Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Un Exonuclease analyse basée sur la fluorescence pour caractériser DmWRNexo, orthologue humain progéroïde WRN Exonuclease, et son application à d'autres nucléases

Published: December 23, 2013 doi: 10.3791/50722

Materials

Name Company Catalog Number Comments
Reagent/Material
Custom oligonucleotides Eurogentec It is necessary to obtain these at high purity e.g. with PAGE purification.
5'FLO fluoresescein-5' GAACTATGGCTCTC
GAGTGCTAGGACATGTCTGA
CTACGTACAAGTCACC - 3'
bubble 5'- GGTGACTTGTACGT
AGTCAGACATGTCCTAGCAC
TCGAGAGCCATAGTTC-3'
40% 19:1 Acrylamide solution Severn Biotech 20-2400-05 CAUTION: potent neurotoxin so gloves should be worn at all times
His-Trap columns (1 ml) GE Healthcare 17-5247-01
All other reagents any reputable supplier Molecular biology grade is necessary (DNase-free); microfuge tubes similarly should be DNase- and RNase-free
Equipment
Hoefer SE400 gel apparatus Hoefer SE400-15-1.5
FLA-3000 (phosphor and fluorescence imager) Fuji
Image Reader V2.02 FujiFilm
Image Gauge V3.3 FujiFilm

DOWNLOAD MATERIALS LIST

References

  1. Mason, P. A., Cox, L. S. The role of DNA exonucleases in protecting genome stability and their impact on ageing. Age (Dordr. 34, 1317-1340 (2012).
  2. Payne, M., Hickson, I. D. Genomic instability and cancer: lessons from analysis of Bloom's syndrome). Biochem. Soc. Trans. 37, 553-559 (2009).
  3. Yu, C. E., Oshima, J., Fu, Y. H., Wijsman, E. M., Hisama, F., Alisch, R., Matthews, S., Nakura, J., Miki, T., Ouais, S., et al. Positional cloning of the Werner's syndrome gene. Science. 272, 258-262 (1996).
  4. Huang, S., Li, B., Gray, M. D., Oshima, J., Mian, I. S., Campisi, J. The premature ageing syndrome protein, WRN, is a 3'-->5' exonuclease. Nat. Genet. 20, 114-116 (1998).
  5. Goto, M. Syndrome-causing mutations in Werner syndrome. Biosci. Trends. 2, 147-150 (2008).
  6. Perry, J. J., Yannone, S. M., Holden, L. G., Hitomi, C., Asaithamby, A., Han, S., Cooper, P. K., Chen, D. J., Tainer, J. A. WRN exonuclease structure and molecular mechanism imply an editing role in DNA end processing. Nat. Struct. Mol. Biol. 13, 414-422 (2006).
  7. Opresko, P. L., Laine, J. P., Brosh, R. M., Seidman, M. M., Bohr, V. A. Coordinate action of the helicase and 3' to 5' exonuclease of Werner syndrome protein. J. Biol. Chem. 276, 44677-44687 (2001).
  8. Plchova, H., Hartung, F., Puchta, H. Biochemical characterization of an exonuclease from Arabidopsis thaliana reveals similarities to the DNA exonuclease of the human Werner syndrome protein. J. Biol. Chem. 278, 44128-44138 (2003).
  9. Hartung, F., Plchova, H., Puchta, H. Molecular characterisation of RecQ homologues in Arabidopsis thaliana. Nucleic Acids Res. 28, 4275-4282 (2000).
  10. Saunders, R. D., Boubriak, I., Clancy, D. J., Cox, L. S. Identification and characterization of a Drosophila ortholog of WRN exonuclease that is required to maintain genome integrity. Aging Cell. 7, 418-425 (2008).
  11. Cox, L. S., Boubriak, I. DNA Instability in Premature Aging, in DNA Damage Repair, Repair Mechanisms and Aging. Thomas, A.E., Eds. Nova Science Publishers. , 1-34 (2010).
  12. Cox, L. S., Clancy, D. J., Boubriak, I., Saunders, R. D. Modeling Werner Syndrome in Drosophila melanogaster: hyper-recombination in flies lacking WRN-like exonuclease. Ann. N.Y. Acad. Sci. 1119, 274-288 (2007).
  13. Boubriak, I., Mason, P. A., Clancy, D. J., Dockray, J., Saunders, R. D., Cox, L. S. DmWRNexo is a 3'-5' exonuclease: phenotypic and biochemical characterization of mutants of the Drosophila orthologue of human WRN exonuclease. Biogerontology. 10, 267-277 (2009).
  14. Mason, P. A., Boubriak, I., Robbins, T., Lasala, R., Saunders, R., Cox, L. S. The Drosophila orthologue of progeroid human WRN exonuclease, DmWRNexo, cleaves replication substrates but is inhibited by uracil or abasic sites : Analysis of DmWRNexo activity in vitro. Age (Dordr). , (2012).
  15. Machwe, A., Xiao, L., Orren, D. K. Length-dependent degradation of single-stranded 3' ends by the Werner syndrome protein (WRN): implications for spatial orientation and coordinated 3' to 5' movement of its ATPase/helicase and exonuclease domains. BMC Mol. Biol. 7, 6 (2006).
  16. Mangerich, A., Veith, S., Popp, O., Fahrer, J., Martello, R., Bohr, V. A., Burkle, A. Quantitative analysis of WRN exonuclease activity by isotope dilution mass spectrometry. Mech. Ageing Dev. 133, 575-579 (2012).
  17. Xue, Y., Ratcliff, G. C., Wang, H., Davis-Searles, P. R., Gray, M. D., Erie, D. A., Redinbo, M. R. A minimal exonuclease domain of WRN forms a hexamer on DNA and possesses both 3'- 5' exonuclease and 5'-protruding strand endonuclease activities. Biochemistry. 41, 2901-2912 (2002).
  18. Machwe, A., Ganunis, R., Bohr, V. A., Orren, D. K. Selective blockage of the 3'-->5' exonuclease activity of WRN protein by certain oxidative modifications and bulky lesions in DNA. Nucleic Acids Res. 28, 2762-2770 (2000).
Un Exonuclease analyse basée sur la fluorescence pour caractériser DmWRNexo, orthologue humain progéroïde WRN Exonuclease, et son application à d'autres nucléases
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mason, P. A., Boubriak, I., Cox, L.More

Mason, P. A., Boubriak, I., Cox, L. S. A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases. J. Vis. Exp. (82), e50722, doi:10.3791/50722 (2013).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter