Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Stimulation de la cytoplasmiques ADN de détection Pathways doi: 10.3791/51593 Published: September 18, 2014

Summary

L'objectif du protocole est d'utiliser des méthodes optimales pour stimuler les voies cytoplasmiques ADN de détection dans les cellules et in vivo. Ce résultat est obtenu en améliorant le temps de génération de l'ADN double brin au cours de la ligature d'extrémités franches. Les cellules et les souris sont ensuite transfectées en utilisant un réactif de transfection lipidique.

Abstract

Afin de stimuler efficacement une réponse immunitaire innée, l'ADN doit être d'une longueur et une pureté suffisante. Nous présentons une méthode où l'ADN double brin (ADN double brin) qui a les caractéristiques requises pour stimuler l'ADN cytoplasmique voies de détection peuvent être générés à moindre coût et en toute simplicité. Par la concatémérisation de courts oligonucléotides synthétiques (qui n'ont pas de motifs CpG), l'ADN double brin peut être généré pour avoir une longueur suffisante pour activer la voie de l'ADN de détection cytosolique. Ce protocole implique de ligature d'extrémités franches les oligonucléotides en présence de polyéthylène glycol (PEG), qui fournit un environnement efficace pour la liaison de se produire. Les concatémères ADN double brin peuvent être utilisés, après purification par extraction au phénol / chloroforme, pour simuler la réponse immunitaire innée in vitro par des protocoles de transfection standard. Cet ADN peut également être utilisé pour stimuler l'immunité innée in vivo par injection intradermique dans le pavillon de l'oreille d'une souris, par exemple. Parstandardisation du processus de concatémérisation et les protocoles de stimulation ultérieures, une activation fiable et reproductible du système immunitaire inné peut être produit.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ADN est un élément essentiel de tous les organismes et les cellules eucaryotes, qui maintiennent dans des compartiments spécifiques. Une fonction du système immunitaire inné est de déterminer quand tel cloisonnement tombe en panne ou lorsque le matériau étranger est introduit dans l'organisme par une violation des obstacles externes, physiques. Dans le corps humain, il existe un certain nombre de protéines qui existent à l'aide de petites quantités de dégradation de l'ADN qui peut échapper à la bonne cloisonnement; DNAse I, II, et III défoncer ADN dans le plasma, endosome, et le cytosol, respectivement. Cependant, il a été démontré que des souris dépourvues de DNAse II meurent d'une anémie sévère provoquée par une production excessive d'interférons 1 suggérant que le système immunitaire inné répond à l'ADN extra-nucléaire. Cette réponse se produit même chez les souris qui sont entièrement déficiente de la capacité de signalisation du récepteur Toll-like. De nombreuses études ont maintenant démontré que stimulateur de gènes d'interféron (Sting) 2 et le réservoir de liaison kinase 1 (TBK1) 3 sont impliqués dans la détection de l'ADN dans le cytoplasme et que cette voie de signalisation active le facteur de régulation de l'interféron (IRF) -3 4. La transcription de IRF3 dépendante subséquente des cytokines, des chimiokines, des gènes de l'interféron et est caractéristique d'une réponse immunitaire innée, soit à un agent pathogène ou d'un danger associé à motif moléculaire (PAMP ou DAMP) 5.

Le désir d'étudier intracellulaires voies de détection de l'acide nucléique a conduit à la nécessité de développer des méthodes robustes et reproductibles pour la stimulation des cellules par l'introduction d'ADN ou d'ARN dans les cellules sans activer d'autres réponses immunitaires innées. Un procédé par lequel le / TBK1 / voie de IRF3 de piqûre peut être stimulée est d'utiliser cationiques réactifs de transfection lipide pour délivrer un acide nucléique dans le cytoplasme où il peut être accédé par des capteurs de l'ADN comme l'ADN-PK, IFI16, et CGA 8.6.

Les caractéristiques de l'ADN qui sont actuellement comprises pour permettre effactivation isant de la réponse immunitaire innée cytoplasmique sans stimulation d'autres voies sont sa longueur, la masse, la pureté et l'absence de motifs CpG 4,7,9. Les oligonucleotides synthétiques sont très convenable pour le but de générer une réponse immunitaire innée, car ils permettent la séquence d'ADN devant être optimisée et préparée comme une espèce chimique pur. Un ADN (ISD) séquence d'immuno-stimulation de 45 paires de bases a été identifié par Stetson et al. 4 comme étant une séquence appropriée, sans CpG à cet effet. Cette séquence d'ADN double brin est par ailleurs aléatoire et n'a pas de caractéristiques spécifiques au-delà de son manque de motifs CpG. Nous avons découvert que par l'oligonucléotide concatemerizing ISD significativement plus longues en brins augmente la grandeur de la stimulation 7. La génération d'ISD concatemerized est donc utile pour stimuler une réponse immunitaire innée cytoplasmique. Nous présentons ici les protocoles pour la préparation de ce réactif et comment il peut être utilisé pour activer la voie de l'ADN de détection envitro ainsi que in vivo.

NOTE: Toutes les études animales sont réalisées selon des protocoles approuvés institutionnels et les lignes directrices de soins aux animaux.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. concatémérisation

  1. Resuspendre les amorces Fw et Rv (voir le tableau des matériaux pour les séquences d'amorces) à une concentration de 10 pg / pl de la biologie moléculaire note H 2 O. Ensuite, mélanger 5 pi de Fw et 5 pi de Rv amorce dans un tube de 1,5 ml.
  2. Mélange d'amorces de recuit par chauffage à la température d'hybridation appropriée (75 ° C pour les amorces décrites ici) pendant 15 min. Laisser sur le banc de refroidir à la température ambiante (RT). Préparer le PEG8000 60% au cours de cette incubation par dissolution dans le trou DDH 2 O.
  3. Ajouter 50 ul de 60% ​​PEG8000 (pour atteindre une concentration finale de 30%), 10 pi de 10x polynucléotide kinase (PNK) tampon, 27 pi de H 2 O, et 3 pi de PNK à la composition de l'amorce. Incuber à 37 ° C pendant 2 heures.
  4. Refroidir à la température ambiante et ajouter 11 ul de tampon ADN ligase. Ajouter ensuite 3 U d'ADN ligase et on incube à 37 ° C pendant une nuit.

2 Purification de l'ADNAnalyse et

  1. Ajouter 300 ul de H 2 O pour augmenter le volume du mélange de ligature. Remarque: Procédez à une hotte en raison de la toxicité du phénol: chloroforme vapeur.
  2. Ajouter 1 volume (400 pi) de phénol: chloroforme et mélanger en agitant vigoureusement.
  3. Centrifugeuse à vitesse max pendant 1 min dans une microcentrifugeuse de table. Les phases aqueuse et de solvant se séparent de la phase aqueuse au-dessus et une couche blanche de protéine précipitée entre les deux couches.
  4. Transférer la couche supérieure dans un nouveau tube de pipetage attention (éviter le transfert du milieu, la couche blanche)
  5. Répéter les étapes 2.2 et 2.3 au moins deux fois ou jusqu'à ce qu'il n'y a pas de protéine précipité après centrifugation.
  6. Ajouter 1 volume (400 pi) de chloroforme et répétez les étapes 2.3-2.4.
  7. Ajouter 2 volumes (800 pi) de 100% d'éthanol préalablement refroidi et incuber à 20 ° C pendant au moins 1 heure ou jusqu'au lendemain. REMARQUE: cette étape précipite les concatémères ADN.
  8. Isoler à la vitesse max et aspirer supernatant. Laver une fois en ajoutant 1 ml de 70% d'éthanol et sécher à l'air dans une hotte.
  9. ADN Remettre en suspension dans 50 pi d'endotoxines ddH 2 O. Remarque: L'utilisation des endotoxines libres réactifs est critique pour la génération d'une réponse immunitaire innée spécifique de l'ADN dans des cellules et in vivo.
  10. Retirer une partie aliquote de 2 pl de l'ADN concatemerized dans un tube frais et ajouter 1 ml de tampon de gel de l'ADN de chargement.
  11. Dissoudre 1% d'agarose dans du tampon TAE par chauffage à pleine puissance dans un four à micro-ondes pendant 2 min (temps ou qui est approprié à la puissance du four et le volume).
  12. Verser le gel dans un appareil de coulée, ajouter 4 pl de colorant fluorescent de l'ADN de chélation, insérer un peigne, et laisser à température ambiante pendant environ 20 min pour le gel à définir.
  13. Une fois ensemble, enlever le gel de peigne et le lieu dans le réservoir d'électrophorèse contenant un tampon TAE. Charge 3 pl de l'échantillon ou la taille des marqueurs ADN dans les puits.
  14. Exécutez électrophorèse sur gel pour 30-40 min à 90 V avec un courant constant. Visualize l'ADN sous lumière ultra-violette d'observer concatémérisation (figure 1A).
  15. Mesurer la concentration de l'ADN dans le reste de l'échantillon par spectroscopie d'absorption UV. Blank le spectromètre avec le même trou DDH 2 O qui a été utilisé pour remettre en suspension l'ADN et mesurer le spectre d'absorbance de 200 à 300 nm. REMARQUE: concentration d'ADN peut être calculée en utilisant la loi de Beer-Lambert, A = e * c * l, où A est l'absorbance, e le coefficient d'extinction, et l la distance du trajet de la lumière. Pour la mesure de concentrations d'ADN de l'absorbance à 260 nm doit être mesuré et un coefficient d'extinction de 0,027 (pg / ml) -1 cm -1 utilisés. La distance de la trajectoire de la lumière, l, va varier en fonction du spectrophotomètre. Bien que la mesure de la concentration, de prendre note du rapport d'absorbance 260/280 nm comme une indication de la pureté de l'ADN; une valeur de ce ratio supérieur à 2,00 est recommandé.

3. transfection de dsADN concatémères de Vitro

  1. cellules de semences dans une boîte de culture de tissu ou une plaque à 70% de confluence au moment de la stimulation.
  2. Calculer la masse d'ADN nécessaire pour la stimulation de cellules en utilisant une concentration finale de 1 à 10 pg / ml. La masse requise de l'ADN est à noter que X ci-dessous. Par exemple, si la stimulation des cellules dans un seul puits d'une plaque à 6 puits avec 2 ml de milieu à une concentration d'ADN de 5 pg / ml, puis une masse de 2 * 5 = 10 ug d'ADN est requise.
  3. Ajouter 50 ul de X * un milieu exempt de sérum dans un tube stérile de taille appropriée. Pipette avec précaution dans le centre du milieu, sans toucher le côté du tube, 2 * pi X cationique réactif de transfection lipidique et laisser reposer pendant 5 min.
  4. Ajouter X pg d'ADN dans le tube et vortex brièvement. Laisser à température ambiante pendant au moins 20 min. Pour la transfection in vitro ajouter ce mélange directement dans les cellules à stimuler les voies de l'ADN cytoplasmique de détection.

4. transfection de l'ADN double brin concatémères jen Vivo

  1. Préparer mélange de transfection comme décrit dans 3.1 à 3.5 en utilisant une pg d'ADN, 2 pi de réactif de transfection lipide, et 18 ul de sérum par un milieu dépourvu de l'oreille de souris à être stimulée. Préparer un 20 pi Hamilton seringue stérile, bouchon avec une aiguille 30 G stérile, et charger avec le mélange d'ADN de transfection.
  2. Anesthésier une souris C57BL / 6 en utilisant 1-2% d'isoflurane. Confirmez l'anesthésie par une perte de mouvement et le rythme respiratoire constant et par test de réflexe de pincement si nécessaire. Surveiller les yeux de l'animal pendant l'anesthésie et utiliser la pommade comme nécessaire pour éviter la sécheresse excessive.
  3. En utilisant une technique stérile, injecter avec soin dans le pavillon de l'oreille 10 ul du mélange de transfection de sorte qu'un seul «bulle» de liquide est formé entre les couches dermiques de l'oreille. Remarque: Utilisez un dé à coudre en caoutchouc sur le pouce ou l'index, étirer l'oreille au-dessus, et injecter un angle aigu pour garantir l'aiguille ne pénètre que la première couche de la peau du pavillon de l'oreille.
  4. Reintroduire la souris dans la cage et régulièrement surveiller la récupération post-anesthésique. Utilisation d'une lampe de chauffage pour éviter un refroidissement excessif des souris anesthésiées. Ne pas laisser sans surveillance souris jusqu'à ce qu'ils aient repris conscience suffisante pour maintenir décubitus sternal.
  5. Flash geler l'ensemble du pavillon de l'oreille, dans un tube à centrifuger en l'immergeant dans de l'azote liquide pendant 2 minutes.

5 Traitement des échantillons d'ADN stimulée et l'analyse par PCR quantitative (qPCR)

  1. De la culture cellulaire: Aspirer le milieu avec une pipette et jeter les déchets.
  2. Ajouter 1 ml de PBS stérile. Répétez 5.1 et 5.2 deux fois et passez à l'étape 5.3
  3. À partir de tissus de l'oreille: broyer les tissus sous azote liquide à l'aide d'un pilon et le mortier en céramique stériles, transférer tissu broyé dans un tube à centrifuger aide d'une spatule stérile, et passez à l'étape 5.4
  4. Ajouter tampon de lyse 350 pi et de procéder à ARN commerciale protocole du kit d'extraction. Elute ARN à partir de l'extraction kit de purificationcolonne dans 40 ul ddH 2 O. Remarque: Le kit d'extraction d'ARN commercial (voir matériaux / table de l'équipement) fonctionne très bien; d'autres techniques ont été testées avec des résultats en dessous.
  5. Quantifier l'ARN par spectroscopie UV comme décrit ci-dessus pour l'ADN (section 2.13). Remarque: le coefficient d'extinction de l'ARN est de 0,025 (pg / ml) -1 cm -1.
  6. Ajouter à une PCR stérile tube 1 pi d'oligo (dT) amorce, une ul de 10 mM dNTP mix, et 250 ug d'ARN. Compléter le volume à 11 ul avec le trou DDH 2 O. stérile
  7. Incuber pendant 5 min à 65 ° C. Puis ajouter 4 pi First Strand Buffer, 1 pl 0,1 M dithiothréitol, 0,25 ul transcriptase inverse et 1,75 ul ddH 2 O dans le tube. Incuber à 50 ° C pendant 1 h, suivi par 72 ° C pendant 15 min. Eventuellement, diluer le produit ADNc 1: 5 en utilisant le trou DDH 2 O.
  8. Pour la PCR quantitative utilisation 2 ul d'ADNc, 2 pl ddH 2 O, 5 pi qPCR Master Mix, et 1ul de 10 uM de chaque marche avant et arrière des stocks d'amorces pour amplifier le gène (s) de choix. Mélanger dans une plaque à 96 puits et à analyser à l'aide d'un appareil de PCR quantitative (Figures 1B et 1C).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les résultats ci-dessous indiquent que l'ADN concatemerized peut être générée avec une relative facilité et est capable de stimuler une réponse immunitaire innée robuste dans des cellules et chez des souris. Avec l'utilisation de PEG8000, il peut être clairement vu que la longueur de l'ADN en cours de création est nettement plus longue et également capable d'induire la transcription de CXCL10. Comme on le voit par analyse sur gel d'agarose, la norme a concatémérisation longueurs d'ADN de plus de 800 paires de bases (pb), alors que pour l'échantillon de PEG8000, la longueur des brins d'ADN comprend de plus de 10 000 pb (figure 1A). La transfection de ces ADN dans les fibroblastes murins embryonnaires (MEF) ou la souris induit une transcription robuste de cytokines et de chimiokines qui peut être mesurée par PCR quantitative qui indique la stimulation de la machine de détection d'ADN immunitaire inné (Figures 1B et 1C).

annonce / 51593 / 51593fig1highres.jpg "/>
Figure 1: Des données représentatives indiquant la production de l'ADN concatemerized ISD (conDNA) et de la stimulation des fibroblastes et des souris. (A) un échantillon d'ADN concatemerized produites avec ou sans PEG8000 analysés par électrophorèse sur gel d'agarose. (B) MEF ont été stimulées avec différents ADN de 10 pg / ml et les concentrations de CXCL10 et les ARNm d'IL-6 mesuré par qPCR 6 h plus tard. (C) Les souris ont été injectés dans le pennes d'oreille avec conDNA et les niveaux de CXCL10 et les ARNm d'IL-6 mesurée par PCR quantitative 12 heures plus tard. Les données affichées sont multiplication par rapport au niveau de HPRT (RQ) et les barres d'erreur sont +/- SEM (n = 3).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les protocoles décrits ici sont utilisés pour générer l'ADN double brin à stimuler la réponse immunitaire innée cytosolique avec des résultats reproductibles dans une large gamme de types de cellules et in vivo. Etant donné que le réactif principal de substrat utilisé est un oligonucléotide synthétique, une certaine souplesse dans ce système pour l'utilisation de séquences d'ADN ou d'autres modifications chimiques. Il est possible, par exemple, à la place de l'oligonucléotide brin avant décrit dans ce protocole par une autre qui contient un marqueur fluorescent ou un fragment de biotine ou pour suivre la localisation d'évaluer les interactions avec d'autres biomolécules.

L'un des principaux avantages de concatémérisation ADN est la production de longs brins d'ADN double brin de manière que la séquence peut être contrôlée. Il est une limite qui est ici que la longueur de l'ADN ne peut pas être contrôlée avec précision de sorte que le produit de cette réaction est toujours un mélange d'ADN de longueurs différentes (similaire à l'ARN poly analogique commercial (I: C)). Un autre avantage de cette technique est qu'elle permet la production de grandes quantités de masse d'ADN immuno-stimulateurs (jusqu'à des quantités en mg). L'étape de concatémérisation peut être étendu facilement au besoin, mais il est à noter que les étapes de purification ultérieures doivent ensuite être réalisées dans des aliquotes de l'échelle décrite dans le protocole.

Par rapport aux autres méthodes de concatemerizing ADN, l'addition principale est l'utilisation de PEG8000 au mélange de ligature pour améliorer l'efficacité de ligature. Notez que PEG8000 peut être difficile de se dissoudre pour faire un 60% (p / v) stock mais peut être un vortex et chauffé doucement pour aider à la solubilisation. La ligature peut être laissée à incuber pendant des périodes plus longues que ne l'indique, mais cela ne semble pas affecter la longueur de l'ADN généré. Certains besoins de soins également être observées lors de la manipulation du phénol et du chloroforme comme ceux-ci peuvent être cancérigènes et corrosif. Dans nos mains les gènes régulés à la hausse par d'autres ADN synthétiques (tels que le poly commerciale (dA: DT)) sont différents de ceux régulés à la hausse par la DSI concatemerized. Cependant, d'autres n'ont pas trouvé de telles différences 10, ce qui peut refléter la variation entre les différents types de cellules en cours d'analyse. En dépit de ces conflits, la DSI concatemerized est nettement moins cher à produire, par rapport à l'achat poly (dA: dT) à partir d'une source commerciale, et permet une plus grande souplesse par l'intermédiaire de choix de la séquence et modifications.

Un aspect de la détection de l'ADN qui est sous-étudié est la réponse à la stimulation in vivo. Nous avons montré que ce protocole peut être utilisé pour générer de l'ADN approprié pour des expériences in vivo 7. Le produit est pur et l'ADN double brin de concentration suffisamment élevée pour permettre l'injection à des souris et l'évaluation ultérieure des processus immunitaires innées de signalisation. Dans le protocole décrit ici, il faut prendre soin de s'assurer que l'eau utilisée pour dissoudre le culot d'ADN finale est une endotoxine, RNase et DNase. L'injection de l'ADN libre ou ADNdes complexes de lipides entraîne une réponse à l'interféron comme prévu des procédés de détection de l'ADN et, par conséquent, l'ADN concatemerized peuvent être utilisés pour sonder des aspects multiples de l'ADN de détection in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Les auteurs n'ont aucun remerciements.

Materials

Name Company Catalog Number Comments
Forward primer Integrated DNA Technologies n/a TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer Integrated DNA Technologies n/a TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000 Sigma-Aldrich P-4463
Molecular biology grade water Sigma-Aldrich W4502-1L
T4 polynucleotide kinase Promega M4101
T4 DNA ligase Promega M1801
Phenol:chloroform Fisher Chemical BPE1752p-400
Chloroform Fisher Chemical C/4960/PB08
Ethanol Sigma-Aldrich 32221-2.5L
DNA gel loading buffer New England Biolabs B7021S
Agarose Bioline BIO-41025
Optimem Life Technologies 11058021
TransIT-LT1  Mirus Bioscience MIR 2300
Hamilton syringe Hamilton 80901 Model 1705
30 G needles  BD Bioscience 304000
SYBR Safe DNA gel stain Life Technologies S33102
Rneasy Plus Mini Kit Qiagen 74134
Oligo(dT) primer Thermo Scientific SO131
dNTP mix Fermentas R0192
Super Script III reverse transcriptase Life Technologies 56575
First strand cDNA synthesis buffer Life Technologies y02321
SybrGreen qPCR Fast master mix Applied Biosystems 4385612
cxcl10 murine forward primer  Integrated DNA Technologies n/a ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer Integrated DNA Technologies n/a TTCATCGTGGCAATGATCTC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer  Integrated DNA Technologies n/a GTAGCTATGGTACTCCAGAAGAC

DOWNLOAD MATERIALS LIST

References

  1. Yoshida, H., Okabe, Y., Kawane, K., Fukuyama, H., Nagata, S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat. Immunol. 6, 49-56 (2005).
  2. Ishikawa, H., Ma, Z., Barber, G. N. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 461, 788-792 (2009).
  3. Ishii, K. J., et al. TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines. Nature. 451, 725-729 (2008).
  4. Stetson, D. B., Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity. 24, 93-103 (2006).
  5. Pichlmair, A., Reise Sousa, C. Innate recognition of viruses. Immunity. 27, 370-383 (2007).
  6. Unterholzner, L., et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 11, 997-1004 (2010).
  7. Ferguson, B. J., Mansur, D. S., Peters, N. E., Ren, H., Smith, G. L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife. 1, e00047 (2012).
  8. Sun, L., Wu, J., Du, F., Chen, X., Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 339, 786-791 (2013).
  9. Honda, K., Taniguchi, T. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6, 644-658 (2006).
  10. Karayel, E., et al. The TLR-independent DNA recognition pathway in murine macrophages: Ligand features and molecular signature. Eur. J. Immunol. 39, 1929-1936 (2009).
Stimulation de la cytoplasmiques ADN de détection Pathways<em&gt; In Vitro</em&gt; Et<em&gt; In Vivo</em
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).More

Ku, C. H., Ferguson, B. J. Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo. J. Vis. Exp. (91), e51593, doi:10.3791/51593 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter