Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Quick Fluorescent Published: November 26, 2014 doi: 10.3791/52053
* These authors contributed equally

Abstract

Ved at kombinere RNA fluorescerende in situ-hybridisering (FISH) med immunofluorescens (immuno-FISH) skaber en teknik, der kan være ansat på enkelt celle niveau til sporing af rumlig dynamik RNA lokalisering med samtidig indsigt i lokalisering af proteiner, epigenetiske modifikationer og andre detaljer der kan fremhæves ved immunfluorescens. X-kromosom inaktivering er et paradigme for lang ikke-kodende RNA (lncRNA) -medieret gendæmpning. X-inaktiv specifik udskrift (Xist) lncRNA akkumulering (kaldet en Xist sky) på en af ​​de to X-kromosomer i hunner pattedyr er et afgørende skridt til at indlede X-kromosom inaktivering. Xist RNA direkte eller indirekte interagerer med forskellige kromatin-modificerende enzymer og indfører forskellige epigenetiske landskaber til det inaktive X-kromosom (Xi). En kendt epigenetisk kendetegnende for Xi er histon H3 trimethyl-lysin 27 (H3K27me3) ændring. Her beskriver vi en enkel og hurtig immuno-FISHProtokol til påvisning Xist RNA ved hjælp af RNA FISH med flere oligonucleotidsonder kombineret med immunfluorescens af H3K27me3 at undersøge lokalisering af Xist RNA og tilknyttede epigenetiske modifikationer. Anvendelse af oligonukleotidprober resulterer i en kortere inkubationstid og mere følsom detektion af Xist RNA sammenlignet med in vitro transskriberede RNA-prober (riboprober). Denne protokol giver et stærkt redskab til at forstå dynamikken i lncRNAs og de tilhørende epigenetisk modifikation, chromatinstruktur, nuklear organisation og transkriptionel regulering.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mammalian X-kromosom inaktivering (XCI) er en strategi til at kompensere for ubalancen i X-bundet gen dosering mellem XX og XY, hvor én af de to X-kromosomer hos kvinder er transkriptionelt inaktiveret 1. X-kromosom inaktivering er en stor model for lang ikke-kodende RNA (lncRNA) forskning. X-kromosom inaktivering reguleres af flere lncRNAs, og er blevet grundigt undersøgt i de seneste årtier for at afdække de crosstalk mekanismer mellem lncRNAs, transskription, kromatin struktur og nukleart organisation 2, 3.

X inaktivering center (XIC) placeret på X-kromosomet er en kompleks genetisk locus består af en række gener, der producerer ikke-kodende RNA'er 4. X-inaktiv specifik udskrift (Xist) lncRNA i eutherian pattedyr er en sådan lncRNA som spiller en afgørende rolle i X-kromosom inaktivering 5,6. Xist transkripter omgiver placeringen af ​​futuren Xi at indlede X-kromosom inaktivering, og fremstår som en sky, når visualiseret ved hjælp af RNA FISH; denne formation benævnt "Xist Cloud" 7. Da Xist RNA interagerer med forskellige kromatin-modificerende enzymer, observeres co-lokalisering af Xist skyer med forskellige epigenetiske modifikationer til lydløs kromatin og undertrykkende transskription under X-kromosom inaktivering 8. For eksempel Xist RNA interagerer med Polycomb undertrykkende kompleks 2 (PRC2), som er ansvarlig for H3K27me3 og inducerer en undertrykkende kromatin tilstand 9. Forekomsten af Xist sky på Xi og dets co-lokalisering med den intensive H3K27me3 modifikation udgør en fakultativ heterochromatin landskab af Xi 10,11.

Cytogenetiske teknikker, såsom DNA / RNA FISH er kommet en lang vej fra den traditionelle metode ved hjælp af radioaktivt mærkede prober 12 de seneste og avancerede teknikker med forbedret følsomhed ogfluorescerende billeddannelse ved hjælp af flere oligonukleotidprober 13,14. DNA / RNA-FISH kombineret med immunfluorescens er rutinemæssigt blevet anvendt som et cytologisk redskab til at forstå spatiotemporale nukleare organisation, RNA lokalisering, chromatin struktur og modifikationer. Den mest standard forberedelse probe for RNA FISH indebærer anvendelse af plasmid eller bakterielle kunstige kromosom (BAC) kloner og deres efterfølgende mærkning med enten nick translation eller tilfældig priming 15. Imidlertid næsten 70% af gener i mus og 40% af gener i mennesker viser en overlapning af sense- og antisense transkripter 16 og dermed kræver en streng-specifik FISH metode for at skelne sense- og antisense transkripter. In vitro transskriberede RNA-prober (riboprobe ) bruges ofte til streng-specifikke RNA FISH 17,18; men dette indebærer fremstilling af en plasmidklon eller PCR-produkt med T7, SP6, eller T3-promotor og syntetiserer riboprober. Endvidere riboprober afledt fra genomic DNA eller cDNA indeholder ofte ikke-specifikke regioner og repetitive elementer, der resulterer i høj baggrundsstøj. Et andet problem er, at riboprober, som er et par hundrede nukleotider i længden og indeholder flere fluoroforer, ikke effektivt kan trænge ind i kernen. For at omgå dette har flere kortere oligonukleotidprober mærket med en enkelt fluorophor i slutningen blevet udviklet, som har en god følsomhed, ensartet signalstyrke og let rensning og håndtering 14. Derudover er DNA-oligonukleotider er generelt mere stabile end RNA. Vi har anvendt en lignende strategi for at anvende oligonucleotider i Xist RNA FISH 19 med immunofluorescens at forstå epigenetiske dynamik Xi induceret af Xist lncRNA under processen med X-kromosom inaktivering. Denne protokol beskriver skabelsen af ​​oligonukleotidprober og ordentlig forberedelse af celler, samt udnyttelse af immunofluorescens og RNA fisk. Xist RNA FISH Brug af flere oligonucleotides er omkostningseffektiv tilgang på lang sigt, hvis Xist RNA FISH udføres rutinemæssigt i ens laboratorium. Denne teknik kan anvendes til at identificere lncRNAs i celler, samtidig med at kortlægge dens co-lokalisering med epigenetiske ændringer eller faktorer. En væsentlig fordel ved protokollen er mulighed for nemt at ændre det, der passer til ens forskningsinteresser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Probe Forberedelse

  1. Opnå flere unikke oligonukleotider i Xist (20-30 nukleotid-længde oligonukleotider, 63-65 ºC smeltende temperatur, tabel 1) med en 5'-amino modifikation og suspendere i vand.
  2. Pool ækvimolære mængder af oligonukleotider med 5'-amino modifikation (total 4,5 ug) og mærke med amin-reaktivt fluorescerende farvestof efter fabrikantens anvisninger.
    1. Opløses de poolede oligonukleotider i sidste 5 pi nuclease-frit vand, og der tilsættes 3 pi 1 M natriumbicarbonat til oligonukleotidet opløsning.
    2. Tilsæt 2 pi DMSO til hætteglasset med amin-reaktivt farvestof og vortex kortvarigt.
    3. Bland oligonukleotid løsning med det reaktive farvestof i DMSO og inkuber blandingen ved stuetemperatur i 1 time i mørke.
  3. Oprens fluorescensmærkede oligonukleotidprober af G-25-søjle efterfulgt af ethanoludfældning.
    1. Tilsæt 40 ​​pi nuclease-frit vand til mærkning blandingen fremstillet i trin 1.2.3 og gælder for G-25-søjle. Centrifuger ved 750 x g i 2 min.
    2. Tilsættes 50 pi nuclease-frit vand, 10 pi 3 M natriumacetat (pH 5,2) og 250 pi ethanol til det oprensede probe fra trin 1.3.2. Opbevares ved -80 ° C i 30 minutter og centrifugeres ved 21.000 xg i 15 minutter ved 4 ° C.
    3. Vask de udfældede oligonukleotider gang med 1 ml 70% ethanol.
    4. Resuspender i 50 pi nuclease-frit vand eller TE (10 mM Tris-HCI, pH 7,5; 1 mM EDTA) til en slutkoncentration på ca. 10 um.
  4. Fortynd fluorescensmærkede oligonukleotidprober til en slutkoncentration på 250 nM med hybridiseringsbuffer (10% formamid; 2 x SSC [300 mM NaCl; 30 mM natriumcitrat]; 2 mg / ml BSA, 10% dextransulfat).
    BEMÆRK: Med denne hurtig FISH protokol, oligonukleotid pklæder i Xist blev udformet og anvendt i en højere koncentration end den normale FISH protokol anvendelse af oligonukleotidprober med henblik på at forkorte inkubationstiden for hybridisering.

2. Skub Forberedelse

BEMÆRK: Slides kan fremstilles for immuno-FISH under anvendelse af muse embryonale stamceller (ES) eller embryoid legeme (EB) differentierende celler 20, 21 ved enten at dyrke dem direkte på en poly-lysin-behandlede objektglas eller ved hjælp af cytospin med cellesuspension. Her er forberedelse dias ved cytospin vist.

  1. Aspirer dyrkningsmediet i en 6-brønds skål. Vask med PBS (stuetemperatur), og aspirer grundigt.
  2. Tilsæt 0,5 ml af trypsin til 6-brønds skål, inkuberes i 5-10 minutter ved 37 ° C.
  3. Der tilsættes 5 ml medium og sprede celler ved forsigtigt at pipettere op og ned flere gange.
  4. Overfør celler til et 15 ml rør, centrifugeres i 5 minutter ved 200 xg ved stuetemperatur.
  5. Kassér mediet end forsigtigt suspendere cellerne i 2 ml PBS.
  6. Tæl celler under anvendelse af hæmocytometer og fortyndes cellesuspension ved 4 x 10 5 celler / ml af PBS.
  7. Saml et dias, et filter-kort og et kammer med et klip, og placere dem i de relevante slots i rotoren af ​​cytospin. Tilføj 250 pi af hver prøve fremstillet i trin 2.6 ind i hvert kammer i de samlede enheder i cytospin. Centrifugeres ved 1.500 rpm i 10 min ved stuetemperatur.
  8. Fill 3 Coplin-skåle på is med 40 ml af hver af iskold PBS, CSK buffer (10 mM PIPES, pH 6,8; 100 mM NaCl; 300 mM saccharose, 3 mM MgCl2) og CSKT buffer (CSK buffer med 0,5% Triton X-100), henholdsvis.
  9. Efter cytospin er færdig, hurtigt overføre objektglasset i iskold PBS og inkuberes i 5 min.
  10. Overfør objektglasset i iskold CSK buffer og inkuberes i 1 min.
  11. Overfør objektglasset i iskoldt CSKT puffer og inkuberes i 5 min.
  12. Overfør slæden tilbage i iskold CSK buffer og inkuberes i 1 min.
  13. Overfør objektglasset i 4% paraformaldehyd i PBS og inkuberes i 10 minutter ved stuetemperatur.

3. Immunofluorescens

  1. Objektglassene anbringes i en Coplin-skål med PBST (1x PBS med 0,1% Tween-20) i flere sekunder.
  2. Placer dias på skrå tillader resterende buffer at strømme ned diaset. Tør forsigtigt overskydende væske væk fra dias og placere den i et tomt pipette-tip kasse med vand. Overlay objektglasset med 40 pi blokerende opløsning (1x PBS, 1% BSA, 0,1% Tween-20), forsigtigt placere et dækglas og inkuberes i 10 minutter ved stuetemperatur.
  3. Fjern dækglasset, Den blokerende opløsning fjernes, og der tilsættes 40 pi histon H3K27me3 primære antistof fortyndet til en koncentration på 1: 500 i blokerende opløsning. Placer dækglasset tilbage på objektglasset og inkuberes i 30 minutter ved stuetemperatur.
    BEMÆRK: Et RNase inhibitor i blokerende løsning kunne være nyttigt at bevare RNA i denne RNA FISH protokol når der anvendes polyklonale antistoffer.
  4. Vask slide 2 gange i Coplin-skåle fyldt med PBST, i 5 min hver, forsigtigt ryste mens vask.
  5. Placer dias på skrå tillader resterende buffer at strømme ned diaset. Tør forsigtigt overskydende væske og placere slæden tilbage i spidsen kassen. Overlay med 40 pi af det sekundære antistof (1: 500) fortyndet med blokerende opløsning og et dækglas og inkuberes i 15 minutter i mørke. For de følgende trin, holde dias i mørke på alle tidspunkter.
  6. Vask 2 gange i Coplin krukker med PBST som i trin 3.4.

4. RNA FISH med oligonukleotidprober

  1. Pre-varme en tom pipette-tip kasse med vand i bunden til at forhindre slides tørrer ved 37 ° C for RNA FISH i trin 4.3.
  2. Placer dias på skrå tillader resterende buffer at strømme ned diaset. Tør forsigtigt overskydende væske ud af dias fra trin 3.6 og placere dias i pipette-tip boks med watER nederst. Tilføj 500 pi FISH vaskebuffer (10% formamid i 2 x SSC) på dias og inkuberes i 5 minutter ved stuetemperatur.
  3. Fjern FISH vaskeopløsning, tilsættes 8 pi oligonukleotidprober på dias, skal du placere et dækglas, og overføre dias til en forvarmet pipette-tip kasse med vand i bunden; inkuberes ved 37 ° C i 1-2 timer.
  4. Place 3 foropvarmet Coplin-skåle i et vandbad ved 37 ° C med fisk vaskebuffer, FISH vaskebuffer med DAPI, og 2x SSC.
  5. Efter 1-2 timers inkubation for RNA FISH, sætte glide ind i forvarmet FISH vaskebuffer.
  6. Inkubér slide for et par minutter, indtil dækglasset falder af objektglasset.
  7. Placér tilbage i vaskepuffer, og fortsætte inkubation i 5 min.
  8. Overfør objektglasset til en anden Coplin-skål med forvarmet FISH vaskebuffer med 0,5 ng / ml DAPI og inkuberes i 5 min.
  9. Overfør dias til et andet Coplin-skål med forvarmet 2x SSC og inkuberes i 5 kmn.
  10. Placer dias på skrå tillader resterende buffer at strømme ned diaset. Tør forsigtigt overskydende væske og placere slæden tilbage i en tør tip kassen. Tilføj 4 pi antiblegemiddel med DAPI på dias og placere et dækglas.
  11. Forsegl dækglasset med neglelak og observere under et mikroskop. Slæden kan opbevares ved 4 ° C i mørke i nogle få måneder.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Repræsentative billeder af hurtig immuno-fisk er vist i figur 1A. Co-lokaliseringen af ​​Xist RNA sky og H3K27me3 signal på Xi blev påvist i differentierende kvindelige celler. På dag 12 efter differentiering, mere end 90% af EB-celler havde en Xist cloud (figur 1B). Short oligonukleotidprober effektivt trængt ind i kerner, hvilket fører til en visualisering af næsten alle H3K27me3 signaler co-lokaliseres med Xist RNA (figur 1C, 97%, n = 150).

Figur 1
Figur 1: Xist RNA og H3K27me3 co-lokalisere på Xi i differentierende mus EB (A) Immuno-FISH for Xist RNA med H3K27me3 modifikation i differentierende kvindelige EB-celler på dag 12 efter differentiering.. Xist prober blev mærket med Alexa Fluor 488, og anti-H3K27me3 primære antistof var debeskyttet af anti-muse-IgG Alexa Fluor 555-konjugeret sekundært antistof. Kerner blev modfarvet med DAPI. Det indrammede område er forstørret i de nederste paneler. Scale barer:... 10 pm (B) Hyppigheden af Xist cloud og H3K27me3-positive celler i EB på dag 12 efter differentiering (C) Hyppigheden af co-lokalisering af Xist sky med H3K27me3 signal i EB på dag 12 efter differentiering venligst klik her for en større version af dette tal.

Tabel 1: Sekvens af fluorescens mærkede oligonukleotider til Xist RNA fisk. De 48 oligonukleotider blev syntetiseret med en 5'-amino modifikation at fremstille fluorescensmærkede oligonukleotidprober for Xist RNA FISH.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I dette papir har vi præsenteret en hurtig immuno-FISH protokol, der tager mindre end 5 timer at fuldføre præparatglaspræpareringsprotokol, Xist RNA FISH, og immunofluorescens for H3K27me3. I forhold til den generelle immuno-FISH metode til Xist RNA påvisning, hvilket skal normalt inkubation natten for RNA FISH, denne protokol ikke blot reducerer tidsforbrug, men også forbedrer følsomheden af ​​immun-FISH anvendelse af oligonukleotidprober.

Da Xist er stærkt transkriberet under X-kromosom inaktivering og dets transkript fundet intenst akkumuleres på Xi i cis, er det let at opdage Xist RNA signal i differentiering og differentierede celler med RNA-FISH udnytte en forholdsvis kort inkubationstid. Denne immuno-FISH-protokol kan anvendes til andre proteiner af interesse og rigelig RNA, selv kan være nødvendig optimering i immunofluorescens og RNA fisk. For at anvende denne protokol til andre RNA, numBER mulige oligonukleotidprober skulle tages i betragtning, efterfulgt af trial-and-error optimering af sonden koncentration, inkubationstid og temperatur for RNA FISH. Et eksempel på andre applikationer er vores tidligere succes med at afsløre telomeriske RNA ved hjælp af en enkelt LNA sonder 22. For sonde design og forberedelse til påvisning af lave rigelige RNA-mål, se artiklen af Raj og Tyagi 23. Et andet spørgsmål, der skal overvejes, er permeabilization skridt. Omhyggelig overvejelse om forskellige permeabilization betingelse er nødvendig; for eksempel kan mildere virkninger end hvad der er beskrevet i vores protokol forekomme med permeabilisering efter fiksering 15. Brug også forskellige permeabilisering procedurer, der skal overvejes, når de udfører immuno-FISH hjælp af forskellige celletyper. Rækkefølgen af ​​immunofluorescens og RNA FISH kan også påvirke påvisningen af ​​målproteiner, ændringer og RNA ved immuno-fisk. Hvis RNA FISH er udføreed før immunfluorescens, en times inkubation under RNA FISH segment er nok til at afsløre Xist RNA signal. Men da formamidet indeholdt i hybridiseringsbufferen og FISH vaskebuffer påvirker negativt H3K27me3 immunofluorescens, vi altid udfører H3K27me3 immunofluorescens før Xist RNA fisk i denne protokol. For andre anvendelser, at rækkefølgen af ​​procedurer vil afhænge af målproteiner og epigenetiske modifikationer observeres ved immunofluorescens. Som det primære antistof vi har brugt til H3K27me3 immunfluorescens har en høj titer og specificitet til H3K27me3 24, er vi i stand til at anvende en kortere inkubationstid for immunofluorescens. Imidlertid reaktionstid og temperatur for immunfarvning er afhængige af antistoffet anvendes, og dermed optimering er nødvendig for hvert antistof.

Anvendelse af oligonukleotidprober blev Xist RNA påvisning af RNA FISH væsentligt forbedret. I vores tidligere undersøgelser fandt vi, at en delmængde af differentiating celler med H3K27me3 farvning på Xi er ikke forbundet med Xist RNA-signal 25. Da H3K27me3 modifikation på Xi er forbundet med PRC2 rekruttering af Xist RNA 9-11, 26, vi spekuleret på, at dette var på grund af den ineffektive indtrængning af riboprober i kernerne i forhold til antistoffet for immunofluorescens. Ved anvendelse af oligonukleotidprober i denne protokol, bemærkede vi, at H3K27me3 signal i differentierende kvindelige celler næsten altid co-lokaliserede med Xist RNA (figur 1).

Denne hurtige immuno-FISH-protokollen gør det muligt for os at få et øjebliksbillede af de dynamiske ændringer kredser omkring Xist lncRNA og tilbyder et nyt værktøj til at hjælpe få en bedre forståelse af, hvordan lncRNA fungerer. IncRNAs påvirke forskellige cellulære funktioner såsom genomisk prægning, genregulering, RNA oversættelse, og RNA modning 27. Udvikling af en øget forståelse af den forskelligartede rolles spillet af lncRNA ville bidrage til at drive banen frem og give mulighed for fremtidige opdagelser i reguleringen af ​​vitale cellulære processer i det menneskelige legeme, samt bidrage til udviklingen af ​​potentielle mål for sygdomsbehandlinger. Da denne protokol kan let optimeres med hensyn til andre markører og lncRNAs af interesse, det er et fantastisk værktøj til at hjælpe med at tackle mysterier forskellige lncRNAs i celler.

Subscription Required. Please recommend JoVE to your librarian.

Materials

XP1 ggtaagtatccaaaaccccgttgg
XP2 cgatcagcagcaacagtacacg
XP3 gcaattggttgcttttatccagtcc
XP4 cgcaacaccgcacactaatacg
XP5 gccatcttagacacattcaagagcat
Xp6 cacacgtgaagtaccaagcgaaac
Xp7 gccacgtatagagcactgtaagagactatg
Xp8 caaagcacactatcagacgtgtcg
Xp9 ggagaatctagatgccataaaggcaag
XP10 tgatggacactgcattttagcactg
Xp11 ggacactgcattttagcaatacgattc
Xp12 gtgatgggcactgcattttagc
Xp13 agatgggctatctcagtcttataggct
Xp14 ggaagtcagtatggagggggtatg
Xp15 tgggactgtgactactacagcaatga
Xp16 aagactcaattcctagtcaggattatccac
Xp17 gggctgtagctctatgacagtgcttt
Xp18 gtcttcaccagatgcagattactacagtg
Xp19 aatagtttgaggaaggggtttcaagtg
XP20 gctgttcaggtttccttctgtagtga
Xp21 gcaagagatacaatggtccgaaaagt
Xp22 agcacttcgtacaaccctctttctg
Xp23 gaagagagcaggtcattcgtcagag
Xp24 gcaactgagacactgtagccatatgaag
Xp25 ttcctggaggaagaacggaaaga
Xp26 tgattagaaggcttaggtcatcttcca
Xp27 ttttgttcagagtagcgaggacttga
Xp28 aatagagcagaatggcttcctcgaa
Xp29 acattgcttgatcacgctgaagac
XP30 gcaaggaagaaatagacacacaaagc
Xp31 ggaagaaatagatgtaacaaagaattagacaca
Xp32 cacttcagagccacttgaatcctg
Xp33 agtcacaggtgtcctgtagaaacagttc
Xp34 cctttatgggcaatggcaacaat
Xp35 ggcacatctgcatattgcttgtcta
Xp36 gcaactaagaccatgaacccacaa
Xp37 aaacacactggccttaagtatatggactg
Xp38 cattcatttgcacacatggaacaat
Xp39 tgggagacaatatttagcctccaggt
Xp40 cctagcaagggcactgttttgtaataa
Xp41 taacatttagcacactgccttgcac
Xp42 cagtgatctacactaggtccacctcaca
Xp43 ttatgttgaaggaatcttggccttg
Xp44 aagtgagagctgtagtctcaaggtgtga
Xp45 gtattcaacctctgaggcaaactgtg
Xp46 agattgtggaacttagatggctgtca
Xp47 tggaactgcattaaagtcccaacttag
Xp48 gaactcccagacctcttcaacctg
Name Company Catalog Number Comments
oligonucleotides with 5’-amino modification IDT
Alexa Fluor 488 Reactive Dye Life Technologies A32750
MicroSpin G-25 columns GE Healthcare 27-5325-01
Cytospin 2 Shandon 59900102
Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer) Roche 10715859103
Histone H3K27me3 antibody Active Motif 61017
Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed Life Technologies A21424
ProLong Gold antifade reagent Life Technologies P36931

DOWNLOAD MATERIALS LIST

References

  1. Payer, B., Lee, J. T. X chromosome dosage compensation: how mammals keep the balance. Annu Rev Genet. 42, 733-772 (2008).
  2. Lee, J. T. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 12, 815-826 (2011).
  3. Gendrel, A. V., Heard, E. Fifty years of X-inactivation research. Development. 138, 5049-5055 (2011).
  4. Froberg, J. E., Yang, L., Lee, J. T. Guided by RNAs: X-inactivation as a model for lncRNA function. J Mol Biol. 425, 3698-3706 (2013).
  5. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. Requirement for Xist in X chromosome inactivation. Nature. 379, 131-137 (1996).
  6. Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. Xist-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev. 11, 156-166 (1997).
  7. Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol. 132, 259-275 (1996).
  8. Sado, T., Brockdorff, N. Advances in understanding chromosome silencing by the long non-coding RNA. Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).
  9. Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science. 322, 750-756 (2008).
  10. Plath, K., et al. Role of histone H3 lysine 27 methylation in X inactivation. Science. 300, 131-135 (2003).
  11. Silva, J., et al. Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell. 4, 481-495 (2003).
  12. Gall, J. G. Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis. Proc Natl Acad Sci U S A. 60, 553-560 (1968).
  13. Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. Visualization of single RNA transcripts in situ. Science. 280, 585-590 (1998).
  14. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods. 5, 877-879 (2008).
  15. Chaumeil, J., Augui, S., Chow, J. C., Heard, E. Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation. Methods Mol Biol. 463, 297-308 (2008).
  16. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, 1564-1566 (2005).
  17. Ogawa, Y., Xite Lee, J. T. X-inactivation intergenic transcription elements that regulate the probability of choice. Mol Cell. 11, 731-743 (2003).
  18. Panning, B. X inactivation in mouse ES cells: histone modifications and FISH. Methods Enzymol. 376, 419-428 (2004).
  19. Khalil, A. M., et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).
  20. Martin, G. R., Evans, M. J. Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).
  21. Lee, J. T., Lu, N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell. 99, 47-57 (1999).
  22. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, 685-698 (2009).
  23. Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472, 365-386 (2010).
  24. Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies. Cell Struct Funct. 33, 61-73 (2008).
  25. Ogawa, Y., Sun, B. K., Lee, J. T. Intersection of the RNA interference and X-inactivation pathways. Science. 320, 1336-1341 (2008).
  26. Kohlmaier, A., et al. A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol. 2, 171 (2004).
  27. Wang, K. C., Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904-914 (2011).
Quick Fluorescent<em&gt; In Situ</em&gt; Hybridisering Protokol for Xist RNA Kombineret med Immunofluorescens af histon Ændring i X-kromosom Inaktivering
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).More

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter