Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Bir Kısıtlama Enzim Temelli Klonlama Yöntemi değerlendirin doi: 10.3791/51506 Published: August 31, 2014
* These authors contributed equally

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ana ve HIV-1 patogenezi ve hastalığın ilerlemesi rasyonel aşı tasarımı için her şeyden önemlidir etkileyen viral özelliklerini hem belirlenmesi. Hücresel bağışıklık tepkisi, HIV-1 enfeksiyonu, insan bağışıklık tepkisinin temel bir bileşenidir. Sitotoksik T lenfositleri (CTL), akut viremi başlangıç ​​kontrolü için gerekli olan ve ana sabit bir düzeye (set noktası) virüs yükü, 1,2 kurmaya olanak verir. Bu efektör hücrelerin deneysel tükenmesi viral kontrole 3,4 kaybı ile sonuçlanır. Buna rağmen, mutasyon viral yönden enfekte hücreler 5-9 arasında CTL tanıması bozmak, viral genom içinde ortaya için dizayn edildi.

Belirli HLA allelleri düşük viral yük ve B * 57, B * 27 ve B * 81 10-15 olmak üzere yavaş hastalığın ilerlemesi ile ilişkilendirilmiştir. HLA sınıf I alelleri koruyucu yarar bir kısmı, örneğin Gag gibi genomunun işlevsel olarak sınırlı bölgeleri hedef gerçeğine atfedilebilirve in vitro 16-21 çoğaltmak virüsün yeteneğini azaltmak kaçış mutasyonları için seçin. Hücresel bağışıklık sistemi için bir kaçış I aleli seçme HLA sınıf bağlamında virüse yararlı olmakla birlikte, bu mutasyonlar etkisinin bir HLA-uyumsuz 22,23 münferit iletim üzerine ev için farklı sonuçlara yol açabilir. Bu nedenle, viral replikasyon kapasitesi üzerinde iletilen HLA ilişkili kaçış mutasyonların etkilerini anlamak erken HIV-1 patogenezinde anlayışımızı ilerletmek için önemli olacaktır.

Ben 24-29 kadar ilerleme allel spesifik HLA sınıf ile ilişkili bireysel kaçış mutasyonları fitness kusurları tespit ve karakterize etmek için yapılmış olmakla birlikte, doğal olarak, HIV-1 izolatları, HLA ilişkili polimorfizmlerin özel ve karmaşık bir ayak izleri büyük olasılıkla HLA kaynaklanan olarak oluşan Farklı immünogenetik geçmişlere 30 aracılıkh bağışıklık basıncı. Apnceki analizi, Goepfert ve diğ. 88 akut enfekte Zambiyalılar türetilen iletilen Gag dizilerinde HLA ilişkili bir mutasyon birikimi ayar noktası viral yükte 31 bir azalma ile ilişkili olduğunu göstermiştir. Bu HLA uyumsuz alıcılara özel Gag zararlı kaçış mutasyonları iletim, bir klinik yarar sağlar ve viral replikasyon zayıflatılmış bağlı olabileceğini düşündürmektedir. İleride, bu tür çoğaltma kapasitesi ve erken çoğaltma sırayla HIV-1 klinik parametreleri ve geç-sahne nasıl etkileyebileceğini olarak iletilen virüsün özelliklerini tanımlamak için konser çalışmaları nasıl karmaşık Gag polimorfizmlerinin kombinasyonları doğal olarak oluşan izolatları içinde çalışmaya zorunlu olduğunu patogenezi.

Broekman et al. Birinci alt tip C ve hem de B enfeksiyonlarının kronik aşamalı enfeksiyon ve viral yükü sırasında izole gag-pro sekansları replikasyon kapasitesi arasında bir bağ göstermiştir32-35. Bu çalışmalarda sunulan deneysel yaklaşım, kronik olarak enfekte edilmiş bireylerden türetilen dizilerinin in vitro replikasyon kapasitesi incelenmesi için her ne kadar uygun olan, akut enfeksiyonlu bireyler zor alt tip C, HIV-1 replikatif kapasite ders yapmayı çok sayıda teknik belgesine ve sınırlamalar vardır. Bu yöntem LAV kısmen elde edildi alt tip B NL4-3 Provirüsün, içine nüfus tabanlı PCR çoğaltılmış dizi rekombinasyon dayanan, bir laboratuvar virüs stokları 36 uyarlanmıştır. Virüs üretimi PCR amplikonlarının bir CEM dayalı T hücre hattı 37 birlikte-transfeksiyonu ile gerçekleştirilebilir ve delta-gag-Pro NL4-3 DNA sindirildi. Bu yöntem, potansiyel olarak, in vivo olarak, viral quasi ile ilgili olarak geri kazanılan virüs stokunun doğasını eğriltme ve bu nedenle in vitro replikasyon kapasitesi ölçülmesini değiştirerek, haftalar ve aylar arasında bir süre içinde virüsünün gelişimini gerektirir. Bu yöntem, Ikronik olarak enfekte bireylerin büyük bir sayıda çok sayıda, farklı viral varyantları klonlama etkili yüksek kapasiteli replikatif virüs seçtiği, kronik olarak enfekte olmuş bireylerin incelenerek ve burada daha uygun s uygun bu nedenle oldukça emek yoğun değildir. Ancak, akut enfekte olmuş kişide, genel olarak 1-2 varyantları mevcut bulunmaktadır ve bu nedenle, in vitro seçme basınçları ile geri kazanılan virüs stokunun doğasını eğriltme riskini ortadan kaldırır, in vitro replikasyon kapasitesi daha doğru bir şekilde değerlendirilmesi için sağlar. İkincisi, bu yöntem bir alt tip B türetilmiş omurgası içine alt tip C gag-yanlısı dizileri birleştirilmesini gerektirir ve analiz içine omurga uyumsuzluk önyargıları tanıtmak olabilir. Bu sınırlamalar nedeniyle, dizilerin sayıda oluşan herhangi bir muhtemel yanlılığı üstesinden gelmek için analiz edilmelidir.

Burada alternatif bir deneysel bir yaklaşımı açıklamakalt tip C, akut olarak enfekte olmuş bireylerdeki türetilen sekansları üzerinde çalışmaya uygun ACH. Bu alt tip C Proviral omurgasına MJ4 olarak HIV-1 alt tip C enfekte bireylerin akut enfeksiyon zaman noktalarında elde edilen gag geninin katılması, bir kısıtlayıcı enzim bazlı klonlama stratejisi kullanın. Gag genleri klonlamak için ortak bir omurga olarak MJ4 kullanılması alt tipi C türetilmiş sekansların analizi için çok önemlidir. MJ4 nedeniyle omurga ve gag geni arasındaki alt tipi uyumsuzluk önyargı tanıtmak için daha az muhtemel olacağını, böylece primer izolat 38 türetilmiştir edilir ve. Proviral 293T hücreleri doğrudan transfekte edilmesi gereken yapıların ve klonlanmış gag dizisi ile aynı olan bir klonal virüs stokunun geri kazanımı için Buna ek olarak, kısıtlama enzim bazlı klonlama bölgesinin bir yaklaşım sağlar.

Aşağıda sunulan yöntem türetilmiş Gag-MJ4 alt tip C çoğaltma kapasitesini değerlendirmek için yüksek verimli bir yöntemdirsimerik virüslerin. 293T hücreleri içine transfeksiyonu basittir ve virüsün geri üç gün sürer. In vitro replikasyon kapasitesi. Brockman et al tarafından oluşturulan aynı CEM-CCR5 göre T-hücresi hattında 37 tahlil, ancak başarılı bir çoğaltma için gerekli olan önemli değişiklikler protokolü kullanarak alt tip C MJ4 simerik virüslerin. PBMC'ler daha çok, uygun bir T-hücresi çizgisinin kullanımı, yüksek tahlil üretilebilirliğine ile test edilecek olan alt tip C MJ4-simerik virüslerin çok sayıda sağlar. Son olarak, üstte yüzen madde içindeki virüs miktarının tayini için bir radyo-etiketli ters transkriptaz deneyi kullanılarak ticari olarak temin edilebilen ELISA kitleri kullanılarak P24 den daha düşük maliyetlidir. Ayrıca, aynı tahlilde, hem zayıf ve son derece kopyalayan virüs tespit etmek ve suşlar arasında çoğaltma ince farklar tespit edilmesi için önemli olan bir yüksek dinamik aralık verir.

Sonuç olarak, burada sunulan yöntem için izin verdiHIV-1 alt tip C türetilen öğürme dizilerinin çoğaltma kapasitesi derinlemesine çalışma akut Zambiya bireylerin enfekte ve yazılı olarak, ayrıca C popülasyonları enfekte diğer subtipini incelemek için genişletilmiş olabilir. Farklı Gag izolatlar arasında çoğaltma kapasitelerde varyasyon yüksek derecede gözlenmiştir. Ayrıca, üç yıllık bir süre üzerinde 39 CD4 + düşüş iletilen Gag çoğaltma kapasitesine ve set noktası viral yük arasındaki yanı sıra ile istatistiksel bir ilişki göstermek için başardık. Bu sonuçlar, bu tür çoğaltma kapasitesi nasıl bulaşan viral özellikleri, çalışmanın önemini vurgulamak, erken enfeksiyon sırasında patogenezi etkilemeye konak bağışıklık sistemi ile etkileşim ve etkin bir aşı müdahaleleri gibi tedaviler geliştirilmesinde ayrılmaz olacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Enfekte gelen HIV-1 gag geninin 1. Amplifikasyon, Dondurulmuş Plazma

  1. Bir ekstre etme kiti kullanılarak HIV-1 ile enfekte olan plazma çözülmüş 140 ul viral RNA çıkarmak.
    1. Mümkünse, hemen RNA ekstraksiyon olarak donmamış viral RNA iyi amplifikasyon sonuçları verir sonra cDNA sentezi geçin. Mümkünse, önce, viral RNA ekstraksiyonu için 4 ° C sıcaklıkta bir birinci tur DNA amplifikasyonu ve depolanmasını PCR ana karışım kadar ayarlayın.
  2. RNA'dan cDNA ters-transkribe edilmesi ve ters transkriptaz ve tek adımlı RT-PCR içinde bir termostabil DNA polimeraz kullanılarak, bir birinci tur DNA ürünleri yükseltmek.
    1. Oda sıcaklığında -80 ° C derin dondurucuda (donma gerekli ise) ve kısaca çözülme üzerinden RNA atın sonra soğuk blok yerleştirmek. Ana karışımı 45 ul ihtiva eden her bir PCR tüpü RNA 5 ul başına 50 ul'lik nihai bir hacim elde edildi. Hemen ° C derin dondurucuda -80 içine RNA örnekleri kalan yerleştirin.
    2. Enzimdir sonraİstenen reaksiyonların sayısı, her ince çeperli bir tüp içine PCR amplifikasyonu birinci fasıl PCR Master Mix (Tablo 1), kısım 45 ul DDEd. Örnekler arasındaki minimum çapraz bulaşmayı sağlamak için şerit kapaklar tek tek kapakları PCR tüpleri kullanmak değil emin olun. Isıya duyarlı RT enzim ve RNA şablonu korumak için soğuk bir blokta PCR tüpleri yerleştirin. Not: Numuneler yeterli viral quasispecies örneklemek amacıyla üç nüsha olarak çalıştırılmalıdır. Bu PCR ortaya yanlış katılmasının en aza indirmek için, yüksek doğrulukta bir DNA polimeraz enzimi ile bir ürün kullanılması da önemlidir. Önerilen ürün için reaktifler listesine bakınız.
    3. RNA şablonu Tüm reaksiyon tüplere ilave edildikten sonra, Tablo 1 B'de açıklanan döngüleyici programı kullanılarak bir PCR amplifikasyonu için PCR tüpleri aktarın. Not: Bu amplifikasyon PCR ürünü, iç içe bir ikinci tur kullanılacaktır.
  3. Gerçekleştirin iç içe geçmiş bir seDNA şablonu olarak ilk tur PCR amplifikasyonu (1.2) 1 ul kullanılarak iletken boyunca PCR amplifikasyonu.
    1. Kısım istenilen reaksiyonların sayısı, her ince duvarlı PCR tüpüne ikincil PCR ana karışımı (Tablo 2A), 49 ul. Aktarım, her bir reaksiyon tüpüne birinci fasıl PCR amplifikasyonundan 1 ul 50 ul'lik nihai bir hacim elde edildi. Not: Bu ikinci tur yükseltilmesi için şablon olarak DNA hizmet verecek. Bu PCR ortaya yanlış katılmasının en aza indirmek için çok yüksek doğrulukta ve düzeltme özelliklerine sahip bir DNA polimeraz kullanılması da önemlidir. Önerilen ürün için reaktifler listesine bakınız.
    2. Termalcycler için ikinci tur PCR reaksiyon karışımı ve Tablo 2B'de tarif çalışma programı aktarın. Not: programın tamamlanmasından sonra, bu reaksiyon ürünleri ürünün üretimini teyit etmek için agaroz jel üzerinde olacaktır.
  4. 5 & ​​# 5x yükleme boyası 3 ul ekleyin181; 50 ul ikincil reaksiyon hacmi içinde ilave edildi ve çözülene kadar bantları UV ile floresan bir DNA ihtiva etmeyen bir% 1 agaroz-TAE jeli üzerinde 120 V'ta tutuldu. Bir mavi ışık ışığını 1.6 kb bantları görselleştirmek (Şekil 1A bakınız).
  5. Bir DNA ihtiva etmeyen bir% 1 agaroz-TAE jeli üzerinde kalan 45 ul reaksiyon hacmi çalıştırın ve temiz bir jilet ile uygun bantları kesip.
    1. , Nükleaz içermeyen su içinde elüt, bir jel arıtma takımı kullanılarak jel dilimi DNA ekstrakte birey için üç pozitif reaksiyon birleştirebilir ve daha sonraki kullanım için -20 ° C'de dondurma ürünü.

Gerekli Kısıtlama site tanıtımı ile Klonlama 2. hazırlanması tıkaç amplikonlarının

  1. Uzun terminal tekrarı (LTR) kullanılmaktadır MJ4 plazmidin / 5 'UTR kısmını amplifiye (bakınız Tablo 3).
  2. Arındırmak 1.3 kb PCR ışığını ürünleri, tüketim olumlu amplıkonları, jel görselleştirmek ve daha önce dondurmatarif edildiği gibi (1.4,1.5 Şekil 1B'ye bakınız).
  3. "Bağlayıcı-örtüşme uzatma" ile MJ4 LTR, gag amplikonları kaynaşık oluşturma PCR'dir (bakınız Tablo 4).
  4. , Tüketim, görselleştirmek arındırmak ve 1.4,1.5 gibi 3.2 kb amplıkonları (Şekil 1C bakınız) dondurma.

MJ4, Tipi C, Bulaşıcı Moleküler klonlama içine 3. Klonlama Amplified öğürme Genler

  1. 1,5 MJ4 plazmid ug ve 50 ° C (Tablo 5A bakınız) 1.5 saat için Bcll (metilasyona duyarlı) restriksiyon endonükleaz ile arıtılmış, LTR, gag PCR ürününün 1.5 ug Digest.
  2. Sindirim reaksiyona NgoMIV 1 ul ilave edilir ve 1 saat boyunca 37 ° C'de inkübe edin.
  3. Daha önce azalan olarak klonlanması için gösterilen bantlar tepkileri restriksiyon dijest 5x yükleme boya ilave edin ve yavaş yavaş 100 V Visualize'nin, tüketim 1-2 saat boyunca bir DNA jel leke ihtiva eden bir% 1 agaroz-TAE jel üzerinde toplam hacmi electrophorese ve saflaştırılmasıribed (bakınız Şekil 2).
  4. Vektör oranı 1 insert: 3 saflaştırılmış Ltr- öğürme ekleme ve MJ4 vektör DNA kullanılarak ligasyon reaksiyonları hazırlayın. 4 ° C'de bir gece boyunca inkübe ligasyon reaksiyonları (Tablo 5B bakınız).
  5. Ligasyon ürünleri ile kimyasal olarak yetkin JM109 bakteri dönüşümü ve 100 ug / ml ampisilin ile LB agar plakaları üzerine yayılır ve 22 + saat boyunca 30 ° C'de büyütülmüştür.
    1. 15 dakika boyunca JM109'dan buz üzerinde yetkili hücreleri çözülme. Buz üzerinde 1.5 ml mikrosantrifüj tüpler ve chill Etiket.
    2. JM109 hücrelerinden alikot 50-100 ul önceden soğutulmuş 1.5 ml mikrosantrifüj tüpleri. Hafifçe karıştırın tüp hafifçe ve hemen buz dönen, JM109 hücrelerine ligasyon reaksiyonu 2.5-5 ul ekleyin. 30 dakika boyunca buz üzerinde ligasyon ürünü ile yetkili hücreleri inkübe edin.
    3. Isı şoku JM109 kompetan hücreler ve 45 saniye boyunca 42 ° C ısıya blok ligasyon reaksiyonu içeren ve en az 3 dakika için buza geri dönmek bir 1.5 ml mikrosantrifüj tüpleri.
    4. Her bir mikrosantrifüj tüpüne SOC ortam 50 ul ekle ve ampisilin, 100 ug / ml ile takviye edilmiş, oda sıcaklığı, LB-agar plakaları üzerine bütün transformasyon reaksiyonu plaka.
    5. 30 ° C inkübatör Transfer levhaları ve koloniler açıkça oluşturulan bir 20 saat boyunca, ya da kadar serbest bırakılır.
  6. Izole edilmiş koloniler ve 22 + saat boyunca 30 ° C'de 100 ug / ml ampisilin ile LB 4 ml büyür.
  7. , 15 dakika boyunca 3.200 xg'de kültürleri aşağı Spin suyu dökün, ve plazmid DNA ayıklayın.
  8. Aslına klonlama teyit etmek için, 2 saat boyunca 37 ° C 'de özet bir çift NgoMIV ve Hpal restriksiyon enzimleri ile kesilmiş miniprep DNA'sının. % 1 agaroz-TAE jeli üzerinde analiz (Tablo 5C bakınız).
  9. Sekans, aşağıdaki primerler kullanılarak her plazmid LTR-gag uç bölge: GagInnerF1, GagF2, Rev1, 3 Rev ve GagR6 (Tablo 6) sekans özdeşliği teyit etmek için.
  10. Nüfus dizileri der elde klonlanan karşılaştır1.5.1 Saflaştırılmış ilk amplikonundan ived. Not: Bu sonuçta herhangi bir in vitro replikasyon fenotipler klonlama işlemi sırasında oluşan omurga hataları nedeniyle değildir sağlamak amacıyla iki adet bağımsız klon çoğaltma kapasitesini değerlendirmek için önemlidir.

Çoğaltma Yetkili Gag-MJ4 simerik virüslerin 4. Üretimi ve titre

  1. Prince ve arkadaşları tarafından tarif edildiği gibi 39 Fugene HD: 1 oranında bir 4 kullanılarak 293T hücrelerine kimerik MJ4 plazmid miniprep DNA 1,5 ug ile transfekte replikasyon yapabilen bir virüsün oluşturur.
  2. Al 39 altında ve Prens et açıklandığı gibi TZM-bl hücreleri üzerinde Titre hasat virüs stokları.
    1. Levha TZM-bl hücreler ertesi gün bir% 30-40 konfluent hücre tekli tabakası olması için virüs enfeksiyonundan önce 24 saat. Bu, genellikle, 24 oyuklu plakada oyuk başına 800 ul toplam hacim içinde 5 x 10 4 hücreler ekleyerek elde edilebilir.
    2. Oyuğuna ilave edildikten sonra hücreler, hafifçe, hücreleri verimli bir şekilde dağıtmak için yan sonra öne ve arka yüzü 24 oyuklu plaka hareket eder. Girdap yok - bu plakasının merkezinde biriken hücreler neden olur.
    3. Ertesi gün, DMEM,% 1 FBS hazırlamak; Bu, DEAE-dekstran seyreltilmesi için virüs stokları ve seyreltmek için kullanılır. Hazır DEAE-Dekstran 10 mg / ml veya 125x ve 80 ug / ml veya 1 x istenen bir nihai konsantrasyonu.
    4. Virüs stokları dışarı atın, oda sıcaklığında erimeye çalkalayıcı -80 ° C dondurucu ve yerden test edilecek.
    5. Bir çok kanallı pipet kullanarak, seri yuvarlak dipli bir doku kültüründe güçlü bir virüs stokları seyreltik kapağı ile 96 oyuklu plaka işlemden geçirildi. Bu, 3-kat seyreltme protokolüdür. Seyreltme düzeni için Tablo 7'ye bakın.
    6. Emin, hücre tekli tabakası rahatsız dikkat ederek bir vakum aspiratör ile tohumlanır TZM-bl 24-delikli plakadan ortamı çıkarın. Sadece bir seferde bir 24-plaka ortamı çıkarın hücreler yapmak o kadarkurumasına değil.
    7. Her bir göze, 1.000 ul pipet kullanarak DMEM karışımı içindeki 1x DEAE-Dekstran +% 1 FBS 150 ul ilave edin. Bu tek tabaka bozan olarak tekrar pipet kullanın etmeyin.
    8. Uygun oyuğuna Seyreltilmiş her bir virüs 150 ul ilave edin. Kuyunun merkezine virüs ekleyin ve eşit hücre mono tabakasının karşısında virüs dağıtmak için hafifçe karıştırılır. 37 ° C'de, bir doku kültürü inkübatörü içinde, 2 saat ve% 5 CO 2 enfekte olmuş hücreleri inkübe edin.
    9. 2 saat inkübe edildikten sonra, her bir göze, DMEM içerisinde 0.5 ml% 10 FBS eklemek ve ek bir 48 saat boyunca inkübatör plakaları döner.
    10. 48 saat sonra, hücreler% 100 konfluent olmalıdır. MJ4 Bir çoğaltma yetkili virüs olduğundan, bazı hücre ölümü olabilir, ancak bu beklenebilir olacaktır.
    11. Her ortamı iyi çıkarın ve 400 ul / iyi çözüm (tarifi için Tablo 8A bakınız) sabitleme ekleyin. Bir seferde sadece bir tabak Fix. 1.000 ul pipet kullanarak çözüm sabitleme ekleyin ve 5 dk bekletinoda sıcaklığı.
    12. Sabitleme çözüm çıkarın ve Ca 2 + / Mg 2 + PBS ile 3x yıkayın. Yavaşça tek tabaka bozmamak için kuyunun tarafına PBS eklemek için bir püskürtme şişesi kullanın. Üçüncü yıkamadan sonra, emici kağıt üzerinde plaka kuru kurulayın.
    13. 400 ul / oyuk 24 oyuklu plakanın her oyuğuna boyama çözeltisi (tarifi için bakınız Tablo 8B) ve en az 2 saat boyunca 37 ° C'de inkübe edin. Daha uzun inkübasyon süreleri, kabul edilebilir, fakat inkübasyon süresi hassas olarak ölçülmesi deneyler arasında tutarlı olması gerekmektedir.
    14. Yıkama 2+ / Mg 2 + Ca PBS ile 2x ve enfeksiyon için puan veya daha sonra puanlama için 4 ° C'de PBS ve mağaza ekleyin. Plakalar sürece tek tabakalı hidre tutulur gibi, en fazla dört gün boyunca 4 ° C'de muhafaza edilebilir.
    15. Enfeksiyonu için puan için, kadranın içine 24 çukurlu bir levhanın çukurlarına bölmek için kalıcı bir işaret kullanılır. Bir kez, 200X toplam büyütme kullanılarak, bir görüş alanı içindeki tüm mavi hücreleri saymakKuyunun dört kadranın her.
    16. Aşağıdaki gibi ul başına Enfeksiyon Birimleri hesaplayınız: / (virüs ilave ul) = IU / ul [(# mavi hücreler / 4) 67 x]. Her bir kuyucuğa ilave virüsün ul hacim Tablo 8C bakınız. Ortalama birkaç kuyu birlikte; Numaralar doğru titrasyon için nispeten ucuz olmalıdır.

In vitro çoğaltma Testi Kültür Medya ve GXR25 Hücrelerinin Yayılma 5. hazırlanması

  1. GXR25 hücrelerin yayılması için komple RPMİ'de (cRPMI) hazırlayın. NOT: En az 4 ay önce planlanmış çoğaltma deneylerinde kültür GXR25 hücreleri için son derece önemlidir (Tablo 9).
  2. Bölünmüş hücreler, haftada iki kez 01:10 ve korumak hücre yoğunluğu 10 6 x 05-02 Ekim x 1 arası hücre / ml olmuştur.

GXR25 (CEM-CCR5-GFP) olarak Gag-MJ4 Kimeralar in vitro replikasyonu 6. Hücreleri

  1. I önceki günbu enfeksiyonun gününde logaritmik büyüme böylece nfection bir konsantrasyonda, 5 ila 10 x 2-3 arası hücre / ml hücre ayrıldı.
  2. Enfeksiyonun gününde C dondurucu ve çözülme ° -80 virüs stokları çıkarın. Aşağıdaki formül kullanılarak 0.05 enfeksiyon çokluğunda 5 x 10 5 GXR25 hücrelerini enfekte etmek için TZM-bl hücresi tahlilinde ikinci U / ul titreye bağlı olarak her bir stoktan gerekli virüs hacmini hesaplayın:
    Enfeksiyonu (ul) için virüs hacmi = 1 ul / X IU x 0,05 x 500.000
    NOT: Bu test ettik virüs tüm logaritmik büyüme fazında sonuçlanır Biz 0.05 bir MOI'nin seçtiniz. Bu virüs, test edilecek için logaritmik büyüme yakalamak için en uygun MOI belirlemek için ilk deneyler önemlidir.
  3. Ve bir V-tabanlı doku kültürü bir kuyuya ilave (0.05 MOI elde etmek için) 100 ul bir hacme kadar seyreltin cRPMI virüs 96 oyuklu plaka işlemden geçirildi. Not: her iki dahil positireplikasyon deneylerinde her set (MJ4 WT ile enfekte edilmiş) ve bir negatif (sahte enfekte olmuş hücreler) ve denetimine. Her kolon oyuklar arasındaki çapraz kontaminasyonu sınırlamak için boş olduğu şekilde plaka ayarlayın. Deneysel suretin çoğaltma oranının bir ölçüsü olan çoğaltma yamaçları normalize etmek için, daha sonra, bir standart olarak kullanılacak şekilde, pozitif kontrol, zorunludur.
  4. , Otomatik bir hücre sayacı kullanılarak GXR25 hücre sayımı. Tüm enfeksiyonlar (5 x 10 5 x # enfeksiyonları) için toplam gereken hücre sayısını hesaplayın. 50 ml konik bir tüp ve hücrelerini pellet haline getirmek için santrifüje gerekli hacmi kısım. Gerekli her zaman daha% 25 daha fazla enfeksiyonları için hesaplar.
  5. 5 x 10 5 hücre / 100 ul bir konsantrasyonda cRPMI dikkatli bir şekilde aspire ortam ve tekrar süspansiyon.
  6. Steril bir çukur içine pipet hücreleri ve iyice karıştırın. Çok kanallı bir pipet kullanılarak, seyreltilmiş virüs içeren 96 oyuklu plakanın her bir oyuğuna 100 ul hücre ilave edin. Mix iyice.
  7. Her bir polibren 5 mg / ml (100 x) solüsyonu 2 ul iyi ekleyin ve iyice karıştırın hücreleri.
  8. 3 saat boyunca% 5 CO2 ile doku kültürü kuluçka makinesi içinde 37 ° C'de inkübe edilir.
  9. Enfekte hücreleri yıkamak için, santrifüj 96 oyuklu V-tabanlı plaka hücrelerini pellet haline getirmek. Daha sonra dikkatli bir ortamın 150 ul çıkarın ve hücre pelletini bozmadan cRPMI taze 150 ul ile değiştirin. Yeterince hücreleri yıkamak için santrifüj (dahil) 2 kez daha tekrarlayın.
  10. Son santrifüj uygulanmış, ve 150 ul cRPMI ilave edildikten sonra, çok kanallı bir pipet ile hücre pelletini ve 24-çukurlu bir doku kuyuda cRPMI her biri de bağımsız bir şekilde 800 ul kadar tüm hücre / virüs karışımı (yaklaşık 200 ul) kültür plakası.
  11. 37 ° C'de% 5 CO2 doku kültürü inkübatöründe plaka.
  12. Her iki gün, kültür yüzer yüzeyinden 100 ul da ayrılması ve 96 oyuklu U transfer-Dip plaka ve mağaza virüs niceleme Deney yapılmadan kadar -80 ° C'de donduruldu. NOT: 96 oyuklu plakalar içinde yüzer dikkatli düzenlemesi, radyo-etiketli ters transkriptaz (RT) deneyi ile viryon ölçümü sırasında, kültür yüzer madde, çok kanallı bir pipet transferi sağlayacaktır. Her plaka RT deneyi okuma arası plaka değişimi normalleştirmek amacıyla bir enfeksiyon standart numuneler içermelidir.
  13. Iyice yeniden süspanse edilmesi hücreler tarafından 2 ve geriye kalan hacim (450 ul) yarısını uzaklaştırılması: split hücreleri 1 her 100 ul numune alınmasından sonra çekilmesi. Her bir oyuğa taze 550 ul cRPMI ekleyerek orijinal hacmi (1 mi) yükleyin.

Hücre kültür süpernatanlarından Ters transkriptazın 7. Analiz (RT)

Protokol Ostrowski ve diğ 40 uyarlanmıştır.

  1. Radyoaktif maddeler ile kullanım için bir BSL-3 tesis biyolojik güvenlik kaputu ayarlayın.
    1. Hoo emici kağıt yerleştirinAspiratör d ve yerine aspiratör radyoaktif kullanımı için belirlenmiş. Not: Tüm radyoaktif atıklar uygun güvenlik düzenlemelerine uygun olan atılmalıdır.
  2. RT ana karışımı her biri 1 mi kana [33 P α-] dTTP'nin 10 mCi / ml ve 1 M ditiyotreitol (DTT) 4 ul 1-2 ul (Tablo 10 ve Ostrowski ve ark. 40).
  3. Dikkatlice steril bir çukur 1.000 ul pipet ve transfer ile RT master mix, DTT ve [33 P α-] dTTP'nin her 1.5 ml mikrosantrifüj tüp karıştırın.
  4. Etiketli RT 25 ul, 96 oyuklu ince duvarlı PCR plakanın her oyuğuna karıştırın dağıtın. Not: pozitif bir kontrol (MJ4 WT enfeksiyonu) ve negatif bir kontrol (sahte enfeksiyon) için boşluk içerir.
  5. RT ana karışımı ihtiva eden PCR plakaya her bir süpernatanın 5 ul ekleyin.
  6. Yapışkan PCR folyo ile plaka sızdırmaz şekilde kapatılır ve bir PCR, 37 ° C'de 2 saat boyunca inkübe edilir. Güvenlik nedenleriyle, rinse pipet Amphyl ile ipuçları ve daha sonra radyoaktif atık bertaraf edilecektir Amphyl atık içeren küçük bir kapta ipuçları, atmayın.
  7. Kuluçkadan sonra, 200 ul, çok kanallı bir pipet kullanarak bir folyo küçük delik açmak. Not: pipet uçları kuyudaki sıvı temas ederse, bir sonraki sütun veya satıra geçmeden önce ipuçları değiştirin.
  8. Karışım örnekler 5x ve DE-81 kağıdı için her numunenin transferi 5 ul. Hava 10 dakika kurutulur.
  9. Yıkama lekeler, 1x SSC (sodyum klorür, sodyum sitrat) ile 5 kat, ve, yıkama başına 5 dakika% 90 etanol ile sonra 2 x. Kendine kurumaya bırakın.
    1. Blot kapak ve 5 dakika boyunca çalkalanır kadar yıkama tamponu (1 x SSC ve% 90 EtOH) ekleyin, bu gibi bir sandviç muhafaza kutusu gibi ayrı bir yıkama kabı, her blot yerleştirin.
    2. Ayrı bir kapta ve tekrar yıkama tamponu içine dökün. Not: İlk 3 yıkar radyoaktif kabul edilir ve düzgün bir şekilde bertaraf edilmelidir. Son 2 yıkar düzenli bertaraf edilebilir.
  10. Kuruduktan sonra, araçefully Saran leke sarın ve gece boyunca oda sıcaklığında, sıkıca yalıtılmış küçük bir kaset içinde phosphoscreen maruz sarın.
  11. Bir phosphorimager ile phosphoscreens Analiz ve radyoaktif transkript ölçmek.
  12. OptiQuant yazılımını kullanarak her radyoaktif sinyalin etrafında bir çember çizin. Çoğaltma eğrilerini oluşturmak için Dijital Işık Birimi (DLU) değerlerinin grafiğini.
  13. Replikasyon kapasitesi skorlarını oluşturmak amacıyla, DLU değerleri Geçmiş 10 -transformed ve eğimleri 2, 4 ve 6 gün zaman noktalarında kullanılarak hesaplanmıştır. Çoğaltma yamaçları sonra sipariş oluşturmak çoğaltma kapasite skorları WT MJ4 eğimi ile ayrılır. Bu deney içi değişkenliği azaltmak için aynı RT plaka elde MJ4 WT değerlerine göre normalize etmek önemlidir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Düzgün tam fonksiyonel, bulaşıcı Gag-MJ4 şimeralar montaj yeteneğine sahip bir proviral plazmid oluşturur bu protokolü, yürütmek amacıyla, büyük bakım uygun PCR amplıkonları oluşturmak için alınmalıdır. PCR uygun büyüklükte öğürme Amplikon'u üretti olmadığının saptanması önemlidir. Ürünler, şekil 1A'da gösterilen yaklaşık olarak 1700 bp'lik bir amplikon, 100 baz çifti (bp) içinde olmalıdır. Bu fragmanın tam uzunluğu, çalışma kapsamında gag geni bağlı olarak değişecektir. Daha sonra, MJ4 moleküler klonunun 5 'uzun terminal tekrarı (LTR) bölümü yükseltilir ve daha sonra klonlama için uygun hale getirmek için gag amplikona eklenmiş olması gerekir. MJ4 LTR amplikon uzunluğu 1474 bp olması gerekir. Şekil 1B bant boyutları, doğru olarak tespit edildiği için temsili bir jel görüntüsünü gösterir. Ek yeri örtüşme uzatma PCR 41 sonra bir araya getirilmiş, LTR susturucu ürün olmalıdırŞekil 1C'de gösterildiği gibi, uzunluk olarak yaklaşık 3200 bp'lik.

Gag geni gerekli NgoMIV I kısıtlama alanı içeren MJ4 dan 5 'LTR, vektör ve gag İlave parçalar her iki füzyon yoluyla klonlama için uygun yapıldıktan sonra NgoMIV ve Bcll sınırlama enzimleri ile sindirilmiş ve sonra, bir agaroz elektroforetik jelinden kesilip olmalıdır ayırma. Bu uygun vektör ve insert bantları kesip zorunludur. Temsili bir jel, Şekil 2 'de gösterilmiştir. Restriksiyon bölgeleri aşırı uçlarında yer alan gibi LTR tıkaç elemanı, uzunluğu yaklaşık 3000 bp olması gerekmekle birlikte MJ4 plazmid vektörü kısmı, uzunluğu yaklaşık 10.000 bp olması gerekir amplikon. Boyutunda önemli bir azalma çalışılan gag geni içinde ek bir kesme sitesini gösterir.

İki fragmana bağlanmasından sonra, bakteriyel transformasyon, birnd plazmid DNA izolasyonu, Gag-MJ4 kimeralar çift NgoMIV ve Hpal restriksiyon enzimleri ile sindirilmesi gerçekleştirilerek uygun boyutta olup olmadığı kontrol edilmelidir. Tam uzunluğu yaklaşık 8700 ve 4300 bp'lik iki grup, Şekil 3 'de gösterilen benzer bir kısıtlama örneği, olması gereken bakteriyel replikasyon sırasında herhangi bir silme yapılan olay değil Gag-MJ4 kimeralar.

Daha önceki yaklaşımlar ile karşılaştırıldığında bu protokol önemli bir fark, HIV-1 alt tip C enfeksiyonlu moleküler klon, MJ4 yerine, daha yaygın laboratuar adapte NL4-3 virüsünün kullanılmasıdır. Bununla birlikte, önceki bölümde tarif edilen yaklaşımlar pNL4-3 içine alt tip B, gag dizilerin klonlanması için modifiye edilebilir.

Sonraki deneylerde kullanılmak üzere enfeksiyon (MOI) çokluğunun bir test optimizasyonu virüs büyük bir kısmının logaritmik büyüme gösterdi ideal MOI seçmek için gerçekleştirilmiştir.Şekil 4, Örnek çoğaltma MJ4 (Şekil 4A), üç farklı ıslak temizleme (0.01, 0.05 ve 0.25) için eğrilerini ve NL4.3 (Şekil 4B) süreyle, tasvir etmektedir. NL4-3 çoğaltma için bir İçişleri Bakanlığı uygun olasılıkla verimli MJ4 çoğaltma algılamak için çok düşük olacağı gibi MJ4, dikkate almak önemlidir NL4-3, daha GXR25 hücrelerde daha az verimli çoğaltır. Şekil 4A, 0.01 ya da 0.25 karşıt olarak 0.05 MOl'de görüldüğü gibi, logaritmik büyüme MJ4 için günlük 2-6 arasında gözlenmiştir, çünkü ideal bir seçim. Alt MOI, 0.01 için, gün 6 DLU değerleri zorlukla saptanabilir olan, ve daha düşük MJ4 çoğaltılmış Gag-MJ4 simerik virüslerin üretilmesini öngörmektedir. Bu nedenle, bu İB, aynı zamanda biyolojik olarak en kritik olabilir, daha fazla zayıflatılmış Gag-MJ4 kimeralar, büyümesini yakalamak olmaz. Viral replikasyon hızlı kinetiğidir önemli bir Amou öldürdükleri için ek olarak, bir 0.25 İB, ideal değildi4. Bu çift gün hücrelerin nt platoya çoğaltma eğri neden olur ve bunlar da bu gibi bir eğrisine göre bir eğiminin hesaplanması replikasyon kapasitesi hafife olacaktır. Hatta 0.01 MOl'de, NL4-3 için oluşturulan eğriler dayanarak, mevcut hücre hedefleri belirgin enfeksiyondan 6 gün bitkin edilmiştir. Sonuç olarak, bir 0.05 İB çeşitli Gag dizileri ve replikasyon değişen derecelerde hepsi Gag-MJ4 simerik virüslerin, geniş bir panel için uygun olduğu bulunmuştur.

Akut alt tip C Gag dizilerinden türetilen 149 Gag-MJ4 simerik virüslerin toplam Bu yöntem kullanılarak, in vitro replikasyonu için test edilmiştir. Normalize RC değerleri vahşi tip MJ4 daha verimli 100 defadan fazla kopyalayan bazı virüsler ile 3.5 üzerinde 0.01 arasında değişmektedir. 5 kırmızı tasvir vahşi tip MJ4 ile dokuz temsilcisi Gag-MJ4 kimerik virüslerden çoğaltma eğrileri, göstermektedir, ve replikasyon c geniş göstermektedirapacities görülmektedir. Bu sebeple, sadece gag geni içinde sekans çeşitliliği büyük ölçüde, in vitro olarak replike yeteneğini etkileyebilir. Bu akut enfekte Zambiyalılar türetilen Gag-MJ4 simerik virüslerin temsili iken, diğer alt-tip C sekanslarının kapsamlı olarak test edilmemiştir ve farklı çoğaltma kinetiği sergileyebilir. Farklı HIV-1 Gag ile izole omurgaları arasında çoğaltma seviyelerinde geniş bir yelpazede olabilir nedenle, hassasiyet, belirli bir çalışma virüs spesifik çoğaltma uygun MOI optimize etmek için özen gösterilmelidir.

Bu MJ4 replikasyonunu destekleyen GXR25 hücre soyu gibi bir T-hücresi çizgisi kullanılarak avantajlarından biri, yeniden üretilebilirlik düzeyi hedefler olarak, periferik kan mononükleer hücreleri, uyarılmış kullanılarak replikasyon deneylerinde göre gözlenir. İlk deneylerde optimizasyonu, MJ4 vahşi tip% 8.7 analiz içi değişkenlik gösterdi, ve farklı!% 8.5 çoğaltma aynı Gag-MJ4 simerik virüs sergilenen değişkenlik nt klonları. Farklı bir master karışımları ve phosphoscreen maruz büyüklük olarak biraz farklıdır DLU değerlerini verebilmektedir için, analiz içi değişkenliği ayrıca her RT deneyi plakasında (bizim durumumuzda vahşi tip MJ4) aynı virüs standart çalıştırarak kontrol edilebilir. Şekil 6, grafikler DLU değerler, sekiz farklı RT plakalarda miktarı, aynı MJ4 enfeksiyonundan türetilmiştir. Ölçümler için, bu da, sinyal büyüklüğünde küçük değişiklikler neden olduğu potansiyel hata azaltmak için yardımcı olabilecek tüm RT deneyleri için ortak olan bir virüs normalleştirme.

Inter-tahlil değişken de test edilmiş ve yüksek korelasyon farklı günlerde tekrarlanan çoğaltır. Yaklaşık bir yıl arayla yapılan iki bağımsız deneyden 7 parselleri normalize RC puan değerlerini Şekil. Büyük aşın değerlerin yokluğunda (R2 = 0,873) ile ilişkili bir yüksek derecede Arası gözlenmiştiriki bağımsız çoğaltır een.

Yüksek korelasyon olmasına rağmen, iki bağımsız deneyler arasındaki çoğaltma kinetik genel büyüklüğü bazı farklılıklar bulunmaktadır. Bu, her deneyde kullanılan hücreler, GXR25 stoklar arasındaki geçiş sayıları arasındaki farklılık kısmen bağlanabilir. Genel olarak, 6 aydan daha uzun bir süre için daha pasajlama edilmiştir GXR25 hücreleri stokları Gag-MJ4 kimeralar daha etkili kopyalanmasını desteklemek eğilimindedir. Bu nedenle, bir aylık bir süre içinde kimeralar grupları arasında replikasyon kapasitesini değerlendirmek için tavsiye edilir. Önceki adımlar takip edilmekte, bu deney çalışmaları geniş bir aralığına uygulanabilirdir olan son derece sağlam ve tekrarlanabilir sonuçlar üretebilmektedir.

Şekil 1
Şekil 1. Temsilcisi jel imagPCR ürünlerinin ayrılmasını gösteren elektroforetik es. bütün PCR ürünler için, her bir 50 ul reaksiyon 5 ul 1X SYBR @ uyumlu DNA jel leke ile takviye edilmiş,% 1 agaroz-TAE jel yüklenir, 5x yükleme boyası 3 ul ile karıştırılmış ve daha 45 dakika süre ile 120 V'de elektroforez ile ayrıldı. Promega 1 kb DNA merdiveni (Şerit 1) amplikon boyutları a.) Gag geni, bir içiçe PCR yaklaşımı kullanarak, viral RNA büyütülmüştür yaklaşık kullanılmıştır. Eklemeler ve silmeler nedeniyle, gag amplikon 1,600-1,700 bp uzunluğunda farklı olabilir ve 1500 bp'lik bir DNA merdiveni işaretleyici biraz üzerinde görüntülenir. Şerit 2-5 MJ4 5 'LTR vahşi tip MJ4 plazmidinden büyütüldü ve elektroforezle ayrılması ile görselleştirildi. B) arka arkaya, gag gen amplifikasyonu tasvir etmektedir. Şerit 2-5 1.500 bp DNA merdiveni işaretleyici. C) 5R biraz altında görünen 1.474 bp LTR ürün, başarılı amplifikasyon tasvir17; LTR, vahşi tip MJ4 türetilen ve hastanın plazma büyütülmüş gag geni bağlayıcı bir örtüşme-uzatma PCR ile birleştirilmiş bir heterosiklik halkadır ve elektroforezle ayrılması ile görselleştirilebilir. Şerit 2-5 tasvir başarıyla boyutu yaklaşık 3.200 bp amplıkonları erimiş ve hafif 3,000 bp DNA merdiveni işaretleyici üzerinde görüntülenir.

Şekil 2
Kısıtlama Şekil 2. Örnek jel elektroforezi ile ayrılması gösteren Resim MJ4 içine hasta, gag genleri klonlamak için parçalar. Yabani tip MJ4 plasmidi ve LTR gag füzyon ürünleri 37 ° C'de 1 saat boyunca 50 ° C ve NgoMIV 1.5 saat BeH ile sindirildi C. Vektör ve insert fragmanlarının 1X SYBR @ uyumlu bir DNA ile takviye g bir% 1 agaroz-TAE jel üzerinde elektroforezle ayrılması ile görselleştirilmiştirEl 2 saat boyunca 100 V'de leke ve UV kaynaklı DNA hasarını azaltmak amacıyla bir mavi ışık aydınlatıcı kullanarak. Müteakip klonlama aşamalarında uygun vektör ve ek parçalan yaklaşık 10.000 bp ve sırasıyla 2900 bp görünür.

Şekil 3,
Şekil saflaştırılmış Gag-MJ4 kimera plazmid DNA, sınırlı parçalama elektroforetik ayırımı tasvir 3. Örnek jel görüntüsü. Saflaştırılmış Gag-MJ4 kimera plazmid DNA NgoMIV çift-sindirildi ve Hpal restriksiyon 37 ° C'de 2 saat boyunca enzimleri. Sınır dijestleri, 45 dakika süre ile 120 V'de 1X SYBR @ uyumlu DNA jel leke ile takviye edilmiş,% 1 agaroz-TAE jel üzerinde elektroforezle ayrılması ile görselleştirilmiştir. Büyük çıkarma yapılmadan Plasmidler yaklaşık 8,700 ve 4,300 bp iki ayrı bantları çözecektir.


MJ4 ve NL4-3 Şekil 4 çoğaltma enfeksiyonun farklı çokluklar de GXR25 hücre hattı (İB) HIV-1 izolatlarının. 5-kat arasında MOI artan yöntem protokolde tarif edildiği gibi, 5 x 10 5 hücre enfekte edilmiştir GXR25 Her virüs stok. Yüzer kısımlar, Gün 2, 4, 6, toplanmış ve 8 sonrası enfeksiyon ve virüs üretimi, bir radyo-etiketli ters transkriptaz deneyi ile ölçülmüştür. Enfeksiyonlar üç kopya halinde test edildi ve hata çubukları, üç kopya için standart sapmayı göstermektedir. (A) 'MJ4 (B)' NL4-3.

Şekil 5,
Şekil farklı Gag-MJ4 kuruntulardan için çoğaltma 5. Temsilcisi aralığı. 5 hücre GXR25 0.05 MOl'de vahşi tip MJ4 veya Gag-MJ4 kimeralar ile enfekte edilmiştir, süpernatanlar enfeksiyondan iki gün aralıklarla toplandı ve radyoaktif olarak işaretlenmiş olan bir virüs üretimi ile nicelleştirilmiştir RT deneyi. Çeşitli alt tip C türetilen öğürme genlerin yerleştirilmesi MJ4 çoğaltma kapasitesine üzerinde dramatik bir etkisi olabilir. Yabani tip MJ4 çoğaltma kırmızı gösterilmektedir.

Şekil 6,
Radyo-etiketli, ters transkriptaz (RT), ölçüm deneyi. Içinde analiz içi varyasyon Şekil 6. karşılaştırması grafik sekiz farklı RT deneyde, tek bir vahşi tip MJ4 enfeksiyondan aynı süpernatanların DLU değerlerin konulması sureti ile doğal test içi değişkenlik göstermektedir plakalar. Virajlarda varyasyon sinyal büyüklüğü bahiste hafif değişiklikleri yansıtırDaha sonra, aynı levha üzerindeki tahlil Gag-MJ4 kimeralar yamaçları normalize etmek için kullanılabilir Her RT levha, standart çalıştırarak düzeltilebilir rinde plakalar.

Şekil 7
Şekil GXR25 hücre hattında zaman çoğaltma tahlilinde 7. tekrarlanabilirliği. Aynı Gag-MJ4 simerik virüslerin, iki bağımsız deneyde GXR25 hücrelerini enfekte etmek için kullanıldı bir yıl arayla yaklaşık gerçekleştirilir. Çoğaltma skorları log-transforme DLU değerlerinin eğiminin hesaplanması ve vahşi tip MJ4 bu eğim normalize edilmesi ile oluşturulmuştur. Vahşi tip MJ4 daha verimli çoğaltma gag-MJ4 kimeralar 1 'den daha büyük bir kopyalama puanları vardır ve yabani tipte MJ4 daha az verimli bir şekilde replike olanlar (iki bağımsız ölçümler güçlü bir korelasyon vardır az 1 den replikasyon puanlarıR 2 = 0.87, lineer regresyon) ve farklı zamanlarda ve farklı pasajlara hücreleri ile yapılan testlerin tekrarlanabilirliği vurgulayın.

A),

Reaktif 1x reaksiyonu için Volume (ul)
2x Reaksiyon Karışımı (Invitrogen) 25
Nükleazlar-free H 2 O 17
İleri primer GOF (20 uM konsantrasyon) 1
Ters primer Vifor (20 uM konsantrasyon) 1
Üst Simge III Bir adım Enzim Mix 1
RNA şablonu 5
Toplam hacmi 50

B)

Cycles Sayısı Zaman (saat: dakika: saniye) Sıcaklık (° C)
1 01:00:00 50
1 02:00 94
10 00:15 94
00:30 56
05:00 68
40 00:15 94
00:30 56
05:00 + 5 saniye / çevrim 68
1 00:00 68
1 4
Son

Tablo 1. A) Yüksek Lisans karışımı ve B) gag yükseltilmesi için strong> termosikler koşulları. * Not: GOF primer sekans: 5'-ATTTGACTAGCGGAGGCTAGAA-3 '. Vifor primer sekans: 5'-TTCTACGGAGACTCCATGACCC-3 '.

A),

Reaktif 1x reaksiyonu için Volume (ul)
Nükleazlar-free H 2 O 35,5
5x Phusion HF Tampon 10
dNTP (40 mM deoksinükleotid) 1
İleri primer GagInnerF1 (20 uM konsantrasyon) 1
Ters primer BclIDegRev2 (20 uM konsantrasyon) 1
Phusion Sıcak Başlangıç ​​II Polimeraz 0.5
Şablon olarak ilk tur PCR 1
Toplam hacmi 50

B)

Cycles Sayısı Zaman (saat: dakika: saniye) Sıcaklık (° C)
1 00:30 98
29 00:10 98
00:30 53
01:00 72
1 10:00 72
1 4
Son

Tablo 2. A) Yüksek Lisans karışımı ve B) iç içe ikinci tur gag amplifikasyonu için PCR koşulları. * NNot: T GagInnerF1 primer sekans: 5'-AGGCTAGAAGGAGAGAGATG-3 '. BclIDegRev2 primer sekans: 5'-AGTATTTGATCATAYTGYYTYACTTTR-3 '.

A),

Reaktif 1x reaksiyonu için Volume (ul)
Nükleazlar-free H 2 O 35,5
5x Phusion HF Tampon 10
dNTP (40 mM deoksinükleotid) 1
İleri primer MJ4For1b (20 uM konsantrasyon) 1
Ters primer MJ4Rev (20 uM konsantrasyon) 1
Phusion Sıcak Başlangıç ​​II Polimeraz 0.5
MJ4 plazmid gibi şablon (10 ng / ul) 1
Toplam hacmi 50

B)

Cycles Sayısı Zaman (saat: dakika: saniye) Sıcaklık (° C)
1 00:30 98
29 00:10 98
00:30 58
00:45 72
1 10:00 72
1 4
Son

Tablo 3. A) Yüksek Lisans karışımı ve B) 5 'MJ4 LTR amplifikasyonu için PCR koşulları. * Not: MJ4For1b primer sekans: 5'-CGAAATCGGCAAAATCCC-3 '. MJ4Rev primer sekans: 5 '-CCCATCTCTCTCCTTCTAGC-3 '.

A),

Reaktif 1x reaksiyonu için Volume (ul)
Nükleazlar-free H 2 O 34.5
5x Phusion HF Tampon 10
dNTP (40 mM deoksinükleotid) 1
İleri primer MJ4For1b (20 uM konsantrasyon) 1
Ters primer BclIRev (20 uM konsantrasyon) 1
MJ4 LTR 1.3 kb Amplikon (Jel arıtılmış, ~ 50 ng) 1
Phusion Sıcak Başlangıç ​​II Polimeraz 0.5
Gag amplikon (Jelle saflaştırılmış, ~ 100 ng), 1
Toplam hacmi 50

B)

Cycles Sayısı Zaman (saat: dakika: saniye) Sıcaklık (° C)
1 00:30 98
29 00:10 98
00:30 58
01:30 72
1 10:00 72
1 4
Son

Tablo 4. A) Yüksek Lisans karışımı ve B) birleşme-örtüşme-uzatma PCR için termosikler koşullar Ltr- öğürme ekler oluşturmak için. * Not: BclIRev primer sekans: 5'-TCTATAAGTATTTGATCATACTGTCTT-3 '

A),

Reaktif 1x reaksiyonu için Volume (ul) İnkübasyon Süresi (saat) Kuluçka, Sıcaklık (° C)
3 kb LTR, gag amplikon veya MJ4 plasmidinin 1.5 ug 1.5 ug X ul
NEB CutSmart Tampon (önceden NEB Tampon # 4) 2
Bcll sınır enzimi 1
Nükleazlar-free H 2 O x
Toplam hacmi 19 1.5 50
NgoMIV kısıtlama enzimi 1
Toplam hacmi 20 1 37

B)

Reaktif 1x reaksiyonu için Volume (ul) İnkübasyon Süresi (saat) Kuluçka, Sıcaklık (° C)
50 ng kesik plazmid vektörü MJ4 50 ng x ul
45 ng kesim Ltr- öğürme insert (3: 1 oranı) 45 ng x ul
Roche ligaz tamponu 10x 2
Roche T4 DNA ligazı (5 U / ml) 1
Nükleazlar-free H 2 O
Toplam hacmi 20 18 + (gece) 4

C)

Reaktif 1x reaksiyonu için Volume (ul) İnkübasyon Süresi (saat) Kuluçka, Sıcaklık (° C)
Gag-MJ4 plazmid 450 ng 450 ng x ul
NEB CutSmart Tampon (önceden NEB Tampon # 4) 2
NgoMIV kısıtlama enzimi 0.5
Hpal restriksiyon enzim 0.5
Nükleazlar-free H 2 O x
Toplam hacmi 20 2 37

Tablo 5. A) Kısıtlama master mix ve B) Gag-MJ4 klonlama aslına sağlamak için Gag-MJ4 kimerik Provirüs. C) Teşhis kısıtlama sindirmek nesil için bağlanma reaksiyonu sindirmek.

Astar Adı Nükleotid Dizisi (5 '- 3')
GagInnerF1 AGGCTAGAAGGAGAGAGATG
GagF2 GGGACATCAAGCAGCCAT
For3 CTAGGAAAAAGGGCTGTTGGAAATG
GagR6 CTGTATCATCTGCTCCTG
3Rev GACAGGGCTATACATTCTTACTAT
Rev1 AATTTTTCCAGCTCCCTGCTTGCCCA

Gag-MJ4 kimerik Provirüsün 5 'LTR ve gag dizi kimliğini doğrulamak için gerekli sıralama primerleri Tablo 6. listesi.

Peki bir DMEM içinde 8 ul virüs + 232 ul% 1 FBS
Peki B DMEM'de Peki A + 160 ul% 1 FBS 80 ul
Peki C DMEM'de Well B + 160 ul% 1 FBS 80 ul
Peki D DMEM'de Peki C + 160 ul% 1 FBS 80 ul
Peki e DMEM'de Peki D + 160 ul% 1 FBS 80 ul
Peki F DMEM'de Şey E + 160 ul% 1 FBS 80 ul

Tablo 7. Seyreltme şeması (3TZM-bl hücreleri üzerinde bulaşıcı virüsler titering için) katlayın.

A),

Reaktif Cilt
PBS Ca 2 + ve Mg olmadan 2+ 500 mi
Gluteraldehit 4 mi
Formaldehit 11 mi

* Not: Mağaza 4 ° C'de ilave edildi.

B)

Reaktif Cilt
PBS Ca 2 + ve Mg olmadan 2+ 4.75 mi
Potasyum ferrisiyanür (0.2 M) 100 ul
Potasyum ferrosiyanür (0.2 M) 100 ul
Magnezyum klorür (1 M) 20 ul
X-gal (50 mg / ml) 40 ul

* Not: Taze yapın ve kullanıma kadar ışıktan uzak tutunuz.


C.

Orijinal Seyreltme iyi Bir B C D E F
Virüsü (ul) hacmi, 24 oyuklu bir plaka sıranın çukurlara eklendi 5 1.6667 0,5556 0,1852 0,06173 0,02057

Tablo 8. A) ° C). enfeksiyöz birim / ul hesaplamak için göz başına ilave virüsün sesinin Gag-MJ4 kimerik virüs titre güçlü> Boyama ve B) sabitleme çözümleri.

Reaktif Cilt
Fetal sığır serumu (FBS), tanımlanmış 55 mi
Penisilin, Streptomisin, Glutamin (100x) 6 mi
HEPES tamponu (1 M) 6 mi

Tablo GXR25 hücrelerin çoğaltılması için tam RPMI ortamında 9. Tarif.

Reaktif Hacmi (mi)
Nükleazlar-ücretsiz H 2 O 419.5
Tris-HCl, pH 7.8 (1M) 30
Potasyum klorür (1 M) 37.5
Magnezyum klorür (1 M) 2.5
Nonidet P-40 (% 10) 5
EDTA (0.5 M) 1.02
Poliadenilik asit, potasyum tuzu (2 mg / ml) 1.25
Oligo-dT primeri (25 ug / ml) 3.25
Toplam hacmi 500

Radyoetiketlenmiş ters transkriptaz tahlil ana karışımı Tablo 10. Tarif. * Not: -20 ° C'de 1 ml'lik kesirler halinde.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nedeniyle uzunluk ve bu protokol, teknik doğası nedeniyle, kimerik Gag-MJ4 plasmidlerin kurulmasında her ikisi için önemli bir unsur olarak ayrıca viral replikasyon kapasitesinin ölçümü için olan birkaç adım vardır. Bu protokolde belirtilen MJ4 yabancı öğürme genlerin tanıtımı için kısıtlama enzim bazlı klonlama stratejisi önceden kullanılan rekombinasyon bazlı yöntemlere göre çok sayıda avantajları olmasına rağmen kritik adımlar tam uyulmadığı takdirde, protokol teknik olarak zor olabilir.

İlk olarak, DNA, DCM ve baraj metilazlar eksik yetkin bir bakteri soyu içinde elde edilmiş plazmid DNA MJ4 kullanımı kesinlikle gereklidir. Bu MJ4 omurgasına gag genleri klonlamak için kullanılan Bcll sınırlama endonükleazı, enzimatik etkinliği gerekli olduğu baraj / DCM metilasyon duyarlıdır. JM110 ve SCS110 (bir negatif Enda JM110 türevi), E. E. coli suşları birmetillenmemiş MJ4 plazmid DNA elde etmek için uygun yeniden. Ayrıca, vektör ve uç bantların çıkarılması için, oldukça bir mavi ışık aydınlatıcı görselleştirme için kullanılması tavsiye edilir. Bu UV dalga boyu bağımlı DNA hasarını azaltmak ve büyük ölçüde klonlama etkinliğini artıracaktır. Bir mavi ışık aydınlatıcıdır kullanılamaz ise, klonlama verimliliği SYBR Güvenli DNA jel leke yerine etidyum ile DNA görselleştirme ve UV ışınlarına maruz kalma süresini minimize maksimize edilebilir.

Son olarak, büyük (> 10kb) ve / veya MJ4 retroviral plazmidlerle moleküler klonlama geleneksel çeşitli nedenlerden dolayı zor olmuştur. Geniş plazmidler kompetan bakteriyel suşlar 42 transformasyon etkinliğini azaltmak yanı sıra uzun terminal tekrar (LTR) sekansı, retroviral genom 43 kromozom yol açan bakteri konukçu içinde plasmid DNA plasmidi ve uzlaşma çoğaltma aslına stabilitesini düşürdüğünü içeren retroviral eklerin, E. kullanıldığında Ayrıca, MJ4 plazmid replikasyon daha kararlıdır Bizim ellerde DH5α suş üzerinde E. coli suşu,. Nedeniyle plazmidin stabil olmayan doğası, saflaştırılmış plazmid ürünler her zaman sınır enzimi sindirimi ile doğru plazmid büyüklüğü için kontrol edilmelidir; Burada, bir çift 2 saat boyunca 37 ° C'de NgoMIV ve Hpal restriksiyon endonükleazı ile sindirmek.

Bir kez kimerik Gag-MJ4 plasmidlerin başarılı üretimi başarılmıştır, virüs 2 transfeksiyonu ile üretilirBir endikatör hücre hattı, TZM-bl hücreleri ve replikasyon kapasitesi üzerinde titre 93T hücreler, CEM-dayalı T hücre hattı kullanılarak ölçülür. Bu çoğaltma çalışmalar için kullanılan CEM tabanlı GXR25 hücre çizgisi, HIV-1 CCR5-tropik suşlannın girişini ve kopyalanmasını desteklemek için birkaç mümkün Belirlenmiş T-hücre hatlarının biridir. Bu, insan CCR5 37 stabil ifadesini sağlamak için, retroviral transdüksiyonu ile elde edilmiştir. Bu hücre hattı doğal CXCR4'ü ifade ve bu laboratuvar adapte sarmalı NL4-3 olarak CXCR4-tropik HIV-1, çoğaltması destekleyecektir. Buna rağmen, bu tür MJ4 gibi, GXR25 hücreler enfeksiyon öncesinde en az 4 ay boyunca ilerletilmesi gerekmektedir, CCR5-tropik suşlannın kopyalanmasını desteklemek için etkili bir. Düzgün geçişli kültürler kadar bile 1 yıl boyunca pasaj sonra çoğaltma destekleyebilir. Pasajlayarak genelinde CCR5-tropik çoğaltma dikkatle izlenmesi başarılı deneyler için önemlidir.

Herhangi bir tekniği olduğu gibi, sınırlamalar yanlısı için vardırdüşünülmelidir tokol. Nedeniyle MJ4 plasmidde kısıtlama siteleri de doğal olarak var olan, HIV-1 izolatlarının muhafaza restriksiyon siteleri mevcudiyetine bağlı, 3 'uzak kısıtlayıcı site, Bcll, gag bitiş kodonundan 137 nükleotidler bulunur. Bu bir kimerik proteaz geni oluşturmasına rağmen, bu bölge bu kohorttaki korunmuş 96.5%, ve biz ölü ya da kusurlu simerik virüslerin bir bolluk gözlemlemek vermedi.

C alt-tipi ile türetilen diziler ite MJ4 alt tip C enfeksiyonlu moleküler klon kullanılmasının avantajlarından biri ve gag genlerinin farklı alt tipi omurga vektörleri arasında optimal gen eşleştirme riskini azaltmasıdır. , Aynı alt tipten 31 içinde bulunan bile ülkeye ya da bölgeye göre, HIV-1 dizilerin kümeleme ile kanıtlandığı gibi, ancak, içindeki clade çeşitlilik belirli bir miktarda mevcuttur. Gag genler der arasındaki bu bırakıyorsa eşleştirme katkıda bulunabilirakut ve enfekte Zambiyalılar Botsvana 38 bir kronik olarak enfekte olmuş bir bireyden elde edildi MJ4 bulaşıcı moleküler klon omurgasından gelen ived. Bununla birlikte, analiz yapıların bir çoğu bulaşıcı progen meydana virüs üretilir. Gibi farklı HIV-1 alt tip C bulaşıcı moleküler klonlar daha yaygın olarak kullanılabilir hale, ayrıca nedeniyle tanıttı minimal bir önyargı olduğunu sağlamak için diğer omurgaları içine bu HIV-1 clade C öğürme genlerin klonlanması bu sistemi doğrulamak için önemli olacaktır omurga uyumsuzluklara.

GXR25 hücre çizgisi, özellikle bağlı CXCR4 ve CCR5-tropik suşları ve HIV-1 uyarımlı GFP raportör 37 desteklemek üzere kabiliyeti için, benzersiz bir hücre hattıdır. Bununla birlikte, bazı sınırlamalar vardır ve dikkatle protokolünden adapte edilmiş deneyler için, bu hücre çizgisi kullanılarak önce dikkate alınmalıdır. GXR25 hücre hattı alt tip C veya A, CCR5-tropik, pr bir çoğunluğunun girişini desteklemek için görünmüyorimary test ettik ayırır. Buna ek olarak, ana CEM hücre hattı olan GXR25 hücre çizgisi sergilerse 2'ye kadar siklofilin A'nın yüksek oranda elde edilmiştir Jurkat hücre çizgisinin 44 daha fazla ekspresyon 4 kat. Siklofilin A dolayı yüksek düzeyde, normal olarak çoğaltma kusur Siklofilin A bağlamak için kapsid bir azalma yeteneğini atfedilir kanonik HLA-B * 57 bağlantılı çıkış mutasyonu, T242N, ile bağlantılı, kolayca bu özel hücre hattında tespit edilemez 25. Böylece CEM-bazlı GXR25 hücre çizgisi, HIV-1 kapsid-bağlama siklofilin döngü mutasyonlarla ilişkili olan çoğaltma kusurları çalışmak için ideal değildir.

Bu protokol, akut zaman noktalarında elde edilen öğürme sekansların replikasyon kapasitesi analiz etmek için ideal iken, son olarak, modifikasyonlar, kronik olarak enfekte bireylerden türetilen genlerin GAG replikasyon kapasitesi incelemek için yapılmalıdır. Bu protokol am içerirViral çeşitlilik sınırlı, akut zaman noktalarından nüfus dizilerin plification (medyan 45 gün enfeksiyon tarihini tahmin gönderebilirler). Her bir ikinci chimera gag geni daha sonra dizisi çıkarıldı ve bağlılığını klonlama sağlamak için ilk popülasyon PCR amplikonunun karşılaştırılır. Akut zaman noktalarında sınırlı dizi çeşitlilik, nüfus PCR ürünleri klonlama mümkündür. Ancak, sekans çeşitliliği kronik enfekte bireyin viral quasi içinde bulunmaktadır; Bu nedenle, doğru kronik quasi türlerin bir replikasyon kapasitesi değerlendirmek amacıyla, tek genom amplifikasyonu kaç temsili varyantları yakalamak için kullanılması gerekmektedir. Bu varyantların her biri daha sonra, in vitro replikasyonu için test edilmelidir.

Bu teknik mevcut yöntemlere göre avantajları kaynaklanan çeşitli geniş bir uygulama alanına sahiptir. Bu işlem, bir replikasyon yapabilen bir plazmid, klonal ile sonuçlandığından, ilave m yapıları için, kullanımı kolayViral kopyalama için belirli artıkların katkısını aydınlatmak için yardımcı olabilir utagenesis çalışmalar. Bundan başka, uzunlamasına zaman noktalarından gag genlerinin klonlama ile, tek bir zaman içinde viral replikasyon kapasitesi gelişiminin değerlendirilmesi ve bu değişiklikler, bir HIV-1 bulaşmış birey içinde patogenezi ne etkileyebilir.

Bu teknik, farklı uygulamalar için yararlılığını genişletmek için değiştirilebilir. İlave HİV-1 virüs proteinleri, viral çoğalma ya da konak proteinler ile olan etkileşimleri üzerine etkilerini değerlendirmek amacıyla, MJ4 plazmid içine inşa edilebilir. Bu sessiz nükleotid değişiklikleri oluşturulması yoluyla genomunda istenen bölgelerinde ek kısıtlamalar the işlenmesi suretiyle gerçekleştirilebilir. Gibi birçok yardımcı proteini, seçenek oluşturan bir okuma çerçeveleri kodlanmıştır HIV-1 genomunun 3 'yarısına, yeni sınır mevkilerini ve bir sessiz değişiklik mühendislik Ancak, özel bir dikkat alınması gerekirproteinin diğer bir amino asit ikamelerine yol açabilir. Bu durumda, bu tür Dudley ve arkadaşları tarafından tarif edilenler gibi bir sınırlandırma bölgesi bağımsız klonlama yöntemleri. 45 bu sınırlamanın üstesinden gelebilir. Farklı popülasyonlar türetilen viral sekansların replikasyon kapasitelerinin değişen aralıkları olabilir ve İB kendi logaritmik büyüme fazı içinde viral izolatları çoğunluğunu yakalamak için buna uygun olarak ayarlanabilir. Son olarak, GXR25 hücre soyu, bir LTR-dayalı, Tat-uyarımlı promotörün kontrolü altında GFP ile transfekte edilmiş, ve ağız yoluyla dağıtımı, burada tarif edilen ya da RT deneyi için bir alternatif olarak 37 akım sitometrisi ile GFP pozitif hücrenin bir fonksiyonu olarak ölçülebilmektedir, örneğin Geleneksel bir p24 ELISA.

Sonuç olarak, bu protokol uygun viryon oluşumu için gerekli olan bir proteini kodlayan yapısal korunmuş gag geni tarafından kazandırılan olarak, HİV-1 virüs çoğalmasını değerlendirmek için etkili ve güçlü bir teknik sağlar, Tomurcuklanma, olgunlaşma ve sökme 46-48. Ayrıca, bu teknik, bu nedenle mutagenez incelemeleri için de ideal bir yerdir ve bir replikasyon yapabilen bir plazmid klonal oluşturur, viral fitness spesifik amino asit belirleyicilerin ortaya çıkartılması için bir yöntem temin etmektedir. Bu gibi çalışmalar, bağışıklık odaklı viral evrim HIV-1 ile enfekte kişilerde patogenezi ve hastalığın ilerlemesini nasıl etkilediğinin anlayışı geliştirmek için zorunludur.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
PCR Reagents
GOF: 5' ATTTGACTAGCGGAGGCTAGAA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
VifOR: 5' TTCTACGGAGACTCCATGACCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagInnerF1: 5' AGGCTAGAAGGAGAGAGATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIDegRev2: 5' AGTATTTGATCATAYTGYYTYACTTTR 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4For1b: 5' CGAAATCGGCAAAATCCC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
MJ4Rev: 5' CCCATCTCTCTCCTTCTAGC 3' IDT DNA Custom Oligo 25 nmol, standard desalt
BclIRev: 5' TCTATAAGTATTTGATCATACTGTCTT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagF2: 5' GGGACATCAAGCAGCCAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
For3: 5' CTAGGAAAAAGGGCTGTTGGAAATG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
GagR6: 5' CTGTATCATCTGCTCCTG 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev3: 5' GACAGGGCTATACATTCTTACTAT 3' IDT DNA Custom Oligo 25 nmol, standard desalt
Rev1: 5' AATTTTTCCAGCTCCCTGCTTGCCCA 3' IDT DNA Custom Oligo 25 nmol, standard desalt
CoolRack PCR 96 XT Biocision BCS-529
CoolRack M15 Biocision BCS-125
Nuclease free water Fisher SH30538FS Manufactured by Hyclone
QIAamp Viral RNA Mini Kit Qiagen 52906
Simport PCR 8 Strip Tubes, Blue (Flat Cap) Daigger EF3647BX
SuperScript III one-step RT-PCR system Life Technologies/Invitrogen 12574035
Phusion Hot-start II DNA polymerase Fisher F-549L
PCR Nucleotide Mix Roche 4638956001
Agarose, high gel strength Fisher 50-213-128
TAE 10X Life Technologies/Invitrogen AM9869
Promega 1 kb DNA ladder Fisher PRG5711 Manufactured by Promega
Sybr Safe DNA Gel Stain, 10,000x Life Technologies/Invitrogen S33102
Wizard SV Gel and PCR Clean-Up System Promega A9282
Razor blades, single-edged Fisher 12-640 Manufactured by Surgical Design
Thermocycler, PTC-200 MJ Research
Microbiology & Cloning Reagents
LB Agar, Miller Fisher BP1425-2
LB Broth, Lennox Fisher BP1427-2
Sterile 100 x 15 mm polystyrene Petri dishes Fisher 08-757-12
Ampicillin sodium salt Sigma-Aldrich A9518-5G
Falcon 14 ml Polypropylene round-bottom tubes BD Biosciences 352059
NgoMIV restriction endonuclease New England BioLabs R0564L
BclI restriction endonuclease New England BioLabs R0160L
HpaI restriction endonuclease New England BioLabs R0105L
T4 DNA Ligase, 5 U/μl Roche 10799009001
JM109 competent cells, >108 cfu/μg Promega L2001
PureYield plasmid miniprep system Promega A1222
Safe Imager 2.0 Blue Light Transilluminator Invitrogen G6600
Microfuge 18 centrifuge Beckman Coulter 367160
Cell Culture Reagents
Amphyl cleaner/disinfectant Fisher 22-030-394
Fugene HD, 1 ml VWR PAE2311 Manufactured by Promega
Hexadimethrine bromide (Polybrene) Sigma-Aldrich H9268-5G
Costar Plates, 6-well, flat Fisher 07-200-83 Manufactured by Corning Life
Costar Plates, 24-well, flat Fisher 07-200-84 Manufactured by Corning Life
Costar Plates, 96-well, round Fisher 07-200-95 Manufactured by Corning Life
Flasks, Corning filter top/canted neck, 75 cm2 Fisher 10-126-37
Flasks, Corning filter top/canted neck, 150 cm2 Fisher 10-126-34 Manufactured by Corning Life
Conical Tubes, 50 ml, blue cap Fisher 14-432-22 Manufactured by BD Biosciences
Conical Tubes, 15 ml, blue cap Fisher 14-959-70C Manufactured by BD Biosciences
Trypsin-EDTA Fisher MT25052CI Manufactured by Mediatech
RPMI, 500 ml Life Technologies/Invitrogen 11875-119
DMEM, 500 ml Life Technologies/Invitrogen 11965-118
Penicillin/Streptomycin/Glutamine, 100x Life Technologies/Invitrogen 10378-016
PBS with magnesium and calcium, 500 ml Life Technologies/Invitrogen 14040-133
PBS without magnesium and calcium Life Technologies/Invitrogen 20012-050
Sarstedt tubes, assorted colors Sarstedt 72.694.996
Reservoir Trays for Multichannel, 55 ml Fisher 13-681-501
DEAE-Dextran Fisher NC9691007
Corning 96 well clear V bottom tissue culture treated microplate Fisher 07-200-96 Manufactured by Corning Life
HEPES, 1 M Buffer Solution Life Technologies/Invitrogen 15630-080
FBS, Defined, 500 ml Fisher SH30070 03
X-gal VWR PAV3941 Manufactured by Promega
Glutaraldehyde, Grade II, 25% in H2O Sigma-Aldrich G6257-100ML
1 M Magnesium chloride solution Sigma-Aldrich M1028-100ML
Formaldehyde solution, for molecular biology, 36.5% Sigma-Aldrich F8775-500ML
Potassium hexacyanoferrate(II) trihydrate Sigma-Aldrich P9387-100G
Potassium hexacyanoferrate(III) Sigma-Aldrich P8131-100G
Allegra X15-R centrifuge Beckman Coulter 392932
TC10 automated cell counter Bio-Rad 1450001
VistaVision inverted microscope VWR
Reverse-Transcriptase Quantification Assay Reagents
dTTP, [α-33P]- 3000 Ci/mmol, 10 mCi/ml, 1 mCi Perkin-Elmer NEG605H001MC
1 M Tris-Cl, pH 8.0 Life Technologies/Invitrogen 15568025 Must be adjusted to pH 7.8 with KOH
2 M Potassium chloride (KCl) Life Technologies/Invitrogen AM9640G Adjust to 1 M solution
0.5 M EDTA Life Technologies/Invitrogen 15575-020
Nonidet P40 Roche 11333941103
Polyadenylic acid (Poly rA) potassium salt  Midland Reagent Co. P-3001
Oligo d(T) primer Life Technologies/Invitrogen 18418-012
Dithiothreitol (DTT) Sigma-Aldrich 43815-1G
SR, Super Resolution Phosphor Screen, Small Perkin-Elmer 7001485
Corning Costar Thermowell 96-well plate model (M) Polycarbonate Fisher 07-200-245 Manufactured by Corning Life
Corning 96-well Microplate Aluminum Sealing Tape, Nonsterile Fisher 07-200-684 Manufactured by Corning Life
DE-81 anion exchange paper Whatman 3658-915
Trisodium citrate dihydrate Sigma-Aldrich S1804-1KG
Sodium Chloride Fisher S671-3
Autoradiography cassette Fisher FB-CA-810
Cyclone storage phoshpor screen Packard

DOWNLOAD MATERIALS LIST

References

  1. Borrow, P., Lewicki, H., Hahn, B. H., Shaw, G. M., Oldstone, M. B. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. Journal of virology. 68, 6103-6110 (1994).
  2. Koup, R. A., et al. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. Journal of virology. 68, 4650-4655 (1994).
  3. Jin, X., et al. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. The Journal of experimental medicine. 189, 991-998 (1999).
  4. Schmitz, J. E., et al. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science. 283, 857-860 (1999).
  5. Brumme, Z. L., et al. Marked epitope- and allele-specific differences in rates of mutation in human immunodeficiency type 1 (HIV-1) Gag, Pol, and Nef cytotoxic T-lymphocyte epitopes in acute/early HIV-1 infection. Journal of virology. 82, 9216-9227 (2008).
  6. Leslie, A. J., et al. HIV evolution: CTL escape mutation and reversion after transmission. Nature medicine. 10, 282-289 (2004).
  7. Phillips, R. E., et al. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature. 354, 453-459 (1991).
  8. Price, D. A., et al. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proceedings of the National Academy of Sciences of the United States of America. 94, 1890-1895 (1997).
  9. Goulder, P. J., et al. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nature. 3, 212-217 (1997).
  10. Tang, J., et al. Favorable and unfavorable HLA class I alleles and haplotypes in Zambians predominantly infected with clade C human immunodeficiency virus type 1. Journal of virology. 76, 8276-8284 (2002).
  11. Prentice, H. A., et al. HLA-B*57 versus HLA-B*81 in HIV-1 infection: slow and steady wins the race. Journal of virology. 87, 4043-4051 (2013).
  12. Migueles, S. A., et al. HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proceedings of the National Academy of Sciences of the United States of America. 97, 2709-2714 (2000).
  13. Leslie, A., et al. Additive contribution of HLA class I alleles in the immune control of HIV-1 infection. Journal of virology. 84, 9879-9888 (2010).
  14. Kaslow, R. A., et al. Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nature medicine. 2, 405-411 (1996).
  15. Altfeld, M., et al. Influence of HLA-B57 on clinical presentation and viral control during acute HIV-1 infection. AIDS. 17, 2581-2591 (2003).
  16. Kiepiela, P., et al. CD8+ T-cell responses to different HIV proteins have discordant associations with viral load. Nature medicine. 13, 46-53 (2007).
  17. Mothe, B., et al. Definition of the viral targets of protective HIV-1-specific T cell responses. Journal of translational medicine. 9, 208 (2011).
  18. Peyerl, F. W., Barouch, D. H., Letvin, N. L. Structural constraints on viral escape from HIV- and SIV-specific cytotoxic T-lymphocytes. Viral immunology. 17, 144-151 (2004).
  19. Rolland, M., et al. Broad and Gag-biased HIV-1 epitope repertoires are associated with lower viral loads. PloS one. 3, e1424 (2008).
  20. Wagner, R., et al. Molecular and functional analysis of a conserved CTL epitope in HIV-1 p24 recognized from a long-term nonprogressor: constraints on immune escape associated with targeting a sequence essential for viral replication. J Immunol. 162, 3727-3734 (1999).
  21. Wang, Y. E., et al. Protective HLA class I alleles that restrict acute-phase CD8+ T-cell responses are associated with viral escape mutations located in highly conserved regions of human immunodeficiency virus type 1. Journal of virology. 83, 1845-1855 (2009).
  22. Chopera, D. R., et al. Transmission of HIV-1 CTL escape variants provides HLA-mismatched recipients with a survival advantage. PLoS pathogens. 4, e1000033 (2008).
  23. Crawford, H., et al. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. The Journal of experimental medicine. 206, 909-921 (2009).
  24. Boutwell, C. L., et al. Frequent and variable cytotoxic-T-lymphocyte escape-associated fitness costs in the human immunodeficiency virus type 1 subtype B Gag proteins. Journal of virology. 87, 3952-3965 (2013).
  25. Brockman, M. A., et al. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. Journal of virology. 81, 12608-12618 (2007).
  26. Crawford, H., et al. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. Journal of virology. 81, 8346-8351 (2007).
  27. Martinez-Picado, J., et al. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. Journal of virology. 80, 3617-3623 (2006).
  28. Schneidewind, A., et al. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. Journal of virology. 81, 12382-12393 (2007).
  29. Wright, J. K., et al. Impact of HLA-B*81-associated mutations in HIV-1 Gag on viral replication capacity. Journal of virology. 86, 3193-3199 (2012).
  30. Kawashima, Y., et al. Adaptation of HIV-1 to human leukocyte antigen class I. Nature. 458, 641-645 (2009).
  31. Goepfert, P. A., et al. Transmission of HIV-1 Gag immune escape mutations is associated with reduced viral load in linked recipients. The Journal of experimental medicine. 205, 1009-1017 (2008).
  32. Brockman, M. A., et al. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. Journal of virology. 84, 11937-11949 (2010).
  33. Huang, K. H., et al. Progression to AIDS in South Africa is associated with both reverting and compensatory viral mutations. PloS one. 6, e19018 (2011).
  34. Wright, J. K., et al. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. Journal of virology. 84, 10820-10831 (2010).
  35. Wright, J. K., et al. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype. C. Journal of virology. 85, 3996-4006 (2011).
  36. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of virology. 59, 284-291 (1986).
  37. Brockman, M. A., Tanzi, G. O., Walker, B. D., Allen, T. M. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. Journal of virology. 131, 134-142 (2006).
  38. Ndung'u, T., Renjifo, B., Essex, M. Construction and analysis of an infectious human Immunodeficiency virus type 1 subtype C molecular clone. Journal of virology. 75, 4964-4972 (2001).
  39. Prince, J. L., et al. Role of transmitted Gag CTL polymorphisms in defining replicative capacity and early HIV-1 pathogenesis. PLoS pathogens. 8, e1003041 (2012).
  40. Ostrowski, M. A., Chun, T. W., Cheseboro, B., Stanley, S. K., Tremblay, M., et al. Detection assays for HIV proteins. Current protocols in immunology / edited by John E. Coligan ... [et al.]. 12, (Unit 12 15), Forthcoming.
  41. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, 61-68 (1989).
  42. Inoue, H., Nojima, H., Okayama, H. High efficiency transformation of Escherichia coli with plasmids. Gene. 96, 23-28 (1990).
  43. Bichara, M., Pinet, I., Schumacher, S., Fuchs, R. P. Mechanisms of dinucleotide repeat instability in Escherichia coli. Genetics. 154, 533-542 (2000).
  44. Ackerson, B., Rey, O., Canon, J., Krogstad, P. Cells with high cyclophilin A content support replication of human immunodeficiency virus type 1 Gag mutants with decreased ability to incorporate cyclophilin A. Journal of virology. 72, 303-308 (1998).
  45. Dudley, D. M., et al. A novel yeast-based recombination method to clone and propagate diverse HIV-1 isolates. BioTechniques. 46, 458-467 (2009).
  46. Ganser-Pornillos, B. K., von Schwedler, U. K., Stray, K. M., Aiken, C., Sundquist, W. I. Assembly properties of the human immunodeficiency virus type 1 CA protein. Journal of virology. 78, 2545-2552 (2004).
  47. Forshey, B. M., von Schwedler, U., Sundquist, W. I., Aiken, C. Formation of a human immunodeficiency virus type 1 core of optimal stability is crucial for viral replication. Journal of virology. 76, 5667-5677 (2002).
  48. Gottlinger, H. G., Dorfman, T., Sodroski, J. G., Haseltine, W. A. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proceedings of the National Academy of Sciences of the United States of America. 88, 3195-3199 (1991).
Bir Kısıtlama Enzim Temelli Klonlama Yöntemi değerlendirin<em&gt; In vitro</em&gt; HIV-1 Tipi C Gag-MJ4 Kimerik Virüslerin Çoğaltma Kapasitesi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).More

Claiborne, D. T., Prince, J. L., Hunter, E. A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses. J. Vis. Exp. (90), e51506, doi:10.3791/51506 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter