kann relativ, sein, wo der C-t -Wert von einer Sequenz mit der einer anderen Norm oder Control Sequence verglichen wird; die relative Menge entspricht zwei potenziert mit der Differenz in Ct. Alternativ eine Reihe von DNA der bekannten Menge neben den Proben in der Reaktion ausgeführt wird, eine Standardkurve Fluoreszenz Wert auf DNA-Menge verglichen hergestellt werden kann, und ermöglicht die Probe DNA, absolut quantitated.

Es gibt zwei Arten von fluoreszierenden Molekülen in qPCR verwendet. In einem Fall fluoreszierende Farbstoffe, die speziell an die doppelsträngige DNA binden ist enthalten in der Reaktion. Der Farbstoff fluoresziert nur, wenn Sie gebunden an der DNA, so dass die Höhe der doppelsträngigen DNA-Produkt zu quantitated werden.

Bei der anderen Methode soll ein kurzes Stück DNA, bekannt als Sonde, gegen eine bestimmte Ziel-Sequenz von Interesse. Die Sonde ist chemisch verbunden ein fluoreszierender Farbstoff sowie ein "Durstlöscher" Molekül, das unterdrückt das Fluoreszenzsignal von der Farbstoff in der Nähe. Die Polymerase-Enzym, das welches das Produkt DNA synthetisiert, hat eine DNA-abbauenden Aktivität, die das fluoreszierende Molekül "freigegeben" werden von der Sonde, so trennt des Farbstoffs aus dem Quencher und ermöglicht das Fluoreszenzsignal erkannt werden verursachen würde.

Nun, da Sie die Prinzipien hinter qPCR zu verstehen, betrachten wir ein Protokoll für die Verwendung dieser Technik zu identifizieren eine RNA-Virus, der Pflanzen, die Paprika mild Mottle Virus aus Bodenproben infiziert.

In dieser Demo werden Probe aus der Rhizosphäre, die Zone des Bodens ca. 7 mm rund um Pflanzenwurzeln gesammelt, die von den Wurzeln und ihre symbiotischen Mikroorganismen beeinflusst wird.

Rhizosphäre Boden zu sammeln, zunächst sorgfältig die Anlage von Interesse aus dem Boden zu extrahieren und traf es, so viel überschüssige Masse entfernen Boden wie möglich. Verpacken Sie die Pflanze für die weitere Verarbeitung im Labor.

Nach bringen die Proben zurück ins Labor, mit einem sterilen Spatel, den gewünschten Boden in ein Auffanggefäß abzuschaffen. Dann das Virus aus dem Boden zu sammeln und die RNA zu extrahieren.

Sobald die Probe RNA entnommen wird, umwandeln Sie es in komplementären oder cDNA über reverse Transkription. Entnehmen Sie bitte der Jupiter-SciEd video-on-reverse Transkription-PCR Einzelheiten dieses Verfahrens.

Wenn Sie bereit sind, die qPCR durchzuführen, Auftauen von gefrorenem Reagenzien bei Raumtemperatur in einer dedizierten Laminar-Flow-Kapuze, und auf Eis einmal aufgetaut. Reagenz-Komponenten, die das Enzym DNA-Polymerase enthalten sollte immer auf Eis gehalten werden.

Tauen Sie die Probe cDNA und eine Positivkontrolle DNA, wie z. B. ein rundes Stück DNA, bekannt als ein Plasmid, das der Amplifikate Interesse hinein geklont hat.

Vor der Montage der Reaktionen in einer 96-Well qPCR-Platte, Vorbereiten einer 96-Zelle Tabellenvorlage auf Papier und beschriften Sie jede Zelle mit der Reaktion, die in die Platte geladen wird. Schließen Sie Reaktionen für jede Probe und Standard in dreifacher Ausfertigung sowie für die positive Kontrolle und Negativkontrolle, wie eine keine-DNA Reaktion.

Berechnen Sie die Reagenz Bände für eine Reaktion "master-Mix", die alle Reagenzien umfasst, die konstant unter die Reaktionen sind erforderlich. Bereiten Sie genügend master-Mix für dreifacher Reaktionen für alle Proben sowie Kontrollen und zusätzlich 10 % zu pipettieren Fehler ausmachen.

Einmal die Reagenzien aufgetaut sind, montieren Sie den master-Mix in einem 1,5 mL niedrig-Adsorption Microfuge Rohr. Dies zu tun, kurz Wirbel jedes Reagenz mischen, sammeln Sie keine Flüssigkeit auf der Seite der Röhrchen mit einer Mini-Zentrifuge, und pipette das Reagenz in das Microfuge Rohr. Achten Sie darauf, neue Pipettenspitzen für jede Reaktion-Komponente verwenden. Nachdem alle Reagenzien sind hinzugekommen, Wirbel zu mischen und Zentrifugieren. Dann aliquoten die entsprechende Menge an master-Mix in die dafür vorgesehenen Vertiefungen auf der PCR-Platte.

Als nächstes Wirbel Zentrifuge jedes Rohr mit Probe und Kontrolle DNA und pipette den entsprechenden Betrag in die jeweiligen Vertiefungen auf der PCR-Platte. Nachdem Proben hinzugefügt wurden, Dichtplatte mit eine Siegelfolie, und verwenden Sie das Siegelwerkzeug zu vollständig glätten das Siegel und eventuelle Luftblasen herausdrücken. Reißen Sie die nichtklebenden Registerkarten von den Enden der Dichtung vorsichtig.

Um das Reaktionsgemisch vollständig in den Boden der Näpfchen zu sammeln, die Reaktion Platte in einer Zentrifuge mit einem Kennzeichenhalter und richtig balancieren des Rotors mit einem Gegengewicht Teller. Puls-Zentrifuge die Platte bis zu 1.000 u/min, dann lassen Sie die Zentrifuge kommen langsam zum Stillstand ohne Bremsen.

Platzieren Sie die Reaktion-Platte in die qPCR-Maschine. Stellen Sie das PCR-Programm entsprechend den Herstellerangaben, Einstellung der Schmelztemperatur nach der Primerpaar verwendet wird. Stellen Sie die Reaktion Programm laufen ein.

Sobald das qPCR-Programm abgeschlossen ist, wird die Software die bekannten Konzentrationen der Positivkontrolle verwenden, um die Menge der cDNA in jeder Reaktion berechnen können. Die Menge des Virus in der ursprünglichen Probe kann dann berechnet werden.

Sobald das qPCR-Programm abgeschlossen ist, wird die Software die bekannten Konzentrationen der Positivkontrolle verwenden, um die Menge der cDNA in jeder Reaktion berechnen können.

Mit den Ergebnissen aus der qPCR, die Lautstärke in den Brunnen, die Extraktion aus dem Boden und aus der reversen Transkription Faktor übertragen kann die Anzahl der Viren in der ersten Bodenprobe berechnet werden.

Nun, Sie wissen, wie qPCR durchgeführt wird, schauen wir wie es verwendet werden, um verschiedenen Umweltproben zu analysieren.

qPCR kann verwendet werden, um die Menge an Viren erholte sich von vielen verschiedenen Arten von Proben zu quantifizieren. In dieser Anwendung wurden zwei verschiedene Arten von Adenoviren konzentriert von Wasserproben durch eine Reihe von verschiedenen Methoden. DNA wurde dann extrahiert von den Viren und qPCR, ausgesetzt, um die relative Effizienz der Konzentration Methoden zu bewerten.

Eine weitere Anwendung für qPCR-basierten mikrobielle Aufzählung ist zu quantifizieren Bakteriengehalt in Lebensmitteln und landwirtschaftlichen Proben - in diesem Beispiel, fäkale und Proben von Hühnerfarmen Wurf. Anstatt auf einzelne Arten, die Wissenschaftler durchgeführt qPCR mit Primer gegen ein hoch konservierte gen in allen Bakterien gefunden und quantifiziert die gesamte Bakteriengemeinschaft in den Proben gefunden.

Schließlich, wie bereits erwähnt, ist ein Nachteil der traditionellen qPCR Methodik, dass lebende und Tote Mikroben unterschieden werden können. Jedoch konnten Forscher hier durch das Hinzufügen einer Chemikalie bekannt als Propidium Monoazide oder PMA, die nur abgestorbene Zellen eingeben können, wo es an DNA bindet, nachfolgende enzymatische Reaktionen wie PCR hemmen, Unterscheidung zwischen lebenden und Toten Kulturen von E. Coli O157: H7, einen gemeinsamen pathogenen Stamm gefunden in kontaminierte Lebensmittel und Wasser.

Sie habe nur Jupiters Einführung zur Quantifizierung der ökologischen Mikroorganismen und Viren mit qPCR beobachtet. Sie sollten jetzt verstehen, wie qPCR funktioniert, wie qPCR verwenden, um die Menge an eine Mikrobe in einem ökologischen Probe und einige Anwendungen dieser Technik messen. Danke fürs Zuschauen!

A subscription to JoVE is required to view this article.
You will only be able to see the first 20 seconds.

RECOMMEND JoVE