-1::1
Simple Hit Counter
Skip to content

Products

Solutions

×
×
Sign In

EN

EN - EnglishCN - 简体中文DE - DeutschES - EspañolKR - 한국어IT - ItalianoFR - FrançaisPT - Português do BrasilPL - PolskiHE - עִבְרִיתRU - РусскийJA - 日本語TR - TürkçeAR - العربية
Sign In Start Free Trial

RESEARCH

JoVE Journal

Peer reviewed scientific video journal

Behavior
Biochemistry
Bioengineering
Biology
Cancer Research
Chemistry
Developmental Biology
View All
JoVE Encyclopedia of Experiments

Video encyclopedia of advanced research methods

Biological Techniques
Biology
Cancer Research
Immunology
Neuroscience
Microbiology
JoVE Visualize

Visualizing science through experiment videos

EDUCATION

JoVE Core

Video textbooks for undergraduate courses

Analytical Chemistry
Anatomy and Physiology
Biology
Cell Biology
Chemistry
Civil Engineering
Electrical Engineering
View All
JoVE Science Education

Visual demonstrations of key scientific experiments

Advanced Biology
Basic Biology
Chemistry
View All
JoVE Lab Manual

Videos of experiments for undergraduate lab courses

Biology
Chemistry

BUSINESS

JoVE Business

Video textbooks for business education

Accounting
Finance
Macroeconomics
Marketing
Microeconomics

OTHERS

JoVE Quiz

Interactive video based quizzes for formative assessments

Authors

Teaching Faculty

Librarians

K12 Schools

Biopharma

Products

RESEARCH

JoVE Journal

Peer reviewed scientific video journal

JoVE Encyclopedia of Experiments

Video encyclopedia of advanced research methods

JoVE Visualize

Visualizing science through experiment videos

EDUCATION

JoVE Core

Video textbooks for undergraduates

JoVE Science Education

Visual demonstrations of key scientific experiments

JoVE Lab Manual

Videos of experiments for undergraduate lab courses

BUSINESS

JoVE Business

Video textbooks for business education

OTHERS

JoVE Quiz

Interactive video based quizzes for formative assessments

Solutions

Authors
Teaching Faculty
Librarians
K12 Schools
Biopharma

Language

English

EN

English

CN

简体中文

DE

Deutsch

ES

Español

KR

한국어

IT

Italiano

FR

Français

PT

Português do Brasil

PL

Polski

HE

עִבְרִית

RU

Русский

JA

日本語

TR

Türkçe

AR

العربية

    Menu

    JoVE Journal

    Behavior

    Biochemistry

    Bioengineering

    Biology

    Cancer Research

    Chemistry

    Developmental Biology

    Engineering

    Environment

    Genetics

    Immunology and Infection

    Medicine

    Neuroscience

    Menu

    JoVE Encyclopedia of Experiments

    Biological Techniques

    Biology

    Cancer Research

    Immunology

    Neuroscience

    Microbiology

    Menu

    JoVE Core

    Analytical Chemistry

    Anatomy and Physiology

    Biology

    Cell Biology

    Chemistry

    Civil Engineering

    Electrical Engineering

    Introduction to Psychology

    Mechanical Engineering

    Medical-Surgical Nursing

    View All

    Menu

    JoVE Science Education

    Advanced Biology

    Basic Biology

    Chemistry

    Clinical Skills

    Engineering

    Environmental Sciences

    Physics

    Psychology

    View All

    Menu

    JoVE Lab Manual

    Biology

    Chemistry

    Menu

    JoVE Business

    Accounting

    Finance

    Macroeconomics

    Marketing

    Microeconomics

Start Free Trial
Loading...
Home
JoVE Science Education
Environmental Sciences
Quantifying Environmental Microorganisms and Viruses Using qPCR
Quantifying Environmental Microorganisms and Viruses Using qPCR
JoVE Science Education
Environmental Microbiology
A subscription to JoVE is required to view this content.  Sign in or start your free trial.
JoVE Science Education Environmental Microbiology
Quantifying Environmental Microorganisms and Viruses Using qPCR

2.9: Quantifying Environmental Microorganisms and Viruses Using qPCR

53,130 Views
09:57 min
February 23, 2015

Overview

Source: Laboratories of Dr. Ian Pepper and Dr. Charles Gerba - The University of Arizona
Demonstrating Author: Bradley Schmitz

Quantitative polymerase chain reaction (qPCR), also known as real-time PCR, is a widely-used molecular technique for enumerating microorganisms in the environment. Prior to this approach, quantifying microorganisms was limited largely to classical culture-based techniques. However, the culturing of microbes from environmental samples can be particularly challenging, and it is generally held that as few as 1 to 10% of the microorganisms present within environmental samples are detectable using these techniques. The advent of qPCR in environmental microbiology research has therefore advanced the field greatly by allowing for more accurate determination of concentrations of microorganisms such as disease-causing pathogens in environmental samples. However, an important limitation of qPCR as an applied microbiological technique is that living, viable populations cannot be differentiated from inactive or non-living populations.

This video demonstrates the use of qPCR to detect pepper mild mottle virus from an environmental water sample.

Procedure

1. Sample Collection

  1. Collect soil using an auger or shovel to a determined depth. If collecting soil from the rhizosphere, only collect soil within 7 mm around plant root, by hitting excess soil off the root and scraping desired soil into a collection barrel.
  2. Place a sterile Nalgene bottle into dipping stick. Hold the end of the stick and collect water by submerging bottle. Place bottle into a cooler with ice.
  3. Transfer samples to the laboratory.

2. Nucleic Acids Extraction

  1. To isolate microorganisms from the collected samples and to extract DNA and/or RNA from them, please see the JoVE Science Education video on community nucleic acid extraction.

3. Reverse Transcription

  1. If the genetic material being assayed is RNA, it must be used to generate complementary DNA (cDNA) via reverse transcription before proceeding to PCR. For details, please refer to JoVE Science Education video on RT-PCR.

4. Setting up qPCR

  1. Retrieve reagents stored at -20 °C, and thaw them on ice or at room temperature inside a clean hood. Reagents used in this example include the qPCR reaction mix (dependent on the qPCR machine used; contains DNA polymerase), forward and reverse primers, and the TaqMan probe. The primer and probe sequences are designed with sequences specific to the organism that is being enumerated. Refer to current literature to find sequences of interest. In this example, the Roche Light Cycler 480 Probes Mix reagent system will be used. Pepper mild mottle virus will be enumerated in the water sample.1,2 See Table 1 for primer and probe sequences.
  2. Thaw extracted (c)DNA from samples and the positive control DNA (which consists of organism-specific sequences cloned into bacterial plasmids) at room temperature.
  3. Prepare a 96-cell table template that resembles the 96-well qPCR plate. Label each cell with the reaction that will be loaded onto the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.
  4. Calculate the reagent volumes needed for a reaction “master mix”, which includes all of the reagents that are constant among the reactions, based on manufacturer’s instructions and the literature. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error. For a sample master mix recipe, refer to Table 2.
  5. Working inside a clean hood, once all reagents are completely thawed, add calculated amount of each reagent into a 1.5-mL low-binding microfuge tube to create master mix. Vortex and briefly minicentrifuge each reagent before adding. Change pipette tip between each reagent to prevent contamination and ensure correct concentrations. After all reagents have been added, vortex and minicentrifuge tube with the master mix to ensure homogeneity.
  6. Aliquot the appropriate volume of master mix into each designated well in the 96-well PCR plate.
  7. Add the appropriate volume of (c)DNA sample, positive control plasmid, and negative control (molecular grade water) into designated wells.
  8. Once all samples and controls have been added, seal plate with sealing foil. Use a sealing tool to push air out from underneath the foil and prevent bubbles. Tear off edges of the foil carefully.
  9. Centrifuge the sealed 96-well plate in a centrifuge with a plate-holder to gather mixture at the bottom of each well. Make sure to use a counterweight plate to ensure that the centrifuge will be properly balanced while rotating. Pulse centrifuge up to 1000 rpm, then let the centrifuge slowly stop without brakes.

5. qPCR Operation

  1. Place sealed 96-well plate into qPCR machine. Ensure that machine indicates it is ready to start.
  2. Follow qPCR machine instructions to properly input all information needed by software, then set qPCR machine to run.
  3. After machine completes run, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated, based on the dilution, filtration, concentration, amplification, and/or extraction processes performed to obtain the DNA sample.
Reagent Sequence (5’ → 3’) Volume (μL / well) Final Conc.
Forward Primer GAGTGGTTTGACCTTAACGT­TTGA 2.25 900 nM
Reverse Primer TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Probe FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Table 1. Sample primer and probe sequences for detecting pepper mild mottle virus.

Reagent Volume (μL / well) Number of Wells Master Mix Volume (μL)
LC 480 Mix 12.5 26 325
Molecular H2O 4.5 117
Forward Primer 2.25 58.5
Reverse Primer 2.25 58.5
Probe 1.0 26
Total 22.5 585

Table 2. Reagent volumes for individual reaction and master mix.

The advent of quantitative polymerase chain reaction, or qPCR, has made it possible to quantitatively determine the amount of any microorganism in an environmental sample.

Like standard PCR, qPCR identifies microorganisms by detecting for the presence or absence of DNA sequences specific to the organisms of interest. This allows for the detection of microbes that cannot be cultured in lab, making it possible to assay a much wider range of environmental organisms. In addition, qPCR allows the amount of DNA to be quantitatively assessed. But at the same time, PCR methodologies detect DNA from all organisms dead or alive, limiting the ability to only look for actively growing microbes in the sample.

This video will review the chemical innovations that distinguish qPCR from regular PCR, explain how qPCR can be used to quantitatively measure DNA, demonstrate a protocol for using qPCR to detect an RNA virus from soil samples, and finally, show how qPCR is being applied to environmental microbiology today.

The basic principles behind qPCR are the same as regular PCR - repeated cycles of primer annealing to template, elongation of PCR product, and denaturation of product from template, leading to the exponential amplification of a target sequence of interest, known as the amplicon, from a pool of starting material.

The innovation of qPCR is in the addition of fluorescent chemicals into the reaction, which allows the synthesis of PCR product at each cycle to be directly visualized in "real time" by specialized thermocyclers, making it possible to quantify the amount of template sequence in the original sample. The quantity is usually measured in terms of the threshold cycle, abbreviated Ct, also known as the quantification cycle or Cq, which is the PCR cycle at which the amount of fluorescent products exceeds the background level.

Quantification can be relative, where the Ct value of one sequence is compared to that of another standard or control sequence; the relative quantity is equal to two raised to the power of the difference in Ct. Alternatively, if a series of DNA of known quantity is run alongside the samples in the reaction, a standard curve comparing fluorescence value to DNA amount can be produced, and allows the sample DNA to be quantitated absolutely.

There are two broad types of fluorescent molecules used in qPCR. In one case, fluorescent dyes that bind specifically to double-stranded DNA is included in the reaction. The dye only fluoresces when bound to DNA, thus allowing the amount of double-stranded DNA product to be quantitated.

In the other method, a short stretch of DNA, known as a probe, is designed against a specific target sequence of interest. The probe is chemically attached to a fluorescent dye as well as a "quencher" molecule that suppresses the fluorescence signal from the dye when in close proximity. The polymerase enzyme, which synthesizes the DNA product, has a DNA-degrading activity that would cause the fluorescent molecule to be "released" from the probe, thus separating the dye from the quencher and allowing the fluorescence signal to be detected.

Now that you understand the principles behind qPCR, let's look at a protocol for using this technique to identifying an RNA virus that infects plants, the pepper mild mottle virus, from soil samples.

In this demonstration, sample will be collected from the rhizosphere, the zone of soil approximately 7 mm around plant roots that is influenced by the roots and their symbiotic microorganisms.

To collect rhizosphere soil, first carefully extract the plant of interest from the ground, and hit it to remove as much excess bulk soil as possible. Package the plant for further processing in the lab.

After bringing the samples back to the lab, use a sterile spatula to scrap the desired soil into a collection vessel. Then, collect the virus from the soil and extract the RNA.

Once RNA is collected from the sample, convert it into complementary or cDNA via reverse transcription. Please refer to the JoVE SciEd video on reverse transcription-PCR for details of this procedure.

When ready to perform the qPCR, thaw frozen reagents at room temperature inside a dedicated laminar flow hood, and place on ice once thawed. Reagent components containing the DNA polymerase enzyme should always be kept on ice.

Thaw the sample cDNA and a positive control DNA, such as a circular piece of DNA known as a plasmid that has the amplicon of interest cloned into it.

Before assembling the reactions in a 96-well qPCR plate, prepare a 96-cell table template on paper, and label each cell with the reaction that will be loaded into the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.

Calculate the reagent volumes needed for a reaction "master mix", which includes all of the reagents that are constant among the reactions. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error.

Once the reagents are thawed, assemble the master mix in a 1.5-mL low-adsorption microfuge tube. To do this, briefly vortex each reagent to mix thoroughly, collect any liquid on the side of the tubes using a mini-centrifuge, and pipette the reagent into the microfuge tube. Be sure to use new pipette tips for each reaction component. After all reagents have been added, vortex to mix and centrifuge. Then, aliquot the appropriate amount of master mix into the designated wells on the PCR plate.

Next, vortex and centrifuge each tube with sample and control DNA, and pipette the appropriate amount into the respective wells on the PCR plate. Once samples have been added, seal the plate with a sealing foil, and use the sealing tool to fully flatten the seal and push out any air bubbles. Carefully tear off the non-adhesive tabs from the ends of the seal.

To fully collect the reaction mixture into the bottom of the wells, place the reaction plate into a centrifuge with a plate-holder and properly balance the rotor with a counterweight plate. Pulse-centrifuge the plate up to 1,000 rpm, then let the centrifuge slowly come to a stop without brakes.

Place the reaction plate into the qPCR machine. Set the PCR program according to the manufacturer's specification, setting the melting temperature according to the primer pair being used. Set the reaction program to run.

Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated.

Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction.

With the results from the qPCR, the volume transferred into the wells, the extraction from soil, and the factor from the reverse transcription, the number of viruses in the initial soil sample can be calculated.

Now that you know how qPCR is performed, let's look at how it can be used to analyze different environmental samples.

qPCR can be used to quantify the amount of viruses recovered from many different types of samples. In this application, two different kinds of adenoviruses were concentrated from water samples by a number of different methods. DNA was then extracted from the viruses and subjected to qPCR, to evaluate the relative efficiency of the concentration methods.

Another application for qPCR-based microbial enumeration is to quantify bacterial content in food and agricultural samples - in this example, fecal and litter samples from chicken farms. Rather than targeting individual species, the scientists performed qPCR using primers against a highly conserved gene found in all bacteria and quantified the total bacterial community found in the samples.

Finally, as mentioned earlier, one disadvantage of traditional qPCR methodology is that live and dead microbes cannot be distinguished. However, by adding a chemical known as propidium monoazide, or PMA, which can only enter dead cells where it binds to DNA to inhibit subsequent enzymatic reactions such as PCR, researchers here were able to distinguish between live and dead cultures of E. coli O157:H7, a common pathogenic strain found in contaminated food and water.

You've just watched JoVE's introduction to quantifying environmental microorganisms and viruses using qPCR. You should now understand how qPCR works, how to use qPCR to measure the amount of a microbe in an environmental sample, and some applications of this technique. Thanks for watching!

Transcript

The advent of quantitative polymerase chain reaction, or qPCR, has made it possible to quantitatively determine the amount of any microorganism in an environmental sample.

Like standard PCR, qPCR identifies microorganisms by detecting for the presence or absence of DNA sequences specific to the organisms of interest. This allows for the detection of microbes that cannot be cultured in lab, making it possible to assay a much wider range of environmental organisms. In addition, qPCR allows the amount of DNA to be quantitatively assessed. But at the same time, PCR methodologies detect DNA from all organisms dead or alive, limiting the ability to only look for actively growing microbes in the sample.

This video will review the chemical innovations that distinguish qPCR from regular PCR, explain how qPCR can be used to quantitatively measure DNA, demonstrate a protocol for using qPCR to detect an RNA virus from soil samples, and finally, show how qPCR is being applied to environmental microbiology today.

The basic principles behind qPCR are the same as regular PCR - repeated cycles of primer annealing to template, elongation of PCR product, and denaturation of product from template, leading to the exponential amplification of a target sequence of interest, known as the amplicon, from a pool of starting material.

The innovation of qPCR is in the addition of fluorescent chemicals into the reaction, which allows the synthesis of PCR product at each cycle to be directly visualized in "real time" by specialized thermocyclers, making it possible to quantify the amount of template sequence in the original sample. The quantity is usually measured in terms of the threshold cycle, abbreviated Ct, also known as the quantification cycle or Cq, which is the PCR cycle at which the amount of fluorescent products exceeds the background level.

Quantification can be relative, where the Ct value of one sequence is compared to that of another standard or control sequence; the relative quantity is equal to two raised to the power of the difference in Ct. Alternatively, if a series of DNA of known quantity is run alongside the samples in the reaction, a standard curve comparing fluorescence value to DNA amount can be produced, and allows the sample DNA to be quantitated absolutely.

There are two broad types of fluorescent molecules used in qPCR. In one case, fluorescent dyes that bind specifically to double-stranded DNA is included in the reaction. The dye only fluoresces when bound to DNA, thus allowing the amount of double-stranded DNA product to be quantitated.

In the other method, a short stretch of DNA, known as a probe, is designed against a specific target sequence of interest. The probe is chemically attached to a fluorescent dye as well as a "quencher" molecule that suppresses the fluorescence signal from the dye when in close proximity. The polymerase enzyme, which synthesizes the DNA product, has a DNA-degrading activity that would cause the fluorescent molecule to be "released" from the probe, thus separating the dye from the quencher and allowing the fluorescence signal to be detected.

Now that you understand the principles behind qPCR, let's look at a protocol for using this technique to identifying an RNA virus that infects plants, the pepper mild mottle virus, from soil samples.

In this demonstration, sample will be collected from the rhizosphere, the zone of soil approximately 7 mm around plant roots that is influenced by the roots and their symbiotic microorganisms.

To collect rhizosphere soil, first carefully extract the plant of interest from the ground, and hit it to remove as much excess bulk soil as possible. Package the plant for further processing in the lab.

After bringing the samples back to the lab, use a sterile spatula to scrap the desired soil into a collection vessel. Then, collect the virus from the soil and extract the RNA.

Once RNA is collected from the sample, convert it into complementary or cDNA via reverse transcription. Please refer to the JoVE SciEd video on reverse transcription-PCR for details of this procedure.

When ready to perform the qPCR, thaw frozen reagents at room temperature inside a dedicated laminar flow hood, and place on ice once thawed. Reagent components containing the DNA polymerase enzyme should always be kept on ice.

Thaw the sample cDNA and a positive control DNA, such as a circular piece of DNA known as a plasmid that has the amplicon of interest cloned into it.

Before assembling the reactions in a 96-well qPCR plate, prepare a 96-cell table template on paper, and label each cell with the reaction that will be loaded into the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.

Calculate the reagent volumes needed for a reaction "master mix", which includes all of the reagents that are constant among the reactions. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error.

Once the reagents are thawed, assemble the master mix in a 1.5-mL low-adsorption microfuge tube. To do this, briefly vortex each reagent to mix thoroughly, collect any liquid on the side of the tubes using a mini-centrifuge, and pipette the reagent into the microfuge tube. Be sure to use new pipette tips for each reaction component. After all reagents have been added, vortex to mix and centrifuge. Then, aliquot the appropriate amount of master mix into the designated wells on the PCR plate.

Next, vortex and centrifuge each tube with sample and control DNA, and pipette the appropriate amount into the respective wells on the PCR plate. Once samples have been added, seal the plate with a sealing foil, and use the sealing tool to fully flatten the seal and push out any air bubbles. Carefully tear off the non-adhesive tabs from the ends of the seal.

To fully collect the reaction mixture into the bottom of the wells, place the reaction plate into a centrifuge with a plate-holder and properly balance the rotor with a counterweight plate. Pulse-centrifuge the plate up to 1,000 rpm, then let the centrifuge slowly come to a stop without brakes.

Place the reaction plate into the qPCR machine. Set the PCR program according to the manufacturer's specification, setting the melting temperature according to the primer pair being used. Set the reaction program to run.

Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated.

Once the qPCR program is completed, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction.

With the results from the qPCR, the volume transferred into the wells, the extraction from soil, and the factor from the reverse transcription, the number of viruses in the initial soil sample can be calculated.

Now that you know how qPCR is performed, let's look at how it can be used to analyze different environmental samples.

qPCR can be used to quantify the amount of viruses recovered from many different types of samples. In this application, two different kinds of adenoviruses were concentrated from water samples by a number of different methods. DNA was then extracted from the viruses and subjected to qPCR, to evaluate the relative efficiency of the concentration methods.

Another application for qPCR-based microbial enumeration is to quantify bacterial content in food and agricultural samples - in this example, fecal and litter samples from chicken farms. Rather than targeting individual species, the scientists performed qPCR using primers against a highly conserved gene found in all bacteria and quantified the total bacterial community found in the samples.

Finally, as mentioned earlier, one disadvantage of traditional qPCR methodology is that live and dead microbes cannot be distinguished. However, by adding a chemical known as propidium monoazide, or PMA, which can only enter dead cells where it binds to DNA to inhibit subsequent enzymatic reactions such as PCR, researchers here were able to distinguish between live and dead cultures of E. coli O157:H7, a common pathogenic strain found in contaminated food and water.

You've just watched JoVE's introduction to quantifying environmental microorganisms and viruses using qPCR. You should now understand how qPCR works, how to use qPCR to measure the amount of a microbe in an environmental sample, and some applications of this technique. Thanks for watching!

Explore More Videos

Quantitative Polymerase Chain ReactionQPCRMicroorganismsVirusesEnvironmental SampleDNA SequencesMicrobial DetectionPCR MethodologiesActively Growing MicrobesChemical InnovationsRNA VirusSoil SamplesEnvironmental Microbiology

Related Videos

Determination of Moisture Content in Soil

06:16

Determination of Moisture Content in Soil

Environmental Microbiology

363.4K Views

Aseptic Technique in Environmental Science

10:48

Aseptic Technique in Environmental Science

Environmental Microbiology

132.0K Views

Gram Staining of Bacteria from Environmental Sources

09:31

Gram Staining of Bacteria from Environmental Sources

Environmental Microbiology

106.3K Views

Visualizing Soil Microorganisms via the Contact Slide Assay and Microscopy

10:04

Visualizing Soil Microorganisms via the Contact Slide Assay and Microscopy

Environmental Microbiology

43.9K Views

Filamentous Fungi

08:58

Filamentous Fungi

Environmental Microbiology

61.5K Views

Community DNA Extraction from Bacterial Colonies

09:59

Community DNA Extraction from Bacterial Colonies

Environmental Microbiology

30.2K Views

Detecting Environmental Microorganisms with the Polymerase Chain Reaction and Gel Electrophoresis

13:34

Detecting Environmental Microorganisms with the Polymerase Chain Reaction and Gel Electrophoresis

Environmental Microbiology

46.9K Views

RNA Analysis of Environmental Samples Using RT-PCR

12:04

RNA Analysis of Environmental Samples Using RT-PCR

Environmental Microbiology

43.9K Views

Water Quality Analysis via Indicator Organisms

08:17

Water Quality Analysis via Indicator Organisms

Environmental Microbiology

31.1K Views

Isolation of Fecal Bacteria from Water Samples by Filtration

10:58

Isolation of Fecal Bacteria from Water Samples by Filtration

Environmental Microbiology

42.8K Views

Detection of Bacteriophages in Environmental Samples

09:17

Detection of Bacteriophages in Environmental Samples

Environmental Microbiology

43.7K Views

Culturing and Enumerating Bacteria from Soil Samples

10:57

Culturing and Enumerating Bacteria from Soil Samples

Environmental Microbiology

188.4K Views

Bacterial Growth Curve Analysis and its Environmental Applications

12:23

Bacterial Growth Curve Analysis and its Environmental Applications

Environmental Microbiology

302.5K Views

Algae Enumeration via Culturable Methodology

09:29

Algae Enumeration via Culturable Methodology

Environmental Microbiology

14.6K Views

JoVE logo
Contact Us Recommend to Library
Research
  • JoVE Journal
  • JoVE Encyclopedia of Experiments
  • JoVE Visualize
Business
  • JoVE Business
Education
  • JoVE Core
  • JoVE Science Education
  • JoVE Lab Manual
  • JoVE Quizzes
Solutions
  • Authors
  • Teaching Faculty
  • Librarians
  • K12 Schools
  • Biopharma
About JoVE
  • Overview
  • Leadership
Others
  • JoVE Newsletters
  • JoVE Help Center
  • Blogs
  • Site Maps
Contact Us Recommend to Library
JoVE logo

Copyright © 2026 MyJoVE Corporation. All rights reserved

Privacy Terms of Use Policies
WeChat QR code