Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Identifiering av doi: 10.3791/50156 Published: February 1, 2013

Summary

En metod för att identifiera okända förare av karcinogenes användning av en opartisk tillvägagångssätt beskrivs. Metoden använder

Abstract

Genomiska, proteomik, transcriptomic och epigenomic analyser av humana tumörer tyder på att det finns tusentals anomalier inom varje cancer genomet jämfört med matchade normal vävnad. Baserat på dessa analyser är det uppenbart att det finns många oupptäckta genetiska förare av cancer 1. Tyvärr dessa drivrutiner är dolda i ett mycket större antal passagerare avvikelser i genomet som inte direkt bidrar till tumörbildning. En annan aspekt av cancer genomet är att det finns en stor genetisk heterogenitet inom liknande tumörtyper. Varje tumör kan hysa olika mutationer som ger en selektiv fördel för tumörbildning 2. Utföra en opartisk framåt genetisk skärm i möss ger förutsättningar för att generera tumörer och analysera deras genetiska sammansättning, samtidigt som bakgrunden för passagerare mutationer. The Sleeping Beauty (SB) transposon system är en sådan metod 3. SB-systemet utnyttjar mobil vavskärmare (transposoner) som kan införas i hela genomet genom den transposas enzymet. Mutationer är begränsade till en specifik celltyp genom användning av en villkorlig transposas allel som aktiveras av Cre-rekombinas. Många muslinjer existerar som uttrycker Cre-rekombinas i specifika vävnader. Genom att korsa en av dessa linjer till den villkorade transposaset allelen (t.ex. Lox-stop-Lox-SB11) är SB-systemet aktiveras endast i celler som uttrycker Cre rekombinas. Cre rekombinas kommer punktskatt stopp kassett som blockerar uttrycket av transposas allelen, därigenom aktivera transposon mutagenes inom den angivna celltypen. En SB skärm initieras genom avel tre stammar av transgena möss så att de experimentella mössen bär en villkorlig transposas allel, en konkatamer av transposoner och en vävnadsspecifik Cre-rekombinas allel. Dessa möss får ålder tills tumörer form och de blir döende. Mössen är sedanobduceras och genomiskt DNA isoleras från tumörerna. Därefter är det genomiska DNA utsattes för linker-medierad-PCR (LM-PCR) som resulterar i amplifiering av genomiska loci innehållande en SB transposon. LM-PCR utförs på en enda tumör kommer att resultera i hundratals olika amplikoner representerar hundratals genomiska loci innehåller transposoninsättningar i en enda tumör 4. De transposoninsättningar i alla tumörer analyseras och gemensamma insertionsställen (CISS) identifieras med hjälp av en lämplig statistisk metod 5. Gener inom OSS är mycket sannolikt att onkogener eller tumörsuppressorgener, och anses kandidat cancer gener. Fördelarna med att använda SB-systemet för att identifiera gener kandidat cancer är: 1) transposonen kan lätt lokaliseras i genomet, eftersom dess sekvens är känd, 2) kan riktas till nästan alla celltyper och 3) transposonen kan införlivandet införa både vinst-och förlust-av-funktion mutationer 6. Den following-protokollet beskriver hur man utforma och genomföra en framåt genetisk skärmen med hjälp av SB transposonen för att identifiera gener kandidat cancer (figur 1).

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Avel och åldrande av transgena djur

  1. Välj stammar av transgena möss som är lämpliga för experimentet. Ett typiskt experiment kommer att använda tre transgena linjer, ett villkorat transposas mus, en mus hyser en konkatamer av transposoner, och en mus som uttrycker Cre rekombinas i cellerna tros vara cellerna ursprungsreglerna för önskad cancer. Om cancern som modelleras har en känd mutation i en stor andel av patienter kan det vara önskvärt att inkludera denna mutation vid starten. Exempel på dessa "predisponerande" mutationer inkluderar aktiverade Kras, dominanta negativa TP53 eller en floxade PTEN allel. Genom att lägga till en predisponerande mutation modellen kan bättre representera den mänskliga cancer (se 1.3). Flera Törnrosa transposas och möss transposon är tillgängliga från National Cancer Institute Mouse Repository ( http://mouse.ncifcrf.gov/ ).
  2. Ras villkorliga transposas möss med möss som härbärgerar transposonerna att slutligen erhålla möss homozygota för båda allelerna om möjligt. Ras homozygot avkomma till möss som uttrycker Cre rekombinas för att skapa din trippel transgena experimentella möss (Figur 2). Obs: Skaffa homozygota möss är inte alltid möjligt eller ideal. Till exempel, homozygota p53 dominanta negativa möss är mycket svårare att föda än heterozygota möss. Dessutom är det bra att se till att kullar följer Mendels genetik för att bekräfta att avel systemet är framgångsrikt.
  3. Om använder en predisponerad bakgrund, första ras-möss med transposaset till möss med den predisponerande allelen. Samtidigt ras möss som uttrycker Cre-rekombinas för möss som bär transposoner. Skapa homozygota möss för varje allel om möjligt. Slutligen föder den homozygota avkomma från de tidigare två avel program för att generera fyrdubbla transgen experimentell AnimALS.
  4. Utöver de försöksdjur generera kontroll grupper av möss. Kontrollgruppen består normalt av kullsyskon från den experimentella avel som endast ärver två av de tre allelerna (figur 2). I fallet med en predisponerad bakgrund, kommer möss inkluderande tre av de fyra alleler också vara nödvändigt.
  5. Övervaka försöksgrupp och kontrollgrupp möss dagligen för tumörutveckling och / eller moribundity. Följ din institutioner djuromsorg och använda kommitté (IACUC) krav på djurhållning. Dessutom är det typiskt att bestämma en tid då du kommer att offra ett djur, om den ännu inte har blivit döende. Arton månader är en typisk ålder då möss avlivas.

2. Nekropsi av transgena djur

Namnet av reagenset Företag Katalognummer
Sure-Seal induktivning Chamber Brain Tree Vetenskaplig EZ-177
Köldkärlet Bioexpress C-3355-2
10% buffrad formalin Sigma Aldrich HT501128-4L

Tabell 1. Reagenser krävs.

  1. När en mus är döende eller har nått slutet av den bestämda livslängd, avliva djur med hjälp av en CO 2 kammare efter dina IACUC riktlinjer. Generellt placerar djuret i en ren gaskammare öppnar bensintanken och justera regulatorn att läsa inte är högre än 5 pounds per kvadrattum. Fyll långsamt för att minimera nasal och okulär irritation och motvilja till CO 2. Se till att djurets hjärta inte längre slog och svarar inte vid beröring i ögat.
  2. Sprej utsida avlivades musen med 70% etanol.
  3. Placera musen på en obduktion ombord och säkra med dissekera stift. Använd sax end pincett för att öppna musen och ta bort organ. Avgöra vilka organ bör samlas är projektet beroende. Det rekommenderas att alltid hämta mjälte och lever som dessa organ ger ofta viktiga insikter om varför musen var döende. Också samla bröstbenet för den potentiella analysen av benmärg. Dessutom är det alltid fördelaktigt att samla in organ eller vävnad som verkar onormalt.
  4. Vävnader och tumörer som samlas bör delas upp i fyra delar. Ett avsnitt fixeras i 10% buffrad formalin under 18 timmar, följt av 70% etanol. Detta avsnitt kan användas för H & E-färgning och / eller IHC. De återstående tre sektioner, som i allmänhet 50 till 100 mg i storlek, är snabbfrystes i flytande kväve. Dessa kan användas för DNA, RNA och protein isolering.
  5. Kassera stomme och kvarvarande vävnad enligt IACUC riktlinjer.

3. Isolera Genomiskt DNA från tumörer

<strong> Namn på reagens Företag Katalognummer
Proteinutfällning lösning Qiagen 158.910
Cell lysbuffert Qiagen 158.906
Proteinas K Qiagen 158.920
RNas A Qiagen 158.924
TE-buffert Promega V6232

Tabell 2. Reagenser krävs.

  1. Fint finhacka frusna tumörprov (50 till 100 mg) med användning av en rent rakblad.
  2. Plats malet vävnad i en 1,5 ml mikrocentrifugrör och tillsätt 1 ml av cell-lyseringsbuffert innehållande 5 pl proteinas K-lösning (20 mg / ml).
  3. Virvel grundligt.
  4. Inkubera i en 55 ° C skakapparat vid 250 rpm under minst 4 timmar, företrädesvis över natten.
  5. Tillsätt 1 pl RNas A lösning (10 mg / ml) och invertera röret 25 gånger.
  6. Inkubera vid 37 ° C under 30 minuter.
  7. Kyl till rumstemperatur genom att placera på is under 3 minuter.
  8. Lägg 333 ul lösning proteinutfällning och skaka kraftigt.
  9. Centrifugera vid 14.000 rpm 10 minuter. Proteiner bör pelleten. Om pellets är mycket liten, virvel igen, inkubera på is under 5 minuter, och sedan åter-centrifug.
  10. Häll bort supernatanten innehållande DNA i en ren 15 ml centrifugrör.
  11. Lägg lika volym 100% isopropanol och blanda genom att försiktigt vända 50 gånger.
  12. Centrifugera vid 3.500 rpm under 3 minuter.
  13. Släng supernatanten.
  14. Tillsätt 1 ml 70% etanol och invertera röret flera gånger för att tvätta pelleten.
  15. Överför den tvättade pelleten tillsammans med etanol till en 1,5 ml mikrocentrifugrör.
  16. Centrifugera vid 14.000 rpm i 5 minuter vid 4 ° C.
  17. Häll av etanol och invertera röret lufttorka (ca 5 till 30 min).
  18. Återsuspendera DNA pEllet i 50 till 500 pl TE beroende på storlek av DNA-pelleten.
  19. Valfritt inkubation vid 37 ° C för att återsuspendera DNA.
  20. Lagra vid 4 ° C eller -20 ° C för långtidsförvaring.

4. Linker medierad-PCR med användning av genomiskt DNA från tumörer

Namnet av reagenset Företag Katalognummer
Bfal New England Biolabs R0568S
Nlalll New England Biolabs R0125S
MinElute 96 brunnsplattor Qiagen 28.051
QIAvac 96 vakuumförgreningsrör Qiagen 19.504
Multi-mikroplattor Genie, 120V Vetenskaplig Industries, Inc. SI-4000
T4 DNA-ligas med 5x ligeringsbuffert Invitrogen 15224-041
BamHI New England Biolabs R0136S
25 mM dNTP Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA-polymeras Roche 12032929001
Agaros Promega V3121
TAE buffert Promega V4271
TE-buffert Promega V6232
Etidiumbromid Promega H5041

Tabell 3. Reagenser krävs.

Linkersekvenser

Bfal länkare + 5 "GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3 '

Bfal länkare-5 'Phos-TAGTCCCTTAAGCGGAG 3'NH2

"> Nlalll linker + 5'GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 '

Nlalll länkare-5 'Phos-GTCCCTTAAGCGGAGCC 3'

Primersekvensema

Primär PCR framåt på höger sida (Nlalll): Spl IRDR R1 1 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC

Primär PCR framåt på vänster sida (Bfal): Spl IRDR L1 1 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC

Primär PCR bakåt för både höger och vänster sida: Spl Link1 1 GTAATACGACTCACTATAGGGC

Sekundär PCR framåt på höger sida: Exempel på Illumina Streckkodsformulär sekundär primer 5 'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa (N: s representerar 12 bp streckkod, sekvens i versaler krävs för Illumina plattformen och sekvensen med små bokstäver binder till transposonen.)

Sekundär PCR framåt på vänster sida: Exempel på en streckkodade Illumina seconDary primer 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N: s representerar 12 bp streckkod, sekvens i versaler krävs för Illumina plattformen och sekvensen med små bokstäver binder till transposonen.)

Sekundär PCR bakåt för både höger och vänster sida: linker nästlad omvänd primer 5 'CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC

  1. Glödga + och - linkrar för både Bfal linkers och linkers NlaII genom att blanda 50 | il av linker + (100 iM) med 50 pl av linker-(100 pM) och tillsätt 2 pl NaCI (5 M) i ett 1,5 ml mikrocentrifugrör. Placera i 95 ° C värmeblock under 5 min. Stäng av värmeblock och låt sakta svalna till rumstemperatur (detta tar en timme eller mer). Efter kylning kan glödgade linkerfragment lagras i en -20 ° C frys tills de behövdes.
  2. Bered två alikvoter av tumör-DNA, vardera alikvot innehållande 1 pg DNA. En alikvot kommer ned kvickhetha restriktionsenzym som kommer att skära nära "rätt" slutet av transposonen. Den andra alikvoten kommer att digereras med ett restriktionsenzym som skär nära "vänster" ände av transposonet. Detta görs för att maximera chanserna att förstärka varje transposon insättningsstället.
  3. Digerera tumör-DNA i en alikvot med hjälp av "höger" NlaII sida enzym, och smälta den tumör-DNA i den andra portionen med "vänster" Bfal sida enzym: kombinera 1 il enzym, 5 pl 10x NEB buffert # 4, DNA ( 1 pg) och DDH 2 O till en total volym av 50 pl. Digest DNA över natten vid 37 ° C i vattenbad eller en inkubator.
  4. Värm inaktivera enzymer (Bfal = 80 ° C under 20 minuter, Nlalll = 65 ° C under 20 min).
  5. Rengör de digererade proven genom att placera prover i MinElute 96 brunnsplatta, placera plattan i vakuum grenrör och vakuum under ca 15 min tills brunnar ser torr.
  6. Avlägsna plattan från vakuumförgreningsrör och blot botten 96 brunnsplatta med pappershandduk för att avlägsna alla likviditetd
  7. Lägg 30 pl DDH 2 O till varje brunn och skaka på en orbital skakapparat på hög i 2 minuter, eller pipettera upp och ner 20 till 40 gånger.
  8. Överför hela volymen i brunnarna (30 | il) från MinElute 96 brunnsplatta i rena 96-brunnsplattor.
  9. Utför linker ligeringsreaktioner med digererad DNA från steg 4,8 och linkers från steg 4,1. Blanda 10 pl digererade DNA, 4 | il 5x ligeringsbuffert, 5,5 pl glödgade linkers (950 ug / ul), 0,5 pl T4-ligas (5 U / ^ il).
  10. Inkubera i 4 timmar till över natten vid 16 ° C.
  11. Värm inaktivera T4-DNA-ligas vid 65 ° C under 10 min.
  12. Städa upp ligering med MinElute 96 brunnar och ett vakuum grenrör som beskrivs i steg från 4,5 till 4,6.
  13. Återsuspendera i 30 pl H-2 O och överför till en ren 96-brunnsplatta.
  14. Utför en andra DNA nedbrytning för att förstöra kvarvarande konkatamer transposoner. Detta uppnås genom att skära DNA en andra gång med användning av ett enzym som klipper plasmiden vEctor DNA som användes för att skapa de transgena mössen som innehåller transposonen konkatameren.
  15. Digest-DNA med användning av BamHI (både vänster och höger sida): Blanda 25 pl av linker-ligerade DNA från steg 4,13, 5 pl 10x NEB buffert # 3, 0,5 pl BamHI (20 U / fil), 0,5 pl BSA (10 mg / ml ) och 19 pl DDH 2 O.
  16. Digest 3-6 timmar eller över natten vid 37 ° C.
  17. Utför primära PCR med användning av en primer som är specifik för transposonen och en primer som är specifik för linkern. Dessa kommer att variera beroende på vilken transposon och länkare du använder. De primers som anges i primern tabellen ovan arbete för T2/Onc och T2/Onc2 transposoner.
  18. Primära PCR: 5 pl 10x buffert, 2,0 | il MgCl2 (50 mM), 4 pl dNTP (2,5 nM), 1 pl Primer 1 (20 pM), 1 pl Primer 2 (20 pM), 0,25 pl Platinum Taq (5 U / il), 3 pl Digererat DNA med linkers (belopp kan variera), upp till 50 pl DDH 2 O.
  19. PCR-program: 94 ° C under 5 min, 30 cykler av 94 ° C under 30 sekunder, 60 & dt.ex., C under 30 sekunder, 72 ° C under 90 sekunder. Slutlig förlängning vid 72 ° C under 5 minuter.
  20. Städa upp PCR-produkt med användning av MinElute 96 brunnsplattor och en vakuum-grenrör, såsom beskrivits ovan.
  21. Återsuspendera i 30 pl H-2 O och överför till en ren 96-brunnsplatta.
  22. Gör en 1:75 spädning av 1 ° PCR genom att späda 2 pl DNA från steg 4,21 till 148 ul DDH 2 O
  23. Utför sekundär PCR med användning kapslade versioner av primrar som också har den nödvändiga sekvensen för Illumina GAIIx maskinen samt ett 12 baspar streckkod som är unik för varje tumörprov bearbetas (se primer tabellen ovan för exempel på dessa primrar).
  24. Sekundär PCR: 10 pl 10x buffert med MgCl2, 8 pl dNTP (2,5 mM), 1 | il Illumina streckkodade sekundär primer (20 | iM), 1 | il Illumina Nest 1 sekundär primer (20 | iM), 0,25 pl FastStart Taq (5 U / ul ), 2 pl DNA från primära PCR utspädda 1:75, upp till 100 pl DDH 2 O.
  25. PCR-program: 94 °, C under 2 minuter, 30 cykler av 94 ° C under 30 sekunder, 53 ° C under 45 sek, 72 ° C under 90 sek. Slutlig förlängning vid 72 ° C under 5 minuter.
  26. Run 45 pl av denna PCR-reaktion på en 1% agarosgel innehållande etidiumbromid (0,5 pg / ml). Det bör finnas en "smet" av PCR-produkter representerar amplikoner av de många olika transposoninsättningar i tumören (figur 3).
  27. Städa upp kvarvarande 50 | il av PCR-produkt med användning av MinElute 96 brunnsplattor och en vakuum-grenrör, såsom beskrivits ovan. Tvätta en gång genom att placera 50 | il DDH 2 O i brunnarna och dammsugning igen.
  28. Återsuspendera i 30 pl TE och överför till en ren 96-brunnsplatta.
  29. Bestämma koncentrationen av DNA i varje prov. Kombinera lika mängder av DNA i en enda 1,5 ml mikrofugrör. Detta kommer att vara det bibliotek som är sekvenseras i en enda bana av en Illumina HiSeq 2000 maskin. Det är möjligt att sekvensera flera hundra tumörer i en enda bana av en Illumina körning.
  30. Skickaden enda rör innehållande lika mängder DNA från alla tumörer för sekvensering. Detta kan göras genom din institution eller kommersiellt.

5. Analys av transposoninsättningar

  1. Programvara för analys transposoninfogning data finns tillgängliga för gratis nedladdning via SourceForge ( http://sourceforge.net/projects/tapdancebio/ ). Programmet, som kallas TapDance kräver sekvensen filen från Illumina plattform och en streckkod till bibliotek kartan textfil.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Efter avel system har inrättats bör uppfödare producerar en kull var 19-21 dagar. Kullstorlek kommer att variera mellan 5 och 12 valpar, beroende på ålder uppfödare och den genetiska bakgrunden. Dessutom, se till att genotypen av kullen följer Mendels genetik som ett sätt att bekräfta att avel systemet är både korrekt och framgångsrikt.

För experimentet ska lyckas, bör tumörincidens i försöksdjuren vara betydligt större än tumörincidensen i kontrolldjuren. Om inget "predisponerande" mutation ingick i försöket bör det finnas några att inga tumörer i kontrolldjuren. Om en "predisponerande" mutation ingick i experimentet bör tumörincidens hos dessa djur vara mycket lägre än förekomsten hos djur med mutationen och SB aktivitet.

LM-PCR bör amplifiera hundratals transposoninsättningar i en enda tumör. Efter att ha kört hektarLF av den sekundära PCR-produkten på en 1% gel, bör det finnas en "smet" av DNA som representerar denna amplifiering (figur 3). Om det bara finns en eller två band, antingen var SB inte aktiv i tumören eller ett fel gjordes i protokollet (Figur 4).

Sekvensering 1-200 tumörer i en enda bana av Illumina GAIIx plattformen ska producera mer än 30 miljoner sekvenser 100 bp vardera (Figur 5).

Tabell 1. Reagenser som krävs för avsnitt 2.

Tabell 2. Reagenser som krävs för avsnitt 3.

Tabell 3. Reagenser som krävs för avsnitt 4.

Figur 1
Figur 1. Flödesschema som visar stegenatt utföra en främre genetisk skärm med Törnrosa systemet. Först en musmodell genereras. Möss sedan obduceras när döende och tumörer samlas och isoleras. Tumör-DNA renas och linker-medierad PCR. Slutligen förstärks tumör-DNA med transposoninsättningar sekvenserades och gemensamma insertionsställen identifierats.

Figur 2
Figur 2. Avel system för att generera experimentell kohort. Möss innehåller transposaset (ROSA26-LSL-SB11) korsas med möss härbärgerande konkatameren av transposoner (T2-Onc). Avkomman sedan paras med möss som bär den avsedda vävnadsspecifik promotor drivna Cre rekombinas (Cre).

Figur 3
Figur 3. Representantresultat av sekundära PCR. Den förväntade produkten har en fläck utseende varierar från 100 till 600 baspar.

Figur 4
Figur 4. Om LM-PCR misslyckas kommer det att finnas en frånvaro av "smet" av DNA. Istället kommer du att se definitiva band DNA.

Figur 5
Figur 5. Exempel data från en sekvensering körning som visar en enda bana av Illumina GAIIx plattformen ska producera mer än 30 miljoner sekvenser 100 baspar vardera.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En framåt genetisk skärmen med hjälp av Törnrosa transposonen systemet ger en metod för att identifiera mutationer som orsakar cancer. Genom att välja lämplig promotor för att styra Cre rekombinas utöver eventuella predisponerande mutationer kommer SB-skärmen identifiera kända och nya kandidatgener cancer.

Framgången för en SB skärmen är till stor del beroende på de möss som valts för att skapa skärmen. För transposonen rekommenderar vi att du använder två olika musstammar bär konkatameren enligt onkogena transposoner på olika kromosomer 7. Noggrann eftertanke bör användas vid val av vävnadsspecifika Cre rekombinas som aktiverar SB transposaset. Det bör finnas belägg för att Cre enzymet är aktivt i den celltyp som misstänks vara cellen varifrån den cancer som modelleras. Framgångsrika exempel är villin-Cre (mag-tarmkanalen cancer), albumin-Cre (hepatocellulär carcinoma) och Aid-Cre (lymfom). 8-10

Antalet möss som krävs för en lyckad skärm kommer att bero på tumören penetrans. I allmänhet kommer fler tumörer och fler möss resultera i en mer robust skärm. För att detektera en 2-faldig skillnad i cancer latens det bör finnas minst 60 djur i både kontroll-och experimentgrupper. 11

Den mångsidiga naturen av dessa skärmar är kraftfull i förhållande till andra tekniker att man kan ange vilken typ av sjukdomen, följa utvecklingen och analysera den genetiska sammansättningen. Denna teknik har varit framgångsrik i ett antal skärmar som har gett CIS listor som identifierar nya potentiella gener cancer körning. Med denna information kan hänvisade studier utföras för att förstå funktionen hos dessa nya mutationer. Sammantaget kan användningen av denna teknik leda till eventuell utformning av nya riktade läkemedelsbehandlingar för att eliminera resultatet av dessa specifika genetiska mutaningar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgments

Författarna vill tacka Branden Moriarity, David Largaespada, och Vincent Keng vid University of Minnesota, och Adam Dupuy vid universitetet i Iowa för deras hjälp med att utveckla protokollet beskrivet ovan.

Materials

Name Company Catalog Number Comments
Sure-Seal Induction Chamber Brain Tree Scientific EZ-177
Cryovial Bioexpress C-3355-2
10% Buffered Formalin Sigma Aldrich HT501128-4L
Protein Precipitation solution Qiagen 158910
Cell lysis buffer Qiagen 158906
Proteinase K Qiagen 158920
RNase A Qiagen 158924
TE Buffer Promega V6232
BfaI New England Biolabs R0568S
NlaIII New England Biolabs R0125S
MinElute 96 well plates Qiagen 28051
QIAvac 96 Vacuum manifold Qiagen 19504
Multi-MicroPlate Genie, 120V Scientific Industries, Inc. SI-4000
T4 DNA ligase with 5x ligation Buffer Invitrogen 15224-041
BamHI New England Biolabs R0136S
25mM dNTPs Bioexpress C-5014-200
Platinum Taq Invitrogen 10966-034
FastStart Taq DNA Polymerase Roche 12032929001
Agarose Promega V3121
TAE Buffer Promega V4271
TE Buffer Promega V6232
Ethidium bromide Promega H5041

DOWNLOAD MATERIALS LIST

References

  1. Fearon, E. R., Vogelstein, B., et al. A genetic model for colorectal tumorigenesis. Cell. 61, 759-767 (1990).
  2. Wood, L. D., et al. The Genomic Landscapes of Human Breast and Colorectal Cancers. Science. 318, 1108-1113 (2007).
  3. Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsvák, Z. Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells. Cell. 91, 501-510 (1997).
  4. Starr, T. K., Largaespada, D. A. Cancer gene discovery using the Sleeping Beauty transposon. Cell Cycle. 4, 1744-1748 (2005).
  5. Mueller, P. R., Wold, B. In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR. Science. 246, 780-786 (1989).
  6. Bergemann, T. L., et al. New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens. Nucleic acids research. 40, 3822-3833 (2012).
  7. Copeland, N. G., Jenkins, N. A. Harnessing transposons for cancer gene discovery. Nature Reviews Cancer. 10, 696-706 (2010).
  8. Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse. Nature. 436, 272-276 (2005).
  9. Starr, T. K., et al. A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science. 323, 1747-1750 (2009).
  10. Keng, V. W., et al. A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma. Nature. 27, 264-274 (2009).
  11. Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system. Nature. 436, 221-226 (2005).
Identifiering av<em&gt; Törnrosa</em&gt; Transposoninsättningar i solida tumörer med Linker-medierad PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).More

Janik, C. L., Starr, T. K. Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR. J. Vis. Exp. (72), e50156, doi:10.3791/50156 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter