Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-exon Skipping Met behulp Cocktail antisense-oligonucleotiden in de Canine X-gebonden Muscular Dystrophy

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Exon skipping is momenteel een veelbelovende therapeutische optie voor Duchenne spierdystrofie (DMD). Om de toepasbaarheid voor DMD patiënten uit te breiden en de stabiliteit / functie van de resulterende afgeknotte dystrofine-eiwit te optimaliseren, een multi-exon skipping benadering met behulp van cocktail antisense oligonucleotiden werd ontwikkeld en we aangetoond systemische dystrofine redding bij een hond model.

Abstract

Duchenne spierdystrofie (DMD) is een van de meest voorkomende dodelijke genetische ziekten wereldwijd, veroorzaakt door mutaties in het dystrofine (DMD) gen. Exon skipping telt korte DNA / RNA-moleculen genaamd antisense oligonucleotiden (AONs), die de reading frame te herstellen en produceren kortere, maar functionele eiwitten. Echter, exon skipping therapie voor twee belangrijke obstakels: beperkte toepasbaarheid (tot slechts 13% van de patiënten kunnen worden behandeld met één AON geneesmiddel) en onzekere functie van afgeknotte eiwitten. Deze problemen werden behandeld met een cocktail AON aanpak. Terwijl ongeveer 70% van de DMD patiënten kunnen worden behandeld door één exon skipping (alle exons samen), kan men eventueel behandelen meer dan 90% van de DMD patiënten als multiple exon skipping behulp cocktail antisense middelen worden gerealiseerd. De honden X-gebonden spierdystrofie (CXMD) hond model, waarvan het fenotype is op humane DMD patiënten, werd gebruikt om de systemische effic testenacy en veiligheid van multi-exon skipping exons 6 en 8. De CXMD hondenmodel herbergt een splitsingsplaats mutatie in intron 6, wat leidt tot een gebrek aan exon 7 in dystrofine mRNA. Om het herstel van de reading frame in CXMD vereist multi-exon skipping van exons 6 en 8; Daarom is een goede CXMD middelgrote diermodel voor het testen van de werkzaamheid en veiligheid van multi-exon skipping. In de huidige studie, een cocktail van antisense morpholinos targeting exon 6 en exon 8 werd ontworpen en gerestaureerd dystrofine-expressie in het lichaam-brede skeletspieren. Werkwijzen voor transfectie / injectie cocktail oligos en evaluatie van de werkzaamheid en veiligheid van multi-exon skipping in de CXMD hondenmodel worden gepresenteerd.

Introduction

Duchenne spierdystrofie (DMD) is een X-gebonden recessieve spierziekte gekenmerkt door progressieve spierzwakte, eerst beschreven door Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD is een veel voorkomende erfelijke ziekte die ongeveer 1 op de 3500 jongens over de hele wereld, met ongeveer 20.000 getroffen kinderen geboren elk jaar 2,3. Motorische ontwikkeling wordt vertraagd en manier van lopen stoornissen worden gezien in de vroege jeugd 4, gevolgd door rolstoel afhankelijkheid bij ongeveer de vroege tienerjaren. De dood treedt meestal op in de leeftijd tussen 20 en 30 als gevolg van de luchtwegen of hartfalen 5-8. Er is momenteel geen remedie voor DMD. Behandeling met glucocorticoïden kan de progressie van spierdegeneratie vertragen tot op zekere hoogte, maar gaat gepaard met significante bijwerkingen, waaronder obesitas en diabetes mellitus 2,7,8. DMD gevolg van mutaties in het dystrofine (DMD) gen, wat leidt tot een verlies van functioneel dystrofine Protein. DMD is een zeer groot gen met meer dan 2 miljoen basenparen en 79 exons 9,10. Schrapping, onzin, en duplicatie mutaties die leiden tot out-of-frame van mutaties zijn de meest voorkomende oorzaak van de DMD fenotype. De gebieden van exons 3-9 en exons 45-55 worden "mutatie hotspots" aangezien de meeste patiënten deletiemutaties in deze gedeelten van het gen, wat leidt tot niet-functioneel dystrofine in DMD patiënten 3,9,11-16. Dystrofine functies binnen het dystrofine-glycoproteïne complex (DGC), die een belangrijke rol in spiermembraan stabilisatie. De N- en C-termini zijn de belangrijkste domeinen functie, terwijl de centrale stang domein speelt een minder grote rol 3,9,17. De naleving van een mild fenotype geassocieerd met Becker spierdystrofie (BMD), die vooral het gevolg is van in-frame mutaties binnen de DMD-gen, geïnspireerd op de toepassing van exon skipping voor de behandeling van DMD. BMD patiënten hebben een verkorte, maar functionaliteitenl, dystrofine-eiwit dat beide uiteinden 3,6,18 onderhoudt. Exon skipping, in theorie, kan het leeskader te herstellen, wat resulteert in verkorte-but-functioneel dystrofine eiwitten vergelijkbaar met die in BMD 3,19.

Meerdere typen antisense oligonucleotiden (AONs) zijn getest in klinische studies, met inbegrip van 2'O-gemethyleerd fosforothioaten (2'OMePS) en fosfordiamidaat morfolino-oligomeren (PMO). Skipping exons 51 en 53 met deze AONs is en zolang resultaten zijn veelbelovend, heeft één exon skipping beperkt toepasbaar, omdat het mutatie-specifieke 3, 19, 20,21, 22-26. Vragen blijven ook de stabiliteit van de verkregen verkorte dystrofine eiwitten afkomstig van één exon skipping 22,23. Bovendien hebben sommige patiënten vereisen meer dan een exon worden overgeslagen om het leesraam 3 herstellen. Hoewel technisch minder, multi-exon skipping is een methode diekan deze problemen aanpakken 3,19. Multi-exon skipping is eerder aangetoond in dystrofische honden en humane cellijnen in vitro. Daarnaast hebben mdx52 muizen en honden X-gebonden spierdystrofie (CXMD) hondenmodellen gebruikt voor in vivo studies 22, 24-27. Canine X-gebonden spierdystrofie Japan (CXMD J) beagles werden hier gebruikt, als leesraam van CXMD J kan worden hersteld door multi-exon skipping exons 6 en 8, of extra exonen (bv exons 3-9) (Fig 1). Beagle-gebaseerde CXMD deelt dezelfde mutatie patroon als de Golden Retriever spierdystrofie (GRMD) model, maar beagles zijn kleiner en goedkoper te onderhouden als gevolg van hun lichaamsgrootte, aldus een bruikbaar model voor DMD 28,29. CXMD honden nauwer na te bootsen de menselijke DMD fenotype dan kleinere diermodellen, zoals knaagdieren, en zijn meer betrouwbaar voor toxicologische evaluaties 3,22,30,31 (Figuur 2). CXMD honden tonen progressieve spier verval, loopstoornissen en hart- en ademhalingsproblemen vergelijkbaar met die in DMD. Vergeleken met één exon skipping, multi-exon skipping van toepassing is op een veel groter aantal patiënten. Van de drie meest voorkomende mutatie (deleties, nonsense en duplicaties), 80 - kan 98% van de patiënten worden behandeld door middel van multi-exon skipping 14,32,33, terwijl 45% van alle DMD patiënten kunnen profiteren van specifiek skipping exons 45 - 55 3,19,22,34.

Met de ontwikkeling van gemodificeerde morpholinos, is de efficiëntie van AON cocktails vergemakkelijking exon skipping verbeterd. Arginine-rich-cel penetrerende peptide-geconjugeerde PMO (PPMOs) en vivo-morpholinos (vPMOs) zijn AON chemische die aanzienlijk zijn verbeterd cel-penetrerende vermogen en de stabiliteit 3,35-38. Zorgen blijven over de lange termijn AON toxiciteit; echter aanzienlijke vooruitgangis gemaakt. Chemische modificaties aan morpholinos off-target effecten sterk verminderen en pre-klinische studies hebben geen significante toxische effecten 3,22,39,40 gemeld. Een overblijvende uitdaging voor multi-exon skipping is de huidige eis per individuele AON te testen op toxiciteit alleen, als een geneesmiddel, in plaats van samen als een cocktail 3,19,22,41,42. In DMD studies waarbij zowel single en multi-exon overslaan van gericht op het hart, is er weinig verbetering in dystrofische hartweefsel geweest. De werkzaamheid van morpholinos in het hart wordt verondersteld laag te zijn vanwege de slechte cel-penetrerende vermogen. Peptide-geconjugeerde PPMOs hebben het vermogen van AONs tot hartcellen dringen verbeterd, het verhogen van de hoeveelheid functioneel dystrofine-eiwit gered in het hart 3,19,38.

Hier wordt onze AON cocktail aanpak besproken, met inbegrip van het ontwerp van AON sequenties met behulp van ESEfinder software 43. ProtocOLS voor hond experimenten met multi-exon skipping worden ook beschreven. CXMD J beagles werden gebruikt voor exons 6 en 8 overslaan experimenten. Multi-exon skipping in de CXMD hond model geeft hoopvolle resultaten, maar uitdagingen blijven bestaan, dat moet worden opgelost voordat ze klinisch toepasbaar.

Protocol

Alle protocollen hieronder in overeenstemming zijn met de verzorging van dieren richtlijnen uiteengezet door het National Center Neurologie en Psychiatrie (NCNP) in Japan. Alle experimenten werden goedgekeurd door de Institutional Animal Care en gebruik Comite van de NCNP.

1. Ontwerp van Antisense Oligo

  1. Gebruik redding ESE en ESEfinder programma's om ESE plaatsen 44 detecteren, 45-47.
  2. Ontwerp 25 basenparen (bp) sequenties die antisense exonen die het doelwit zijn. Target exons 6 en 8 bij de hond model (figuur 1).
    1. Met 25 - 30 bp sequenties voor PMO (Tabel 1) of 25 bp voor 2'OMePS. Om 25 bp sequenties te ontwerpen, selecteert sequenties die binnen het doelgebied. Denk aan secundaire structuur, het vermijden van heterodimeren, exon splicing enhancer motieven, en GC-gehalte stabiele sequenties 43 te creëren. AONs ten minste één van de ESE doelplaatsen zoals geïdentificeerd door de bovengenoemde software.
    2. Select AONs met een GC-gehalte dat minder is dan 65%, minder dan 4 opeenvolgende 'G's en bevatten geen zelf-complementaire sequenties. Gebruik NCBI Blast software om off-target gloeien plaatsen 22,48,49 voorspellen.
  3. Selecteer een geschikte AON backbone chemie. Voor in vitro experimenten gebruiken 2'O-methyl oligonucleotiden (2'OMePS) of morpholinos. Voor in vivo-experimenten, gebruik 2'OMePS, morpholinos of vPMOs. 3,19,48,50

2. In vitro experimenten (Exons 6 en 8 overslaan in de CXMD Model)

  1. 2'OMePS Transfectie van Dog myoblasten
    1. Cultuur CXMD myoblasten in 3 ml groeimedium in 6-well platen. Seed 1-5 x 10 3 cellen / cm2 met 0,5 ml / cm 2 of medium voor myoblasten. Voor het groeimedium Gebruik gemodificeerd Eagle's medium van Dulbecco (DMEM) met 10% foetaal runderserum (FBS) en 1%penicilline / streptomycine (P / S) 40.
    2. Incubeer bij 37 ° C tot 60-80% confluent. Dit duurt ongeveer 12 tot 24 uur.
    3. Verdun een kationisch liposoom transfecteren middel aan een totaal van 100 pl in gereduceerde serum medium (2: 1 verhouding transfecteren octrooigemachtigde AONs, bijvoorbeeld 10 pl lipofectine vs. 5 ug AONs). Laat mengsel bij kamertemperatuur staan ​​voor 30 - 45 min.
    4. Verdun AONs (2'OMePS of morpholinos) tot een eindvolume van 100 pl in gereduceerde serum medium.
    5. Combineer het verdunde transfecteren middel met verdund AONs en incuberen bij kamertemperatuur gedurende 10-15 min.
    6. Terwijl de transfectie agent / AON mengsel zit bij RT, verwijder de oude media uit cellen via aspiratie en was cellen met de media.
    7. Voeg 0,8 ml media om de transfectie agens / AON mengsel en de gehele oplossing vervolgens toevoegen aan de vers-gewassen cellen. Incubeer gedurende 3 uur bij 37 ° C.
    8. Na incubatie, vervang media met diffion media (DM); differentiatie kan tot 10 dagen. Controleer of differentiatie heeft plaatsgevonden vanaf ongeveer dag 3 Differentiatie media DMEM met 2% paardenserum, 200 U / ml penicilline, 200 mg / ml streptomycine en 10 ug / ml insuline.
  2. Morfolino Transfectie van Dog myoblasten
    1. Cultuur CXMD myoblasten in groeimedium zoals beschreven in stap 2.1.
    2. Overschakelen naar differentiatie medium (DM) en voeg 0,1 mM voorraad morfolino aan elk putje om de uiteindelijke concentratie 1 uM te maken. Warmte cocktail morpholinos bij 65 ° C gedurende 10 minuten voor transfectie of injectie aan AON aggregatie voorkomen. Voeg een peptide levering reagens 39,51 en aan te passen tot een eindconcentratie van 3-6 uM.
    3. Na 16-48 uur incubatie, verzamel cellen voor RNA-extractie. Voeg 1 ml zuur guanidinium thiocyanaat-fenol-chloroform om de cellen cellen van de plaat los. Voer RNA winningtie na deze stap.
      1. Alternatief voeg trypsine ter bedekking van alle cellen en incubeer 2 minuten bij 37 ° C.
        Let op: Als plan om immunochemische uitvoeren, gebruikt chambered glijbaan glazen voor het kweken. Na differentiatie, cellen kunnen worden bevestigd met paraformaldehyde (PFA) (4% gedurende 10 min).
  3. RNA-extractie en Reverse Transcriptie Polymerase Chain Reaction (RT-PCR)
    1. Zodra cellen worden gedifferentieerd in myotubes, verwijderen medium en voeg 1 ml zure guanidinium thiocyanaat-fenol-chloroform; Incubeer 10 minuten bij kamertemperatuur.
    2. Transfer naar 1,5 ml buisjes. Combineer met 200 pl chloroform en incubeer bij kamertemperatuur gedurende 2 min tot drie afzonderlijke lagen zichtbaar. De drie lagen van boven naar beneden: een RNA-laag, een DNA laag en een laag eiwit.
    3. Centrifugeer bij 12.000 xg gedurende 15 min bij 4 ° C. Verwijder de bovenste laag bovenstaande vloeistof en plaats in een buis met 500 & #181; l isopropanol (indien hier stoppen, slaan de bovenstaande vloeistof bij -80 ° C). Centrifugeer het supernatant bij 12.000 xg gedurende 10 min bij 4 ° C; na centrifugeren, houd de resulterende RNA pellet en gooi de supernatant.
    4. Was de pellet met ethanol en centrifugeer bij 8000 xg gedurende 5 minuten bij 4 ° C. Verdamp resterende ethanol door het buisje gedurende 15 minuten en voeg vervolgens 15-30 gl RNase-vrij water. Kwantificeren totale RNA-concentratie met behulp van US / VIS-spectroscopie bij 260 nm.
    5. Combineer de vereiste reagentia voor een RT-PCR reactie: 1,5 pl 10 pM forward primer, 1,5 pl 10 uM reverse primer, 1 pl dNTP, 5 pl éénfasige PCR kit-buffer, 0,7 pl RNase-remmer, 1 pi enzymmengsel van één- stap PCR-kit, en 200 ng van RNA. Zodra deze zijn gemengd, voeg water tot een eindvolume van 25 pl.
    6. Plaats mengsel in een thermo-cycler. Voer een 30 minuten cyclus bij 50 ° C, 15 min0; cyclus bij 95 ° C, daarna 35 cycli van 94 ° C gedurende 1 min, 60 ° C gedurende 1 min en 72 ° C gedurende 1 min. Tenslotte lopen een 10 minuten cyclus bij 72 ° C. WINKEL PCR product in een koelkast bij 4 ° C of -20 ° C
  4. Complementair DNA (cDNA) Sequencing
    1. Identificeer exon 6-9-overgeslagen banden middels agarosegelelektroforese. Belasting 5 pi van elk monster in de putjes van een 1,5% agarosegel gerund 135 V door de gel gedurende 5 min en vervolgens 120 V gedurende 20 minuten. Vervolgens incubeer de gel in DNA gel stain bij kamertemperatuur gedurende 30 min. Visualiseer de banden met behulp van beeldbewerkingssoftware.
    2. Accijnzen de band van belang met behulp van een gel extractie kit.
      1. Te snijden en het DNA-fragment oplosbaar gel slice via 200 gl NTI / 100 mg gel. Laat dit zitten gedurende 5 tot 10 min in een 50 ° C waterbad. Vervolgens transfer naar membraanbuis silica.
      2. Centrifugeer bij 11.000 g gedurende 30 sec. Was tweemaal met 700 ul NT3 buffer voordat centrifuging opnieuw bij 11.000 xg gedurende 30 sec.
      3. Droog de silica membraan door centrifugeren bij 11.000 xg gedurende 1 min.
      4. Voeg 15-30 ul NE buffer en laat het zitten bij KT gedurende 1 minuut. Vervolgens centrifugeren bij 11.000 xg gedurende 1 min. Verwijder de kiezelgel en de inhoud in de buis te houden.
    3. Gebruik een sequencing kit om de sequentie te bepalen volgens het protocol van de fabrikant.

3. intramusculaire injecties of Open spierbiopsie

  1. Voor het onderhoud van steriele omstandigheden tijdens de survival operatie, verwijder haar met tondeuse in de omgeving van de operatie site (de achterste ledematen). Gebruik jodoforen of chloorhexidine als ontsmettingsmiddel. Gebruik steriele doeken voor de chirurgische plaats door het plaatsen en het veiligstellen van hen over het gehele dier en de operatietafel.
    1. Draag schone scrubs, gezichtsmaskers, hoofdbedekking, steriele handschoenen en speciale schoenen voor de operatiekamer 52,53.
    2. </ Ol>
    3. Injecteer CXMD honden met 20 mg / kg thiopental natrium te verdoven. Gebruik dierenarts zalf op de ogen te voorkomen dat de ogen uitdrogen.
    4. Gebruik 2-3% isofluraan inhalatie verdoving (figuur 3) te handhaven. Controleer spier reflexen en bewaken hart en de ademhaling om de diepte van de anesthesie te beoordelen. Het normale ademhaling (RR), hartslag (HR) en SpO 2 onder narcose zijn als volgt: RR: 10-20 ademhalingen / min; SpO 2: 95-100%, HR: 80 - 120 slagen per minuut (bpm).
    5. Met behulp van een scalpel, snijd de huid over de tibiale craniale (CT), ook bekend als de tibialis anterior (TA) en maak een single cut ongeveer 5 cm lengte (jonge volwassen honden). Om de injectieplaats markeren, steek de diepe fascia met behulp van een chirurgische naald en chirurgische draad en maak twee steek markers bij 2 cm intervallen.
    6. Injecteer de gewenste concentratie van AONs in de spier met een 27 G naald. De gewenste concenstratie varieert tussen de behandeling. Voor CT, geven twee injecties van 1 ml volume per stuk, voor een totaal van 1,2 mg cocktail PMO (0,4 mg elk PMO) of 0,4 mg cocktail vPMOs (0,13 mg per vPMO). Voor de extensor carpi ulnaris (ECU) voorpoot spier, injecteer twee delen van elk 0,5 ml voor een totaal van 1,2 mg cocktail PMO (0,4 mg elk PMO) of 0,4 mg cocktail vPMOs (0,13 mg per vPMO). Laat de naald in 1 min. Gebruik een gelijke hoeveelheid van elk AON voor de cocktail.
    7. Voer geopend spierbiopsie door het verwijderen van een stukje spierweefsel ongeveer 2 cm in lengte van CT spier met een chirurgische scalpel.
    8. Ga naar stap 6.5 voor spier monstervoorbereiding.
    9. Met behulp van een naald, toedienen van een intramusculaire injectie van 0,02 mg / kg buprenorfine hydrochloride voordat ontwaken uit narcose. Leg spierfascie en de huid terug over spieren en steek deze met behulp van een 3-0 absorbeerbare draad en 3-0 nylon draad voor spier fascia en de afsluiting huid, respectively.
    10. Houd de mond open, te bepalen of de kokhalsreflex is teruggekeerd; wanneer de kokhalsreflex is teruggekeerd, extuberen de hond.
    11. Dien 15 tot 30 mg / kg cefazoline of cefalexine (antibiotica) gedurende 3 dagen via intraveneuze of intramusculaire injectie om infectie te voorkomen.
    12. Verwijder hechtingen binnen zeven dagen. Laat de hond zonder toezicht totdat het voldoende bewustzijn heeft herwonnen om borstligging houden en niet toestaan ​​dat de hond om te communiceren met andere dieren tot een volledig herstel wordt gemaakt. Houd de endotracheale tubes plaats zo lang mogelijk en verwijderen als het dier begint te kauwen en slikken. Monitor van het dier hartslag, ademhaling, en hydratatie om ervoor te zorgen dat ze stabiel zijn en binnen de normale grenzen.
    13. Voor de post-operatie zorg, bieden analgesie gedurende 3 dagen (bv buprenorfine 0,01 mg / kg) en verpleegkundige ondersteuning, met inbegrip van een rustige, donkere rustplaats passende wond en bandage onderhoud, een zachtesteunoppervlak, rehydratie met orale of parenterale vloeistoffen, en een terugkeer naar normale voeding door het gebruik van zeer smakelijke voedingsmiddelen of behandelt. Indien nodig de dieren extra medicatie, geven een intramusculaire injectie van 0,3 mg / kg butorfanol tartraat afhankelijk van de pijnklachten.
      Let op: Honden in pijn kan bijten, krabben of te bewaken pijnlijke regio's, en indien behandeld, kan ongewoon angstig of agressief zijn. Bovendien, pijn in een ledemaat resulteert gewoonlijk in hinken of houden stand van de aangetaste ledemaat met pogingen om het te gebruiken. In dergelijke situaties geven een intramusculaire injectie van 0,02 mg / kg buprenorfine hydrochloride elke 6-8 uur.

    4. Systemische Injecties

    Opmerking: Deze procedure kan wekelijks of tweewekelijks worden herhaald voor het gewenste aantal weken.

    1. handmatig en voorzichtig te beperken honden door het verkrijgen van de hond om te gaan liggen en dan draperen armen boven de schouders en heupen om de hond de hele t zijn plaats te houdenhij procedure.
    2. Injecteren AONs; 120-240 mg / kg cocktail PMO (40-80 mg per AON) met behulp van een veneuze inwonende naald in een ader ledemaat (bekend als een cephalic of vene). De hoeveelheid AON geïnjecteerd afhankelijk van de experimentele conditie. Gebruik een gelijke hoeveelheid van elk AON voor de cocktail.
    3. Gebruik een infuuspomp of spuitpomp met 50 ml totaal injecteren met een snelheid van 2,5 ml / min gedurende 20 min, de instructies van de fabrikant. Herhaalde injecties wekelijks of tweewekelijks (elke twee weken) ten minste 5 maal, zoals dystrofine accumuleert met herhaalde injecties.
    4. Voer bloedtesten wekelijks om de toxiciteit te onderzoeken.
      1. Met een naald, verzamelen 3 ml bloed - 0,5 ml voor complete bloedtelling (CBC) en 2,5 ml voor anderen - van een van de onderhuidse aderen van de voor- of achterpoot. Omvatten CBC, gamma-glutamyl transferase (GGT), aspartaataminotransferase (AST), bloedureum stikstof (BUN), alanine aminotransferase (ALT), creatine kinase (CK) en creatinine assessments bij het ​​testen van de verzamelde bloed, volgens de instructies van de fabrikant van het bloed testkits. 40,54

    5. Klinische Grading of Dogs

    1. Het opzetten van een videocamera en opnemen hondengedrag en manier van lopen. Noteer de hele ontmoeting met de hond als deze zal fungeren als een referentie bij de indeling van de hond; Dit betekent dat elke video zal een andere lengte afhankelijk van de mogelijkheden en de bereidheid van de hond te zijn. Gebruik standaard opname parameters. Filmen creëert een record van de indeling zodat het kan worden beoordeeld op een later tijdstip.
    2. Grade gang en beweging stoornissen.
      1. Voor gang en beweging stoornissen, gebruikt u de volgende kwaliteiten:
        graad 1 = geen, rang 2 = zitten met de achterste ledematen verlengd, graad 3 = bunny-hop met de achterpoten, graad 4 = schuifelend lopen, en rang 5 = niet in staat om te lopen.
      2. Voor mobiliteit verstoring, gebruikt u de volgende kwaliteiten: graad 1 = geen, grade 2 = liggen meer dan normaal, graad 3 = kan niet springen op de achterpoten, graad 4 = toenemende moeilijkheidsgraad bewegen, en rang 5 = niet in staat om op te staan ​​en te verplaatsen.
    3. Time hoe lang het duurt voordat de hond tot 15 m lopen. Meet 15 m, plaatst u de hond op de startlijn en aan te moedigen het aan loopt tot 15 m mark.
    4. Bepaal spieratrofie van de ledemaat met behulp van de volgende indelingsschema:
      graad 1 = geen, rang 2 = verdachte hardheid, graad 3 = kan hardheid voelen of lijkt dun, graad 4 = tussen de rangen 3 en 5, en rang 5 = extreem dun of hard.
    5. Grade kwijlen met behulp van de volgende schaal: graad 1 = geen, rang 2 = af en toe druppelt speeksel bij het zitten, graad 3 = sommige kwijlen bij het eten en drinken, graad 4 = snaren van kwijlen bij het eten of drinken, en rang 5 = continu kwijlen.
    6. Grade hypertrofie van de tong (macroglossia) met behulp van de volgende schaal: graad 1 = geen, rang 2 = iets vergroot, graad 3 = verlengde outside gebit, graad 4 = vergrote en enigszins verdikt, en rang 5 = vergroot en verdikt.
    7. Grade vermogen van de hond om te slikken met behulp van de volgende schaal: graad 1 = geen moeite, rang 2 = kost tijd en moeite in het nemen van voedsel, graad 3 = moeite met het nemen van voedsel van een plaat, graad 4 = moeite met kauwen, slikken, of drinken en graad 5 = niet in staat om te eten.
    8. Bereken totaal gehalte door toevoeging van dezelfde scores (met uitzondering van de 15 miljoen strekkende test) 55.
      Opmerking: De onderzoeken worden verblind zodat er geen vertekening.

    6. Magnetic Resonance Imaging (MRI)

    1. Gebruik een 3 Tesla (3T) MRI en 18 cm diameter / 18 cm lengte menselijke ledematen spoel T2-gewogen beelden van achterpoten ledematen te verkrijgen.
    2. Verdoven dieren door het injecteren CXMD honden met 20 mg / kg thiopental. Gebruik dierenarts zalf op de ogen te voorkomen dat de ogen uitdrogen. Gebruik 2-3% isofluraan inhalatie verdoving te handhaven.
      1. Controleer spier reflexen en bewaken hart en de ademhaling om de diepte van de anesthesie te beoordelen. Het normale ademhaling (RR), hartslag (HR) en SpO 2 onder narcose zijn als volgt: RR: 10-20 ademhalingen / min, SpO 2: 95-100%, HR: 80 - 120 slagen per minuut (bpm ).
    3. Gebruik de volgende instellingen om T2-gewogen beelden te verkrijgen: TR / TE = 4000/85 msec, slice dikte = 6 mm, slice gap = 0 mm, gezichtsveld = 18 cm x 18 cm, matrix size = 256 x 256, en aantal acquisities = 3 tijdens het snel spin-echo (Figuur 4).

    7. Muscle bemonstering en de bereiding (autopsie)

    Opmerking: Spieren moeten een of twee weken worden bemonsterd na de laatste injectie AON.

    1. Injecteer honden met 20 mg / kg thiopental natrium te verdoven. Gebruik dierenarts zalf op de ogen tijdens anesthesie om uitdroging van de ogen te voorkomen.
    2. Gebruik 2-3% isofluraan inhalatie aan Anes behoudenThesia. Controleer spier reflexen en bewaken hart en de ademhaling om de diepte van de anesthesie te beoordelen. Het normale ademhaling (RR), hartslag (HR) en SpO 2 onder narcose zijn als volgt: RR: 10-20 ademhalingen / min; SpO 2: 95-100%, HR: 80-120 bpm.
      1. Euthanaseren honden door verbloeding onder algemene verdoving (alleen voor autopsie). Gebruik leegbloeden onder diepe narcose de effecten van bloed afgeleide factoren in de moleculaire analyse (bijvoorbeeld hartspieren) voorkomen.
    3. Ontleden de volgende spieren (figuur 5): CT, extensor digitorum longus (EDL), gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, deltoideus, ECU, extensor carpi radialis (ECR), FCU (FCU ), flexor carpi radialis (FCR), gracilis, intercostale, buikspieren, middenrif, laterale dorsi, slokdarm, sternocleidomastoideus, en het hart. Om de toxiciteit te onderzoeken, het verzamelen van de nieren en de liVer monsters. Gebruik Evans en Alexander de Lahunta (2009) als referentie voor dissectie techniek 56.
    4. Snijd de CT, EDL, gastrocnemius, soleus, biceps femoris, rectus femoris, biceps brachii, triceps brachii, deltoideus, ECU, ECR, FCU, FCR, gracilis, intercostale, buikspieren, laterale dorsi, slokdarm, sternocleidomastoideus, hart, nieren, en lever in kleine gedeelten van ongeveer 1-1,5 cm lang. Rol het membraan op en snijd het vervolgens in 1-1,5 cm secties 56.
    5. Plaats tragacanth gom zodat het ongeveer 0,5-1 cm dik op kurk schijven. Label schijven met identificatiegegevens en spieren naam van het dier aan de andere kant van de tragacanth gom.
    6. Plaats spieren met hun lengteas loodrecht op de kurk in de tragacanth gom.
    7. Plaats de kurken in een container isopentaan dat zit in vloeibare stikstof. Verplaats het rond voortdurend met een pincet voor 1 min of totdat het volledig bevroren. Store spieren aan kurkenin flesjes bij -80 ° C. Bij het transport, zet flesjes op droog ijs.
    8. Bereid glasplaatjes gelabeld met de identificatie van dieren / name spieren en datum.
    9. In een cryostaat tot -25 ° C afgekoeld, zet de kurk aan de standaard. Stel de snijdikte tot het gewenste niveau. Gebruik 8 urn voor immunohistochemie en 12 pm voor hematoxyline en eosine (HE) kleuring. Gebruik 15 pm voor Western Blot monsters. Knip ongeveer een kwart van de spier een platte spier voor de juiste spieren monsterneming.
    10. Snijden een deel van de spier tegelijk, plaatst elke 6e sectie op dezelfde glaasje als planning samples voor immunohistochemie of HE kleuring. Bij gebruik van monsters voor Western blots, zet 30-40 secties in een buisje en bewaar bij -80 ° C.
    11. Na de bereiding van dia's, laat dia's drogen gedurende 1,5 uur bij kamertemperatuur. WINKEL glijdt bij -80 ° C.

    8. Immunohistochemie

    1. Verwijder bereid dia's uit de opslag en plaats ze invocht kamer naar de glijbanen gescheiden houden en vocht behouden. Vul het vocht kamer zodat de bodem net is bedekt met water (ongeveer 1 mm water).
    2. Lucht drogen voor 0,5 uur. Teken een vierkant omsluit de spier monster op de dia met behulp van een hydrofobe barrière pen.
    3. Voeg 15% geit serum in fosfaatgebufferde zoutoplossing (PBS) en incubeer gedurende 2 uur bij KT in blokkeringsreagens.
    4. Voeg anti-dystrofine rod domein (DYS-1) muizen monoklonaal primair antilichaam, of C-terminale monoklonaal antilichaam (DYS-2) voor hond dystrofine kleuring (1: 150 verdunning). Verdun met een blokkeermiddel in 1,25 ml PBS. Incubeer O / N op de koelkast een 4 ° C.
    5. Wassen met PBS gedurende 5 minuten, driemaal herhaald. Voeg secundaire antilichaam Alexa 594 geit-antilichaam tegen muizen IgG1 (voor DYS-2) of IgG2 (voor DYS-1) (1: 2500). Verdun met een blokkerende reagens in PBS met 0,1% octylfenol ethoxylaat. Incubeer gedurende 0,5 uur bij KT.
    6. Wassen met PBS gedurende 5 minuten, drie tIMES. Laat dia drogen. Voeg 1-2 druppels (3 ng / ml) van 4 ', 6-diamidino-2-phenylindole (DAPI) bevestigingsoplossing. Met een pincet, plaatst een glazen slip over de bovenkant van de secties voorkomen bellen.
    7. Bekijk dystrophine (DYS-1 / DYS-2) positieve vezels onder een fluorescentiemicroscoop bij 594 nm bij een vergroting van 20x.

    9. Western Blotting

    1. Voeg verzamelde spier secties van cryo-snijden tot 150 ul van het monster buffer op ijs.
    2. Met behulp van een hand homogenisator kort homogeniseren het eiwit monsters. Warmte monsters in een 1,5 ml buis in een verwarmingsblok incubator bij 95 ° C gedurende 3-5 min. Centrifugeer bij 16.500 xg gedurende 15 minuten en verzamel de supernatant.
    3. WINKEL aliquots van het supernatant bij -70 ° C. Gebruik gedestilleerd water te verdunnen tot 100x.
    4. Bepaal eiwitconcentratie met behulp van een commerciële kit volgens het protocol van de fabrikant. Voeg 2x Laemmli SDS-laadbuffer om monsters en warmte voor 3 min &# 160; bij 95 ° C.
    5. Laad monsters in 3-8% Tris- acetaat gel voordat u het voor 3 uur bij 150 V. omvatten verscheidene verdunde wildtype (WT) monsters (bijvoorbeeld 1%, 10% en 50%) voor de kwantificering. Minder dan 1% WT niveaus van dystrofine worden gedetecteerd met deze werkwijze.
    6. Plaats de gel in kathode buffer gedurende 20 min. Gedurende deze tijd neemt negen stukken filtreerpapier en die in de overdracht buffers (3 papers in de kathode buffer [+], de anode buffer ([-] en de anode geconcentreerde buffer [-], respectievelijk) Deze. beschrijft een semi-droge overdracht methode die gevoeligheid (Figuur 6) toeneemt.
    7. Geniet van een PVDF-membraan in methanol gedurende 20 seconden en plaats dan in de anode buffer.
      Stel de gel met het membraan voor halfdroge overdracht en laat het 1,5 uur bij 400 mA uitgevoerd in RT of in een koude kamer.
    8. Was het membraan met PBS. Incubeer het membraan in een mengsel van PBS met Tween 20 (PBST) en 5% melkpoeder gedurende 2 uur.
    9. Verdun DYS-1 (primair antilichaam) in PBST en 5% melkpoeder mengsel een 1: 100 verdunning. Toevoegen aan het membraan en laat het incuberen gedurende ten minste 1 uur. Was driemaal met 100 ml PBST gedurende 15 minuten elk.
    10. Voeg 65 gl / laan HRP geconjugeerd secundair antilichaam (anti-muizen IgG2a voor DYS1) bij 1: 5000 verdunning gedurende 1 uur bij KT in een donkere omgeving. Vervolgens wassen met drie maal met 200 ml PBST gedurende 20 min. Meng oplossingen van een detectiekit zoals aangegeven. Incubeer gedurende 1 min.
    11. Ontwikkel film bands te ontdekken en te analyseren met ImageJ software 48,57,58.

Representative Results

In vitro experimenten

Myoblasten werden met verschillende 2'OMePS behandelcondities teneinde de doeltreffendheid van elk AON vergelijken. Één AON behandeling met 600 nM elk van Ex6A, Ex6B, Ex8A of Ex8B waren, en een cocktail behandeling met 600 nM elk van 4 AON sequenties. RNA-monsters werden verzameld vier dagen na transfectie. Na RT-PCR werden monsters voor elke behandeling uitgevoerd op een gel samen met niet-behandelde (NT) monsters. Bands hoger op de gel vertegenwoordigen out-of-frame van DMD producten; deze bands werden gezien in NT, Ex8A en Ex8B behandeld myoblasten. Ex6A, Ex6B, Ex8A, en de-cocktail behandelde myoblasten toonde in-frame producten. De cocktail en Ex6A / B toonde 100% in-frame producten, terwijl Ex8A vertoonde slechts 30% in-frame producten (Figuur 7). Om exon skipping en het herstel van bevestigenhet leesraam, cDNA sequentie werd uitgevoerd; de resultaten bleek dat exons 6-9 inderdaad overgeslagen (Figuur 7). Immunohistochemie toonde dat AON-behandelde honden dystrofine-positieve vezels gestegen vergeleken met NT monsters (Figuur 8).

In Vivo experimenten

Om de efficiëntie van de verschillende AON behandeling voorwaarden vergelijken, CXMD honden - werden (0,5 5 jaar oud) een keer geïnjecteerd met 1,2 mg Ex6A of een cocktail van Ex6A, Ex6B en Ex8A bij verschillende doseringen. Twee weken na de injectie werden de spieren monsters verzameld en gekleurd met DYS-1 het aantal dystrofine positieve vezels vergelijken. All-cocktail behandelde monsters vertoonden verhoogde dystrofine-expressie in vergelijking met NT monsters. Dystrofine-positieve vezels verhoogd met AON dosering (figuur 9). Naar aanleiding van het systeemic injectie, wild-type (WT) en NT-cocktail behandelde CXMD spier monsters werden gekleurd met DYS-1 (Figuur 10). -Cocktail behandelde CXMD honden vertoonden verhoogde dystrofine expressie in vergelijking met NT CXMD honden, zowel in CT en hartspier samples. Echter, AON-behandelde skeletspier (CT) vertoonden veel hogere expressie van dystrofine opzichte behandeld hartspier. Een immunoblot vergelijken WT, NT, en diverse morfolino-cocktail behandeld spieren leidde tot dezelfde conclusie. Er was ook een groot aantal dystrofine in de skeletspier behandelde monsters (figuur 10). Hematoxyline en eosine (HE) kleuring onthulde dat behandeld CXMD honden vertoonden verbeterde histopathologie, met een significante afname in centraal kernhoudende vezels (CNF) ten opzichte van NT CXMD honden (figuur 11). Dit geeft aan dat er meer degeneratie / regeneratie plaatsvindt in het NT hond, een teken van dystrofische spier pathologie. Daarnaast behandelde honden sneller hadlooptijden en verbeterde scores op de klinische indelingsschema. Behandelde CXMD honden toonde beter scoort dan NT CXMD honden in alle categorieën (Figuur 12).

Figuur 1
Figuur 1. Mutatie Patroon van de CXMD Hond en Exons 6 -. 8 Skipping strategieën door middel van een antisense Cocktail CXMD honden hebben een punt mutatie in exon 6 leidt tot een verlies van exon 7 in dystrofische honden mRNA. Dit resulteert in het mRNA die out-of-frame en dystrofine eiwitproductie verloren. Korte AON sequenties zijn ontworpen om te binden met exon 6 en 8, waardoor mRNA splicing effectief skipping exons 6 - 8. De grijze balk in de AON-cocktail behandelde honden vertegenwoordigt korte AON sequenties. Exon 9 codeert voor een scharnier domein en wordt soms spontaan gesplitst met AONs tegen exon 6 en 8. De resulterende mRNA codeert voor dystrofine eiwitten die korter zijn, maar functieal. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2. De belangrijkste klinische verschijnselen van een 1-jarige Canine X-gebonden Muscular Dystrophy (CXMD) Animal. Een 1-jarige wild-type beagle en een CXMD hond worden getoond. De betrokkenheid van proximale, de ledematen, en temporele spieren zijn meestal waargenomen vanaf 2 maanden oud. Joint contractuur en een verschuiving van het bekken zijn openlijke vanaf 4 maanden oud. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3. Algemene Anesthesie voor een hond. A) Intramuscular injecties en spierbiopten worden uitgevoerd onder algemene anesthesie met isofluraan. B) Het houden van het dier voor systemische injecties. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4. Magnetic Resonance Imaging (MRI) van wild-type niet-behandelde CXMD en behandeld CXMD. MRI scans van de achterpoot bij 3 maanden en 5 maanden in WT en NT CXMD honden. Twee voorbeeldfoto's van de behandelde CXMD achterste ledematen MRI pre- (1 week voor de eerste injectie) en post-injectie van AON worden getoond. 2703MA werd behandeld met 7x wekelijks 200 mg / kg cocktail morpholinos. 2001MA werd behandeld met 5x wekelijkse intraveneuze injectie van 120 mg / kg cocktail morpholinos. Controle en behandelde honden waren dezelfde leeftijd. Behandelde honden tonen afgenomen T2 signalen. De beelden zijn ADAP ted met toestemming van Yokota et al. (copyright 2009, John Wiley & Sons) 40 Klik hier om een grotere versie van deze figuur te bekijken.

figuur 5
Figuur 5. spierbiopsie Procedure voor een hond. A) Een lagere ledematen is vastgesteld voor spierbiopsie. B) Met behulp van een tang, de onderste ledematen wordt gehouden. C) De CT spier is blootgesteld. Open biopsie techniek wordt gebruikt om de spieren monsters van geïnjecteerde plaatsen te verkrijgen. Draden worden gebruikt voor biopsie monsters te houden. D) Muscle samples op tragantgom na dissectie. Klik hier om een grotere versie van deze figuur te bekijken.

/53776/53776fig6.jpg "/>
Figuur 6. Semi-droge overdrachtmethode. Een weergave van de halfdroge overdrachtmethode voor Western blotting wordt gepresenteerd. Drie papieren gedrenkt in geconcentreerde anode buffer zijn vastgelegd op de minpool vastgesteld; 3 papier gedrenkt in anode buffer gestapeld bovenop. De Mb PVDF papier wordt geweekt in methanol en vervolgens anode buffer alvorens het werd geplaatst bovenop de 6 papers. De gel, die gedrenkt is in kathode buffer wordt voorzichtig gelegd over de PVDF papier. Tenslotte papier gedrenkt in 3 kathode buffer gelegd bovenop de gel. De positieve terminal is gelegen op de top. 1 uur, 400 mA wordt uitgevoerd door het systeem. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 7
Figuur 7. Exon Skipping in CXMD myoblasten. et al. (Copyright 2009, John Wiley & Sons) 40. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 8
Figuur 8. Verhoogde Dystrophin Expressie in 2'O-gemethyleerd fosforthioaat (2'OMePS) Getransfecteerde CXMD myoblasten. CXMD myoblasten werden met Ex6A alleen of met een cocktail 2'OMePS. DYS-2 (rood) en DAPI (blauw) vlekken worden getoond. De behandelde myoblasten worden vergeleken met wildtype (WT) en niet-behandelde (NT) myoblasten. Beelden worden aangepast met toestemming van Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 pm. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 9
Figuur 9. Redding van Dystrofine Expression met intramusculaire injecties van Morpholinos in CXMD Dogs. Ofwel Ex6A alleen of een cocktail van Ex6A, Ex6B en Ex8A werden geïnjecteerd in de CT spieren van CXMD honden. Dystrofine (DSY-1) kleuring van wild-type(WT), niet-behandelde (NT) en behandeld CXMD honden zijn weergegeven. De honden werden behandeld met ofwel 1,2 mg Ex6A alleen of 1,2 mg cocktail. Beelden worden aangepast met toestemming van Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 micrometer. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 10
Figuur 10. Verhoogde dystrofine Na systemische Cocktail morfolino behandeling in CXMD honden. Dystrofine (DYS-1) kleuring werd gebruikt om dystrofine vergelijken in wild type (WT) (positieve controle), onbehandeld (NT) (negatieve controle), en CXMD honden behandeld met 120 mg / kg morfolino cocktail (40 mg / kg per AON). De morfolino cocktail bevatte Ex6A, Ex6B en Ex8A. Honden werden intraveneus 5 keer geïnjecteerd weekly met deze cocktail. A) Een vergelijking van dystrofine craniale tibiale (CT) spieren van WT, NT en behandelde honden. B) Een vergelijking van dystrofine expressie in hartweefsel tussen NT en morfolino-cocktail behandelde honden. C) Immunoblot voor dystrofine met desmine als een laad controle getoond voor WT, NT, en morfolino-cocktail behandelde honden. De volgende spieren worden weergegeven voor behandelde honden: triceps brachii (TB), biceps brachii (BB), diafragma (DIA), slokdarm (ESO), CT, adductor (ADD), extensor digitorum longus (EDL), masseter (MAS), en het hart. Beelden worden aangepast met toestemming van Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 micrometer. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 11
Figuur11. Verbeterde Histopathologie in CXMD honden die 7 weken met 240 mg / kg morfolino Cocktail. CXMD honden, variërend van een half jaar tot vijf jaar oud werden intraveneus geïnjecteerd met 240 mg / kg morfolino cocktail (Ex6A, Ex6B en Ex8A) eenmaal week gedurende 7 weken. Veertien dagen na de laatste injectie werden slokdarm spieren genomen hematoxyline en eosine (HE) kleuring werd uitgevoerd. HE kleuring van de slokdarm spieren van niet-behandelde (NT) en morfolino cocktail-behandelde (bewerkt) CXMD honden (40X objectief). Klik hier om een grotere versie van deze figuur te bekijken.

figuur 12
Figuur 12. Verbeterde Scores op Clinical Grading en 15 m Running Time After morfolino Treatment. Morfolino-behandelde honden werden vergeleken met niet-behandelde (NT) nestgenoots. Error bars in de grafiek geven SEM. A) totaalscore op de klinische indeling examen berekend voor en na behandeling en behandelde dieren werden vergeleken met NT nestgenoten. B) Een vergelijking van 15 m looptijden van behandelde honden en NT. C) Net als B; werden echter jongere honden gebruikt. Beelden worden aangepast met toestemming van Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Klik hier om een grotere versie van deze figuur te bekijken.

antisense Oligonucleotide nucleotide Sequence
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tabel 1. Antisense Oligonucleotide Design.

Discussion

Exon skipping is een veelbelovende techniek voor de therapeutische behandeling van DMD. Zowel in vitro en in vivo experimenten hebben aangetoond dat multi-exon skipping haalbaar. Hier wordt het gebruik van de CXMD hondenmodel besproken. Eerst werden AONs ontworpen met behulp van de Rescue-ESE en ESEfinder programma's om dystrofine exons 6 richten - 8. De 2'OMePS AON chemie werd gebruikt voor CXMD myoblast transfectie en de morfolino AON backbone chemie werd gekozen voor in vivo-experimenten. vPMOs efficiënter zijn dan ongemodificeerde PMO maar vanwege hun hogere toxiciteit ze niet geschikt voor systemische injecties. RNA-extractie, RT-PCR en cDNA sequentie werd uitgevoerd op de CXMD myoblasten. Honden geïnjecteerd met het PMO cocktail waren klinisch graded aan een verbetering van de klinische symptomen te beoordelen. Nadat de honden op humane wijze werden gedood, werden de spieren monsters genomen en voorbereid voor cryo-snijden. De halfwaardetijd van dystrofine proteïne geïnduceerd door AONS wordt verondersteld ongeveer 1 zijn - 2 maanden. Jonge volwassen honden werden in dit onderzoek, hoewel deze experimenten kan met neonatale honden en oudere honden (> 5 jaar). Bereid spier secties werden gebruikt voor histopathologie te evalueren en te beoordelen dystrofine-eiwit te redden door middel van Western blotting en immunohistochemie 48.

Het is belangrijk om ervoor te zorgen dat het volume van het PMO oplossing juist is voordat injecties is; niet te doen zal aanzienlijke gevolgen hebben op de resultaten. Tijdens intramusculaire injecties wordt voldoende druk vereist om de spiervezels voeren. Monitoring van de hond gezondheid en de controle van de operatie site zijn van belang voor het oplossen van problemen. Om de gezondheid van dieren te controleren, moet wekelijks bloedonderzoek en wegen worden uitgevoerd. Na euthanization van het dier en bereiding van monsters spieren, een kritische stap voor het waarborgen van de gevoeligheid bij het detecteren dystrofine eiwit zowel de Tris-acetaat gel en halfdroge blotting methodetijdens de Western blot procedure.

Zoals getoond in de representatieve resultaten, myoblasten behandeld met Ex6A, Ex6B, Ex8A en de cocktail (met Ex6A, Ex6B, Ex8A en Ex8B) die in het leeskader DMD producten. Aangezien Ex8B geen exon-overgeslagen geproduceerd, werd niet gebruikt in volgende in vivo experimenten. cDNA sequencing toonde aan dat exons 6-9 skipping voorgedaan en immunocytochemie met DYS-2 kleuring vertoonden gerestaureerd dystrofine-expressie in behandelde monsters. AON-behandelde honden vertoonden een significante toename van dystrofine-positieve vezels. Dit geeft aan dat exons 6-8 werden overgeslagen en een verkort eiwit werd geproduceerd. De hoeveelheid dystrofine-positieve vezels verhoogd wanneer een cocktail van AONs werd gebruikt en was evenredig aan AON dosering. Immunoblots toonden toegenomen dystrofine-expressie in systemische-morfolino behandelde honden. Skeletspier had verschillende niveaus van dystrofine vezels; Maar-morfolino behandelde hartweefsel toonde weinigverbetering van dystrofine expressie. Omdat dystrofine een hoog molecuulgewicht (427 kDa), kan detectie van lage hoeveelheden dystrofine moeilijk. Voor het beste resultaat, Tris-acetaat gel en de semi-droge overdracht methode werden gebruikt. HE kleuring vertoonden verbeterde histopathologie in de morfolino behandelde honden. Centraal-gekiemd vezels (CNF 's) zijn een teken van ongezonde spier- en vertegenwoordigen cycli van de spieren degeneratie en regeneratie. Morfolino-behandelde CXMD honden een daling van het percentage CNF 'in vergelijking met niet behandelde CXMD honden. Klinische indeling liet een verbetering van de symptomen, zoals verhoogde lopen en rennen vermogen, in morfolino-behandelde dieren. De hardheid van de spieren wordt dat spieratrofie dus werd opgenomen in de classificering op basis 59 weerspiegelen. De hardheid van de dij (achterste ledematen) spieren werd geëvalueerd; echter uitgesloten we schedelinhoud Sartorius spieren, omdat ze de neiging om hypertrofie in plaats van atrofie vertonen in CXMD. Behandelde honden tonened lagere inschaling scores en had snellere tijden op de 15 meter looptest. Betere tijden op de 15 m-test zijn een indicatie van een verbeterde spierfunctie 40. Hogere algemene inschaling scores geven een slechte gezondheid en een verhoogde spieratrofie.

Hoewel deze resultaten veelbelovend, multi-exon skipping bestaan ​​nog vele uitdagingen die moeten worden overwonnen voordat het klinische toepasbaarheid techniek heeft. Hartweefsel geeft nog steeds een verminderde opname van AONs, waarschijnlijk te wijten aan het verschil in cellulaire handel tussen hart- en skeletspieren weefsel. Geen toxische effecten waargenomen bij dieren onder de huidige doseringsschema's; moet echter meer werk moet worden gedaan om de toxiciteit op lange termijn te beoordelen alvorens het gebruik van AON cocktails kunnen verplaatsen naar klinische proeven. Het is moeilijk om goedkeuring van AON cocktail drugs te krijgen, omdat de regelgevende agentschappen te definiëren elk AON-sequentie als een uniek drug. Dit betekent dat elke sequentie in een cocktail zouden moeten afzonderlijk worden getest safety, die meer tijd en meer geld. Andere belemmering voor het gebruik van multi-exon skipping in een klinische setting een groot aantal tussenproducten eiwitproducten geproduceerd met onbekende functies. Deze eiwitten kunnen mogelijk leiden tot onvoorspelbare bijwerkingen, afhankelijk van de individuele mutaties 22. Daarnaast is de mutatie patronen beschikbaar zijn binnen de huidige Dystrofe hond modellen zijn beperkt. Er zijn weinig natuur voorkomende mutaties, en niet alle mutaties zijn nuttig voor het bestuderen van multi-exon skipping. De dystrofische varken model belooft een goed alternatief voor de toekomstige DMD exon skipping studies 33, 34 zijn.

De DMD hond modellen hebben een aantal voordelen ten opzichte van andere modellen DMD. Omdat het een grotere diermodel, klinische sorteren en MRI zijn mogelijk, waardoor meer gedetailleerde analyse. Aangezien honden zijn grote dieren zijn ze ook geschikt voor toxicologisch onderzoek en beter vertegenwoordigt de menselijke ziekte in vergelijking met het muismodel. hond modellen ook DMD gensequenties die meer lijkt op de mens 23, 34, 45 zijn.

Hoewel technisch uitdagende, kan de multi-exon skipping aanpak uiteindelijk ten goede> 90% van de DMD patiënten 24. Dit maakt het een veel beter alternatief voor single-exon skipping, als single-exon skipping is alleen van toepassing op een kleine subgroep van patiënten. Daarnaast zal multi-exon skipping ons in staat om het verwijderen patronen die de functionaliteit van de verkorte dystrofine eiwitten optimaliseren selecteren. Bijvoorbeeld, het verwijderen van DMD exonen 45-55 wordt in verband gebracht met een uitzonderlijk milde symptomen of asymptomatische individuen 14,19,60-63. De multi-exon skippen van exonen 45-55 reeds aangetoond in een muismodel van DMD een exon 52 deletie (mdx52) via systemische injecties van vPMOs 22,26. Het gebruik van cocktails vPMOs is ook aangetoond in andere vormen van spierdystrofie, zoalszoals Fukuyama aangeboren spierdystrofie (FCMD). FCMD wordt veroorzaakt door exon trapping, waarbij afwijkende mRNA-splitsing wordt veroorzaakt door retrotransposonintegratie insertie. vPMOs is aangetoond dat de splicing patroon redden in zowel FCMD muizenmodel en bij humane cellijnen 64. Next-generation AON chemie vertonen grotere werkzaamheid en lagere toxiciteit zou de effectieve vertaling van de multi-exon skipping aanpak in de klinische toepassing ervan te vergemakkelijken. Voorts zouden meerdere exon skipping mogelijk worden toegepast op andere genetische aandoeningen, zoals dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-exon Skipping Met behulp Cocktail antisense-oligonucleotiden in de Canine X-gebonden Muscular Dystrophy
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter