Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Snel Fluorescent Published: November 26, 2014 doi: 10.3791/52053
* These authors contributed equally

Abstract

Combineren RNA fluorescente in situ hybridisatie (FISH) met immunofluorescentie (immuno-FISH) maakt een techniek die kan worden toegepast bij de enkele cel niveau om de ruimtelijke dynamiek van RNA lokalisatie met gelijktijdige inzicht detecteren in de lokalisatie van eiwitten, epigenetische veranderingen en andere details die kan worden benadrukt door immunofluorescentie. X-chromosoom inactivatie is een paradigma voor lange niet-coderende RNA (lncRNA) gemedieerde silencing. X-inactief specifieke transcript (Xist) lncRNA accumulatie (genoemd Xist cloud) op één van de twee X-chromosomen in zoogdiercellen vrouwen is een kritieke stap voor X-chromosoom inactivatie initiëren. Xist RNA direct of indirect in wisselwerking met diverse chromatine-modificerende enzymen en introduceert verschillende epigenetische landschappen tot het inactieve X-chromosoom (Xi). Een bekende epigenetische kenmerk van de Xi is de histon H3 trimethyl-lysine 27 (H3K27me3) wijziging. Hier wordt een eenvoudige en snelle immuno-FISH beschrijven weprotocol voor het opsporen Xist RNA met behulp van RNA FISH met meerdere oligonucleotidenprobes combinatie met immunofluorescentie van H3K27me3 om de lokalisatie van Xist RNA en bijbehorende epigenetische veranderingen te onderzoeken. Met oligonucleotide probes resulteert in een kortere incubatietijd en gevoeligere detectie van Xist RNA vergeleken met in vitro getranscribeerd RNA probes (riboprobes). Dit protocol biedt een krachtige tool voor het begrijpen van de dynamiek van lncRNAs en de bijbehorende epigenetische modificatie, chromatine structuur, nucleaire organisatie en transcriptionele regulatie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Zoogdier X-chromosoom inactivatie (XCI) een strategie ter compensatie van de onbalans in X-gebonden gen doseringen XX en XY, waarbij één van de twee X-chromosomen bij vrouwen transcriptioneel geïnactiveerd 1. X-chromosoom inactivatie is een geweldige modelsysteem voor lange niet-coderende RNA (lncRNA) onderzoek. X-chromosoom inactivatie wordt geregeld op verschillende lncRNAs, en is uitgebreid bestudeerd in de afgelopen decennia om de overspraak mechanismen tussen lncRNAs, transcriptie, chromatine structuur en nucleaire organisatie 2, 3 ontdekken.

De X inactivatie centrum (XIC) op het X-chromosoom is een complexe genetische locus bestaat uit een aantal genen die niet-coderende RNA's 4. X-inactief specifieke transcript (Xist) lncRNA in eutherian zoogdieren is een dergelijke lncRNA die een cruciale rol in X-chromosoom inactivatie 5,6 speelt. Xist transcripties rondom de locatie van de futuur Xi aan X-chromosoom inactivatie initiëren, en verschijnen als een wolk bij gevisualiseerd met behulp van RNA FISH; Deze informatie is aangeduid als de "Xist Wolk" 7. Sinds Xist RNA interageert met verschillende chromatine-modificerende enzymen, is co-lokalisatie van de Xist wolken met verschillende epigenetische modificaties voor een stille chromatine en repressieve transcriptie waargenomen tijdens X-chromosoom inactivatie 8. Bijvoorbeeld, Xist RNA wisselwerking met polycomb repressieve complexe 2 (PRC2) die verantwoordelijk is voor H3K27me3 en induceert een repressieve chromatine staat 9. Het optreden van de Xist wolk op de Xi en zijn co-lokalisatie met de intensieve H3K27me3 wijziging een facultatieve heterochromatine landschap van de Xi 10,11.

Cytogenetische technieken, zoals DNA / RNA FISH hebben een lange weg van de traditionele methode met behulp speurstoffen 12 tot recente en geavanceerde technieken met verbeterde gevoeligheid enfluorescente beeldvorming met meerdere oligonucleotideprobes 13,14. DNA / RNA FISH combinatie met immunofluorescentie werd routinematig gebruikt als een instrument om cytologische spatiotemporele nucleaire organisatie, RNA lokalisatie, chromatinestructuur en modificaties begrijpen. De meeste standaard probe voorbereiding voor RNA FISH omvat het gebruik van plasmide of bacteriële kunstmatige chromosoom (BAC) klonen en hun verdere kenmerken hetzij nick-translatie of willekeurige priming 15. Echter, bijna 70% van de genen in muizen en 40% van genen bij de mens een overlap vertonen van sense en antisense transcripten 16, waardoor het met een strengs specifieke FISH methode om sense en antisense transcripten onderscheiden. In vitro getranscribeerde RNA probes (riboprobe ) worden vaak gebruikt voor strengs specifieke RNA FISH 17,18; echter, gaat het bereiden van een plasmide kloon of PCR product met T7, SP6 of T3-promotor en synthetiseren riboprobes. Bovendien riboprobes ontleend genomic DNA of cDNA bevatten vaak aspecifiek gebieden en repetitieve elementen, die resulteren in hoge achtergrondruis. Een ander probleem is dat riboprobes, die enkele honderden nucleotiden lang en bevatten meerdere fluoroforen, niet efficiënt kunnen doordringen in de kern. Om dit te omzeilen, hebben meerdere kortere oligonucleotide probes gelabeld met een fluorofoor aan het einde ontwikkeld die goede gevoeligheid, uniform signaalsterkte en gemak van zuivering en behandeling 14 hebben. Daarnaast DNA oligonucleotiden algemeen stabieler dan RNA. We pasten een soortgelijke strategie waarbij oligonucleotiden Xist RNA FISH 19 met immunofluorescentie de epigenetische dynamiek van de Xi geïnduceerd door Xist lncRNA tijdens het X-chromosoom inactivatie begrijpen. Dit protocol wordt het maken van oligonucleotideprobes en goede voorbereiding van cellen, alsook het gebruik van immunofluorescentie en RNA FISH. Xist RNA FISH gebruik van meerdere oligonucleotides is goedkopere wijze op de lange termijn als Xist RNA FISH routinematig uitgevoerd in een laboratorium. Deze techniek kan worden gebruikt om cellen te identificeren lncRNAs in kaart brengen en tegelijkertijd de co-lokalisatie met epigenetische veranderingen of factoren. Een groot voordeel van het protocol is de mogelijkheid om gemakkelijk passen een onderzoek interesses.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Probe Voorbereiding

  1. Het verkrijgen van meerdere unieke oligonucleotiden in Xist (20-30 nucleotide-lengte oligonucleotiden, 63-65 ºC smelttemperatuur, tabel 1) met een 5'-amino modificatie en te schorten in het water.
  2. Pool equimolaire hoeveelheden oligonucleotiden met 5'-amino modificatie (totaal 4,5 ug) en label met amine-reactieve fluorescerende kleurstof volgende instructies van de fabrikant.
    1. Los de samengevoegde oligonucleotiden in finale 5 pl nuclease-vrij water en voeg 3 ul van 1 M natriumbicarbonaat de oligonucleotide oplossing.
    2. Voeg 2 pl DMSO aan de flacon van amine-reactieve kleurstof en vortex kort.
    3. Meng de oligonucleotide oplossing met de reactieve kleurstof in DMSO en incubeer het mengsel bij kamertemperatuur gedurende 1 uur in het donker.
  3. Zuiver het fluorescent gelabelde oligonucleotide probes door G-25 kolom, gevolgd door ethanolprecipitatie.
    1. Voeg 40 ul nuclease-vrij water aan de etikettering mengsel verkregen in stap 1.2.3 en gelden voor de G-25 kolom. Centrifugeer bij 750 xg gedurende 2 min.
    2. Voeg 50 ul nuclease-vrij water, 10 pl 3 M natriumacetaat (pH 5,2) en 250 gl ethanol de gezuiverde probe uit stap 1.3.2. Bewaren bij -80 ° C gedurende 30 minuten en centrifugeer bij 21.000 xg gedurende 15 min bij 4 ° C.
    3. Was de neergeslagen oligonucleotiden eenmaal met 1 ml 70% ethanol.
    4. Resuspendeer in 50 ul nuclease-vrij water of TE (10 mM Tris-HCl, pH 7,5, 1 mM EDTA) voor een uiteindelijke concentratie van ongeveer 10 uM.
  4. Verdun de fluorescent gelabelde oligonucleotide probes tot een eindconcentratie van 250 nM met hybridisatiebuffer (10% formamide, 2x SSC [300 mM NaCl, 30 mM natriumcitraat]; 2 mg / ml BSA, 10% dextransulfaat).
    OPMERKING: Met deze snelle FISH protocol, oligonucleotide probes in Xist werden ontworpen en gebruikt in een hogere concentratie dan normaal FISH protocol oligonucleotideprobes te gebruiken om de incubatietijd voor hybridisatie verkorten.

2. Schuif Voorbereiding

OPMERKING: Dia's kunnen worden voorbereid voor immuno-FISH gebruik van muis embryonale stamcellen (ES) of embryoid lichaam (EB) differentiëren cellen 20, 21 door rechtstreeks ofwel groeien ze op een poly-lysine-behandelde dia of met behulp van cytospin met celsuspensie. Hier wordt de voorbereiding dia door cytospin getoond.

  1. Zuig het kweekmedium in een 6-putjes. Wassen met PBS (kamertemperatuur), en zuig grondig.
  2. Voeg 0,5 ml van trypsine aan de 6-putjes, geïncubeerd gedurende 5-10 minuten bij 37 ° C.
  3. Voeg 5 ml medium en verspreiden cellen door voorzichtig en neer te pipetteren meerdere malen.
  4. Overdracht cellen om een ​​15 ml buis centrifugeer gedurende 5 minuten bij 200 x g bij kamertemperatuur.
  5. Gooi het medium eend voorzichtig schorsen de cellen in 2 ml PBS.
  6. Tellen cellen met hemocytometer en verdund celsuspensie bij 4 x 10 5 cellen / ml PBS.
  7. Monteer een glijbaan, een filter-kaart en een kamer met een clip en plaats ze in de juiste sleuven in de rotor van de cytospin. Voeg 250 ul van elk bereid in stap 2.6 in elke kamer van de gemonteerde eenheden in de cytospin monster. Centrifugeer bij 1500 rpm gedurende 10 min bij kamertemperatuur.
  8. Vul 3 Coplin potten op ijs met 40 ml van ijskoude PBS, CSK buffer (10 mM PIPES, pH 6,8, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2), en CSKT buffer (CSK buffer met 0,5% Triton X-100), respectievelijk.
  9. Nadat de cytospin klaar snel de schuif over in ijskoude PBS en incubeer gedurende 5 min.
  10. Breng de dia in ijskoud CSK buffer en incubeer gedurende 1 min.
  11. Breng de dia in ijskoud CSKT buffer en incubeer gedurende 5 min.
  12. Breng de schuif terug in ijskoude CSK buffer en incubeer gedurende 1 min.
  13. Breng de schuif in 4% paraformaldehyde in PBS en incubeer gedurende 10 minuten bij kamertemperatuur.

3. Immuunfluorescentie

  1. Plaats de objectglaasjes in een Coplin jar met PBST (1x PBS met 0,1% Tween-20) gedurende enkele seconden.
  2. Plaats de dia's schuin waardoor de resterende buffer te stromen van de glijbaan. Veeg overtollige vloeistof uit de dia en plaats het in een lege pipet-tip doos met water. Overlay de dia met 40 ul van blokkeeroplossing (1x PBS, 1% BSA, 0,1% Tween-20), plaats voorzichtig een dekglaasje en incubeer gedurende 10 minuten bij kamertemperatuur.
  3. Verwijder het dekglaasje, verwijder de blokkerende oplossing en voeg 40 ul van het histon H3K27me3 primaire antilichaam verdund tot een concentratie van 1: 500 in blokkeeroplossing. Plaats het dekglaasje terug op de glijbaan en incubeer gedurende 30 minuten bij kamertemperatuur.
    OPMERKING: Een RNase-remmer in de blokkerende oplossing zou nuttig zijn om RNA in dit RNA FIS behoudenH-protocol wanneer polyklonale antilichamen worden gebruikt.
  4. Was schuif 2 keer Coplin potten gevuld met PBST gedurende 5 minuten elk, voorzichtig schudden tijdens het wassen.
  5. Plaats de dia's schuin waardoor de resterende buffer te stromen van de glijbaan. Veeg overtollige vloeistof en plaats de schuif terug in de doos tip. Overlay met 40 pl van het secundaire antilichaam (1: 500) verdund in blokkerende oplossing, plaats een dekglaasje en incubeer gedurende 15 minuten in het donker. Voor de volgende stappen, blijven de glijbaan in het donker te allen tijde.
  6. Was 2 keer Coplin potten met PBST zoals in stap 3.4.

4. RNA FISH met oligonucleotidenprobes

  1. Voorverwarmen lege pipet-tip box met water op de bodem om dia voorkomen drogen bij 37 ° C voor RNA FISH in stap 4.3.
  2. Plaats de dia's schuin waardoor de resterende buffer te stromen van de glijbaan. Veeg overtollige vloeistof uit de dia uit stap 3.6 en plaats de dia in de pipet-tip doos met water onderaan. Voeg 500 ul van FISH wasbuffer (10% formamide in 2x SSC) op het objectglaasje en incubeer gedurende 5 min bij kamertemperatuur.
  3. Verwijder FISH wasoplossing, voeg 8 pi oligonucleotide probes op de dia, plaats een dekglas en breng de dia naar een voorverwarmde pipet-tip box met water op de bodem; incuberen bij 37 ° C gedurende 1-2 uur.
  4. Plaats 3 voorverwarmde Coplin potten in een waterbad bij 37 ° C met FISH wasbuffer, FISH wasbuffer met DAPI, en 2x SSC.
  5. Na 1-2 uur incubatie voor RNA FISH, zet de schuif in de voorverwarmde FISH wasbuffer.
  6. Incubeer de glijbaan voor een paar minuten totdat het dekglaasje valt van de schuif.
  7. Plaats de schuif weer in de wasbuffer, en verder incuberen gedurende 5 min.
  8. Breng de dia naar een andere Coplin pot met voorverwarmd FISH wasbuffer met 0,5 ng / ml DAPI en incubeer gedurende 5 min.
  9. Breng de dia naar een andere Coplin pot met voorverwarmde 2x SSC en incubeer gedurende 5 kmn.
  10. Plaats de dia's schuin waardoor de resterende buffer te stromen van de glijbaan. Veeg overtollige vloeistof en plaats de schuif terug in een droge tip doos. Voeg 4 ul van antifade met DAPI op de dia en plaats een dekglaasje.
  11. Dicht de dekglaasje met nagellak en observeren onder een microscoop. De slede is bij 4 ° C worden bewaard in het donker gedurende enkele maanden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Representatieve beelden van snelle immuno-FISH zijn weergegeven in figuur 1A. Co-lokalisatie van de Xist RNA wolk en H3K27me3 signaal op de Xi werd ontdekt in het onderscheiden vrouwelijke cellen. Op dag 12 na differentiatie, meer dan 90% EB-cellen hadden een Xist wolk (Figuur 1B). Korte oligonucleotideprobes efficiënt doorgedrongen in de kernen, wat leidt tot een visualisatie van bijna alle H3K27me3 signalen gecolokaliseerd met Xist RNA (figuur 1C, 97%, n = 150).

Figuur 1
Figuur 1: Xist RNA en H3K27me3 co-lokaliseren op de Xi in het onderscheiden van de muis EB (A) Immuno-FISH voor Xist RNA met H3K27me3 wijziging in het onderscheiden vrouwelijke EB cellen op dag 12 na differentiatie.. Xist probes werden gelabeld met Alexa Fluor 488, en anti-H3K27me3 primair antilichaam werd Debeschermd door anti-muizen IgG Alexa Fluor 555-geconjugeerd secundair antilichaam. Kernen werden tegengekleurd met DAPI. De boxed regio wordt uitvergroot in de onderste panelen. Schaalbalken:... 10 pm (B) Frequentie van Xist cloud- en H3K27me3-positieve cellen in EB op dag 12 na differentiatie (C) Frequentie van co-lokalisatie van Xist wolk met H3K27me3 signaal in EB op dag 12 na differentiatie aub klik hier om een grotere versie van deze afbeelding te bekijken.

Tabel 1: Volgorde van fluorescent gelabelde oligonucleotiden voor Xist RNA FISH. De 48 oligonucleotiden werden gesynthetiseerd met een 5'-amino wijziging fluorescent gelabelde oligonucleotide probes bereiden Xist RNA FISH.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In dit artikel hebben we een snelle immuno-FISH protocol dat minder dan 5 uur duurt om dia voorbereiding, Xist RNA FISH, en immunofluorescentie voor H3K27me3 voltooien gepresenteerd. In vergelijking met de algemene immuno-FISH aanpak Xist RNA detectie, die meestal nodig overnacht incuberen RNA FISH dit protocol niet alleen aanzienlijk minder tijd, maar verbetert ook de gevoeligheid van immuun-FISH gebruik van oligonucleotide probes.

Aangezien Xist wordt sterk getranscribeerd in X-chromosoom inactivatie en transcript blijkt intens ophopen op de Xi in cis, is het gemakkelijk om Xist RNA te detecteren in differentiërende en gedifferentieerde cellen door RNA FISH gebruik van een relatief korte incubatietijd. Deze immuno-FISH protocol kan worden toegepast voor andere eiwitten van belang en overvloedige RNA, hoewel optimalisatie immunofluorescentie en RNA FISH vereist zijn. Om het protocol voor andere RNA, het number mogelijke oligonucleotide probes zouden moeten worden beschouwd, gevolgd door trial-and-error optimalisering van de concentratie van de sonde, incubatietijd en temperatuur RNA FISH. Een voorbeeld van andere toepassingen is onze eerdere succes bij het ​​opsporen van telomeer RNA met behulp van enkele LNA sondes 22. Voor probe-ontwerp en de voorbereiding voor de detectie van lage overvloedige RNA targets, zie het artikel van Raj en Tyagi 23. Een ander probleem dat moet worden beschouwd is de permeabilisatie stap. Zorgvuldige afweging ten aanzien van verschillende permeabilization conditie nodig is; bijvoorbeeld kan mildere effecten dan wordt beschreven in ons protocol na fixatie 15 optreden met permeabilisatie. Diverse permeabilisatie procedures moeten ook worden overwogen bij het uitvoeren van immuno-FISH met behulp van verschillende celtypen. De volgorde van immunofluorescentie en RNA FISH kan ook de detectie van doeleiwitten, modificaties en RNA door immuno-FISH. Als RNA FISH is uit te voerened voor immunofluorescentie, één uur incubatie tijdens de RNA FISH segment hebben Xist RNA te detecteren. Aangezien het formamide in de hybridisatiebuffer en FISH wasbuffer negatieve invloed H3K27me3 immunofluorescentie we altijd voeren H3K27me3 immunofluorescentie voor Xist RNA FISH in dit protocol. Voor andere toepassingen, de volgorde van de procedures zou afhangen van de doelgroep eiwitten en epigenetische modificaties te worden nageleefd door immunofluorescentie. Als primair antilichaam gebruikten we voor H3K27me3 immunofluorescentie een hoge titer en specificiteit H3K27me3 24, kunnen wij een kortere incubatietijd gebruikt voor immunofluorescentie. Echter, reactietijd en temperatuur immunokleuring zijn afhankelijk van het gebruikte antilichaam en derhalve optimalisering is nodig voor elk antilichaam.

Met oligonucleotide probes werd Xist RNA detectie door RNA FISH aanzienlijk verbeterd. In onze eerdere studies, vonden we dat een subset van differentiating cellen met H3K27me3 vlekken op de Xi zijn niet geassocieerd met Xist RNA signaal 25. Aangezien H3K27me3 modificatie op de Xi is gekoppeld aan PRC2 rekrutering door Xist RNA 9-11, 26, speculeerden wij dat dit te wijten was aan de inefficiënte penetratie van riboprobes in de kernen ten opzichte van het antilichaam voor immunofluorescentie. Door oligonucleotide probes in dit protocol, waargenomen dat H3K27me3 signaal differentiërende vrouwelijke cellen bijna altijd gecolokaliseerd met Xist RNA (Figuur 1).

Deze snelle immuno-FISH protocol stelt ons in staat om een ​​momentopname van de dynamische veranderingen die rond Xist lncRNA krijgen en biedt een nieuwe tool om te helpen krijgen een beter begrip van de manier waarop lncRNA werkt. IncRNAs invloed op verschillende cellulaire functies zoals genomische imprinting, genregulatie, RNA translatie en RNA rijping 27. Het ontwikkelen van een beter begrip van de diverse rols gespeeld door lncRNA hielpen de veld voort te stuwen en mogelijk later ontdekkingen in de regulatie van vitale cellulaire processen in het menselijk lichaam, en kan bijdragen tot de ontwikkeling van potentiële doelwitten voor de ziekte behandelingen. Aangezien dit protocol gemakkelijk kan worden geoptimaliseerd met betrekking tot andere markers en lncRNAs van belang, het is een geweldig hulpmiddel om te helpen bij de aanpak van de mysteries van verschillende lncRNAs in cellen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

XP1 ggtaagtatccaaaaccccgttgg
XP2 cgatcagcagcaacagtacacg
XP3 gcaattggttgcttttatccagtcc
XP4 cgcaacaccgcacactaatacg
Xp5 gccatcttagacacattcaagagcat
XP6 cacacgtgaagtaccaagcgaaac
XP7 gccacgtatagagcactgtaagagactatg
XP8 caaagcacactatcagacgtgtcg
Xp9 ggagaatctagatgccataaaggcaag
XP10 tgatggacactgcattttagcactg
Xp11 ggacactgcattttagcaatacgattc
Xp12 gtgatgggcactgcattttagc
Xp13 agatgggctatctcagtcttataggct
Xp14 ggaagtcagtatggagggggtatg
XP15 tgggactgtgactactacagcaatga
Xp16 aagactcaattcctagtcaggattatccac
XP17 gggctgtagctctatgacagtgcttt
Xp18 gtcttcaccagatgcagattactacagtg
Xp19 aatagtttgaggaaggggtttcaagtg
XP20 gctgttcaggtttccttctgtagtga
Xp21 gcaagagatacaatggtccgaaaagt
Xp22 agcacttcgtacaaccctctttctg
Xp23 gaagagagcaggtcattcgtcagag
Xp24 gcaactgagacactgtagccatatgaag
Xp25 ttcctggaggaagaacggaaaga
Xp26 tgattagaaggcttaggtcatcttcca
Xp27 ttttgttcagagtagcgaggacttga
Xp28 aatagagcagaatggcttcctcgaa
Xp29 acattgcttgatcacgctgaagac
XP30 gcaaggaagaaatagacacacaaagc
Xp31 ggaagaaatagatgtaacaaagaattagacaca
XP32 cacttcagagccacttgaatcctg
Xp33 agtcacaggtgtcctgtagaaacagttc
Xp34 cctttatgggcaatggcaacaat
Xp35 ggcacatctgcatattgcttgtcta
Xp36 gcaactaagaccatgaacccacaa
Xp37 aaacacactggccttaagtatatggactg
Xp38 cattcatttgcacacatggaacaat
Xp39 tgggagacaatatttagcctccaggt
Xp40 cctagcaagggcactgttttgtaataa
Xp41 taacatttagcacactgccttgcac
Xp42 cagtgatctacactaggtccacctcaca
Xp43 ttatgttgaaggaatcttggccttg
XP44 aagtgagagctgtagtctcaaggtgtga
Xp45 gtattcaacctctgaggcaaactgtg
Xp46 agattgtggaacttagatggctgtca
Xp47 tggaactgcattaaagtcccaacttag
Xp48 gaactcccagacctcttcaacctg
Name Company Catalog Number Comments
oligonucleotides with 5’-amino modification IDT
Alexa Fluor 488 Reactive Dye Life Technologies A32750
MicroSpin G-25 columns GE Healthcare 27-5325-01
Cytospin 2 Shandon 59900102
Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer) Roche 10715859103
Histone H3K27me3 antibody Active Motif 61017
Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed Life Technologies A21424
ProLong Gold antifade reagent Life Technologies P36931

DOWNLOAD MATERIALS LIST

References

  1. Payer, B., Lee, J. T. X chromosome dosage compensation: how mammals keep the balance. Annu Rev Genet. 42, 733-772 (2008).
  2. Lee, J. T. Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control. Nat Rev Mol Cell Biol. 12, 815-826 (2011).
  3. Gendrel, A. V., Heard, E. Fifty years of X-inactivation research. Development. 138, 5049-5055 (2011).
  4. Froberg, J. E., Yang, L., Lee, J. T. Guided by RNAs: X-inactivation as a model for lncRNA function. J Mol Biol. 425, 3698-3706 (2013).
  5. Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. Requirement for Xist in X chromosome inactivation. Nature. 379, 131-137 (1996).
  6. Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. Xist-deficient mice are defective in dosage compensation but not spermatogenesis. Genes Dev. 11, 156-166 (1997).
  7. Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol. 132, 259-275 (1996).
  8. Sado, T., Brockdorff, N. Advances in understanding chromosome silencing by the long non-coding RNA. Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).
  9. Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science. 322, 750-756 (2008).
  10. Plath, K., et al. Role of histone H3 lysine 27 methylation in X inactivation. Science. 300, 131-135 (2003).
  11. Silva, J., et al. Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes. Dev Cell. 4, 481-495 (2003).
  12. Gall, J. G. Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis. Proc Natl Acad Sci U S A. 60, 553-560 (1968).
  13. Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. Visualization of single RNA transcripts in situ. Science. 280, 585-590 (1998).
  14. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods. 5, 877-879 (2008).
  15. Chaumeil, J., Augui, S., Chow, J. C., Heard, E. Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation. Methods Mol Biol. 463, 297-308 (2008).
  16. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, 1564-1566 (2005).
  17. Ogawa, Y., Xite Lee, J. T. X-inactivation intergenic transcription elements that regulate the probability of choice. Mol Cell. 11, 731-743 (2003).
  18. Panning, B. X inactivation in mouse ES cells: histone modifications and FISH. Methods Enzymol. 376, 419-428 (2004).
  19. Khalil, A. M., et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).
  20. Martin, G. R., Evans, M. J. Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro. Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).
  21. Lee, J. T., Lu, N. Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell. 99, 47-57 (1999).
  22. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, 685-698 (2009).
  23. Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472, 365-386 (2010).
  24. Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies. Cell Struct Funct. 33, 61-73 (2008).
  25. Ogawa, Y., Sun, B. K., Lee, J. T. Intersection of the RNA interference and X-inactivation pathways. Science. 320, 1336-1341 (2008).
  26. Kohlmaier, A., et al. A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol. 2, 171 (2004).
  27. Wang, K. C., Chang, H. Y. Molecular mechanisms of long noncoding RNAs. Mol Cell. 43, 904-914 (2011).
Snel Fluorescent<em&gt; In Situ</em&gt; Hybridisatie Protocol voor Xist RNA gecombineerd met Immuunfluorescentie van histon-eiwitten in het X-chromosoom inactivatie
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).More

Yue, M., Charles Richard, J. L., Yamada, N., Ogawa, A., Ogawa, Y. Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation. J. Vis. Exp. (93), e52053, doi:10.3791/52053 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter