Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Auslassen von Multi-Exon-Verwendung Cocktail Antisense-Oligonucleotiden in der Canine X-chromosomal-Muskeldystrophie

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Exon-Skipping ist derzeit vielversprechendsten Therapieoption für Duchenne-Muskeldystrophie (DMD). Um die Anwendbarkeit für DMD-Patienten zu erweitern und die Stabilität / Funktion der resultierenden verkürzten Dystrophin-Proteine, ein Multi-Exon-Skipping-Ansatz Cocktail Antisense-Oligonukleotide wurde zur Optimierung entwickelt und wir zeigten systemische Dystrophin-Rettung in einem Hundemodell.

Abstract

Duchenne - Muskeldystrophie (DMD) ist eine der häufigsten tödlichen genetischen Krankheiten weltweit, verursacht durch Mutationen im Dystrophin (DMD) Gen. Exon-Skipping beschäftigt kurze DNA / RNA-ähnliche Moleküle, so genannte Antisense-Oligonukleotide (AON), die den Leserahmen wiederherzustellen und produzieren kürzer, aber funktionelle Proteine. Allerdings Exon-Skipping-Therapie steht vor zwei großen Hürden: begrenzte Anwendbarkeit (bis zu nur 13% der Patienten können mit einem einzigen AON Medikament behandelt werden), und unsichere Funktion der verkürzte Proteine. Diese Fragen wurden mit einem Cocktail AON Ansatz adressiert. Während etwa 70% der DMD-Patienten durch einzelne Exon-Skipping (alle Exons kombiniert) behandelt werden können, könnte man möglicherweise mehr als 90% der DMD-Patienten zu behandeln, wenn multiple Exons unter Verwendung von Antisense-Medikamenten Cocktail Überspringen realisiert werden kann. Der Eckzahn X-chromosomal-Muskeldystrophie (CXMD) Hundemodell, dessen Phänotyp ist ähnlich dem menschlichen DMD-Patienten wurde verwendet, um die systemische effic zu testenACY und Sicherheit des Überspringens Multi-Exon der Exons 6 und beherbergt 8. CXMD Hundemodell zu einem Mangel an Exon 7 in Dystrophin - mRNA eine Spleißstelle Mutation in Intron 6, führt. Zur Wiederherstellung erfordert das Leseraster in CXMD Multi-Exon-Skipping der Exons 6 und 8; Daher ist CXMD ein gutes mittelgroße Tiermodell die Wirksamkeit und Sicherheit von Skipping Multi-Exon zum Testen. In der aktuellen Studie, ein Cocktail von Antisense-Morpholinos Targeting Exon 6 und Exon 8 wurde entwickelt, und es restauriert Dystrophin-Expression in Körper-weiten Skelettmuskulatur. Verfahren zur Transfektion / Injektion von Cocktail-Oligos und Bewertung der Wirksamkeit und Sicherheit von Multi-Exon-Skipping im CXMD Hundemodell vorgestellt.

Introduction

Duchenne - Muskeldystrophie (DMD) ist eine X-chromosomal - rezessiv Muskelerkrankung , die durch progressive Muskelschwäche gekennzeichnet, beschrieben zuerst von Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD ist eine gemeinsame etwa 1 in 3500 Jungen beeinflussen genetische Erkrankung weltweit, mit rund 20.000 betroffenen Kinder pro Jahr geboren 2,3. Die motorische Entwicklung verzögert und Gangstörungen sind in der frühen Kindheit 4, gefolgt von Rollstuhlabhängigkeit bei etwa den frühen Teenager gesehen. Der Tod tritt in der Regel im Alter zwischen 20 und 30 aufgrund von Atemwegs- oder Herzversagen 5-8. Es gibt derzeit keine Heilung für DMD. Behandlung mit Glucocorticoiden kann das Fortschreiten der Muskeldegeneration zu einem gewissen Grad verlangsamen aber mit erheblichen Nebenwirkungen, wie Adipositas und Diabetes mellitus 2,7,8 assoziiert ist. DMD resultiert aus Mutationen im Dystrophin (DMD) -Gen, mit einem Verlust von funktionellen Dystrophin protei führendenn. DMD ist ein extrem großes Gen mit über 2 Millionen Basenpaaren und 79 Exons 9,10. Löschen, Blödsinn und Vervielfältigung Mutationen führen zu Out-of-frame-Mutationen sind die häufigste Ursache für die DMD-Phänotyp. Die Regionen der Exons 3 bis 9 und Exons 45-55 sind "Mutation Hotspots" bezeichnet , da die meisten Patienten Deletionsmutationen innerhalb dieser Abschnitte des Gens, was zu einer nichtfunktionellen Dystrophin in DMD - Patienten 3,9,11-16. Dystrophin Funktionen innerhalb des Dystrophin-Glykoprotein-Komplex (DGC), die eine wichtige Rolle bei der Muskelmembranstabilisierung aufweist. Die N- und C-Termini sind die wichtigsten Bereiche für die Funktion, während der zentrale Stab Domäne eine weniger wichtige Rolle spielt 3,9,17. Die Einhaltung eines milden Phänotyp im Zusammenhang mit Becker - Muskeldystrophie (BMD), die vor allem ergibt sich aus in-frame - Mutationen innerhalb des DMD - Gens, inspiriert die Anwendung von Exon zur Behandlung von DMD - Skipping. BMD-Patienten haben eine verkürzte, aber functional, Dystrophin - Protein , die beide Enden 3,6,18 hält. Exon - Skipping, in der Theorie kann das Leseraster wiederherstellen, was zu einer verkürzten , aber funktionelle Dystrophin - Proteine ​​ähnlich denen in BMD 3,19 gesehen.

Mehrere Arten von Antisense-Oligonukleotide (AON) wurden in klinischen Studien, einschließlich 2'O- methyliert Phosphorothioate (2'OMePS) und Phosphordiamidat Morpholino-Oligomere (PMOs) getestet. Auslassen von Exons 51 und 53 diese AONs verwendet wurde geprüft und während Ergebnisse vielversprechend sind, hat Single-Exon - Skipping Anwendbarkeit begrenzt, da es mutationsspezifischen 3, 19, 20,21, 22-26. Fragen bleiben auch über die Stabilität der resultierenden verkürzten Dystrophin - Proteine ​​produziert von Single-Exon 22,23 überspringen. Zusätzlich erfordern einige Patienten mehr als ein einziges Exon , um den Leserahmen 3 zur Wiederherstellung übersprungen werden. Während technisch schwieriger, ist Multi-Exon-Skipping eine Methode, dieAdresse konnte diese Probleme 3,19. Multi-Exon - Skipping hat in dystrophen Hunde- und menschlichen Zelllinien in vitro gezeigt , vorher. Zusätzlich studiert mdx52 Maus und Hunde - X-chromosomal - Muskeldystrophie (CXMD) Hundemodelle für in vivo verwendet wurden , 22, 24-27. Canine X-chromosomal - Muskeldystrophie Japan (CXMD J) Beagles hier verwendet wurden, da der Leserahmen von CXMD J kann durch Multi-Exon - Skipping des Exons 6 und 8, oder zusätzliche Exons (zB Exons 3 bis 9) wiederhergestellt werden (Abbildung 1). Beagle-basierte CXMD teilt die gleiche Mutation Muster wie die Golden Retriever - Muskeldystrophie (GRMD) Modell, aber Beagles sind kleiner und billiger zu halten aufgrund ihrer Körpergröße, wodurch ein nützliches Modell für DMD 28,29 bereitstellt. CXMD Hunde imitieren stärker den menschlichen DMD - Phänotyp als kleinere Tiermodellen, wie Nagetieren und sind zuverlässiger für die toxikologische Bewertung 3,22,30,31 (Abbildung 2). CXMD Hunde zeigen progressive Muskel Verfall, Gangstörungen und Herz-und Atemprobleme ähnlich wie bei DMD gesehen. Verglichen mit Einzel-Exon-Skipping, ist Multi-Exon-Skipping zu einem viel größeren Anteil der Patienten anwendbar. Unter den drei häufigsten Mutationstypen (Deletionen, Unsinn, und Doppelungen), 80 bis 98% der Patienten , Multi-Exon - Skipping werden könnte 14,32,33 behandelt durch, während 45% aller DMD - Patienten von speziell Skipping Exons profitieren könnten 45 - 55 3,19,22,34.

Mit der Entwicklung von modifizierten Morpholinos, die Effizienz der AON-Cocktails auf Exon-Skipping zu erleichtern hat sich verbessert. Arginin-reichen zellpenetrierendes Peptid-konjugierte PMOs (PPMOs) und vivo-Morpholinos (vPMOs) sind AON Chemien , die deutlich zellpenetrierendes Fähigkeit und Stabilität 3,35-38 verbessert haben. Sorge bereitet weiter langfristige AON Toxizität; jedoch erhebliche Fortschritteist gemacht worden. Chemische Modifikationen an Morpholinos stark Nebeneffekte zu verringern und präklinischen Studien haben keine signifikanten toxischen Wirkungen 3,22,39,40 berichtet. Eine verbleibende Herausforderung für Multi-Exon - Skipping ist der Strombedarf für jeden einzelnen AON für Toxizitäts allein getestet werden, als ein einziges Medikament, statt zusammen als ein Cocktail 3,19,22,41,42. In DMD Studien sowohl Einzel- als auch Multi-Exon-Beteiligung an das Herz gezielt Skipping, hat es wenig Verbesserung in der dystrophischen Herzgewebe gewesen. Die Wirksamkeit von Morpholinos im Herzen wird vermutet, gering zu sein wegen der schlechten zellpenetrierendes Fähigkeit. Peptid-konjugiertes PPMOs haben die Fähigkeit von AONs verbesserte Herzzellen eindringen, um die Menge an funktionellen Dystrophin - Protein im Herzen 3,19,38 gerettet erhöht.

Hier unsere AON Cocktail Ansatz wird ausführlich diskutiert, einschließlich der Gestaltung von AON - Sequenzen mit ESEfinder Software 43. Protocols für Hunde Experimente mit Skipping Multi-Exon werden ebenfalls beschrieben. CXMD J Beagles wurden für die Exons 6 und 8 Überspringen Experimente verwendet. Multi-Exon in dem CXMD Hundemodell Überspringen zeigt vielversprechende Ergebnisse, aber Herausforderungen bleiben, dass müssen überwunden werden, bevor sie klinisch anwendbar sind.

Protocol

Alle Protokolle unten aufgeführt sind in Übereinstimmung mit den Tierpflege Richtlinien des National Center für Neurologie und Psychiatrie (NCNP) in Japan dargelegt. Alle Experimente wurden von der Institutional Animal Care und Use Committee des NCNP genehmigt.

1. Design von Antisense-Oligos

  1. Verwenden Rettung ESE und ESEfinder Programme ESE - Sites 44, 45-47 zu erkennen.
  2. Design 25 Basenpaare (bp) Sequenzen, die Exons Antisense sind, die ausgerichtet werden sollen. Target Exons 6 und 8 im Hundemodell (Abbildung 1).
    1. Verwenden Sie 25 bis 30 bp - Sequenzen für PMOs (Tabelle 1) bzw. 25 bp für 2'OMePS. Bis 25 bp-Sequenzen entwerfen, Auswahl-Sequenzen, die im Zielbereich sind. Betrachten Sekundärstruktur, die Vermeidung von Heterodimeren, Exon Splicing - Enhancer - Motive, und GC - Gehalt stabile Sequenzen 43 zu schaffen. AONs sollte, wie durch die oben erwähnten sof identifizierten mindestens einer der ESE Seiten Zieltware.
    2. Wählen AONs mit einem GC-Gehalt, die weniger als 65% beträgt, mit weniger als 4 aufeinanderfolgende 'G, und enthalten keine selbst-komplementären Sequenzen. Verwenden Sie NCBI Explosion Software Off-Target - Glühen Websites 22,48,49 zu prognostizieren.
  3. Wählen Sie eine geeignete Rückgrat Chemie AON. Für In - vitro - Experimente verwenden 2'O--methyl - Oligonukleotide (2'OMePS) oder Morpholinos. Für die in vivo Experimenten verwenden 2'OMePS, Morpholinos oder vPMOs. 3,19,48,50

2. In - vitro - Experimente (Exons 6 und 8 Skipping im CXMD Model)

  1. 2'OMePS Transfektion von Dog Myoblasten
    1. Kultur CXMD Myoblasten in 3 ml Wachstumsmedium in 6-Well-Platten. Samen von 1 bis 5 x 10 3 Zellen / cm 2 mit 0,5 ml / cm 2 von Medium für Myoblasten. Für das Wachstumsmedium verwenden Dulbeccos modifiziertem Eagle-Medium (DMEM) mit 10% fötalem Rinderserum (FBS) und 1%Penicillin / Streptomycin (P / S) 40.
    2. Inkubieren bei 37 ° C, bis 60 bis 80% konfluent. Dies dauert etwa 12 bis 24 Stunden.
    3. Verdünnte ein kationisches Liposom Transfektionsmittel auf insgesamt 100 & mgr; l in reduziertem Serum - Medium (2: 1 - Verhältnis Transfektionsmittel: AONs, beispielsweise 10 & mgr; l Lipofectin vs. 5 ug AONs). Lassen Sie Mischung bei RT stehen für 30 - 45 min.
    4. Verdünnte AONs (2'OMePS oder Morpholino) zu einem Endvolumen von 100 & mgr; l in reduzierten Serummedium.
    5. Kombinieren Sie das verdünnte Transfektionsmittel mit verdünnter AONs und Inkubation bei RT 10 - 15 min.
    6. Während das Transfektionsmittel / AON Mischung bei RT sitzt, alte Medien von Zellen durch Absaugen entfernen und die Zellen mit den Medien zu waschen.
    7. In 0,8 ml Medium zur Transfektionsagens / AON Mischung und fügen Sie dann die gesamte Lösung auf die frisch gewaschenen Zellen. bei 37 ° C für 3 h inkubiert.
    8. Nach Inkubation ersetzen Medien mit differentiatIonen-Medien (DM); Differenzierung kann bis zu 10 Tage in Anspruch nehmen. Überprüfen Sie, ob die Differenzierung bei etwa aufgetreten 3. Tag beginnt die Differenzierung Medien DMEM mit 2% Pferdeserum, 200 U / ml Penicillin, 200 mg / ml Streptomycin und 10 ug / ml Insulin.
  2. Morpholino Transfektion von Dog Myoblasten
    1. Kultur CXMD Myoblasten in einem Wachstumsmedium als 2.1 in Schritt beschrieben.
    2. Wechseln Sie in den Differenzierungsmedium (DM), und fügen Sie 0,1 mM Lager Morpholin zu jeder Vertiefung auf die Endkonzentration 1 uM machen. Wärme Cocktail Morpholinos bei 65 ° C für 10 min vor der Transfektion oder Injektion AON-Aggregation zu vermeiden. Hinzufügen ein Peptid Liefer Reagenz 39,51 und stellen bis zu einer Endkonzentration von 3 bis 6 & mgr; M.
    3. Nach 16 bis 48 Stunden Inkubation sammeln Zellen zur RNA-Extraktion. 1 ml Säure Guanidiniumthiocyanat-Phenol-Chloroform zu den Zellen Zellen von der Platte zu lösen. Führen RNA extraction nach diesem Schritt.
      1. Alternativ fügen Trypsin so, dass sie alle Zellen bedeckt und bei 37 ° C für 2 min inkubiert.
        Hinweis: Wenn Immunochemie ausführen wollen, verwenden chambered Deckgläser für die Kultivierung. Nach der Differenzierung können Zellen Paraformaldehyd (PFA) (4% für 10 min) festgelegt werden.
  3. RNA - Extraktion und Reverse - Transkriptase - Polymerase - Kettenreaktion (RT-PCR)
    1. Sobald Zellen in Myotuben differenziert sind, entfernen Medium und 1 ml Säure Guanidiniumthiocyanat-Phenol-Chloroform; 10 min bei RT inkubiert.
    2. Transfer zum 1,5-ml-Röhrchen. Kombinieren Sie mit 200 ul Chloroform und Inkubation bei RT für 2 min bis drei separate Schichten zu sehen ist. Die drei Schichten von oben nach unten sind: ein RNA-Schicht, eine DNA-Schicht und eine Proteinschicht.
    3. Zentrifuge bei 12.000 × g für 15 min bei 4 ° C. Entfernen Sie die obere Schicht Überstand und in einem Rohr mit 500 & #181; l Isopropanol (wenn hier zu stoppen, speichern Sie den Überstand bei -80 ° C). Zentrifuge der Überstand bei 12000 × g für 10 min bei 4 ° C; nach dem Zentrifugieren, halten Sie die resultierende RNA-Pellet und den Überstand verwerfen.
    4. Waschen des Pellets mit Ethanol und Zentrifugation bei 8.000 xg für 5 min bei 4 ° C. Dampfe restliche Ethanol durch das Rohr 15 min Umkehren und fügen Sie dann 15 - 30 & mgr; l RNase-freiem Wasser. Quantifizieren von Gesamt-RNA-Konzentration unter Verwendung von US / VIS-Spektroskopie bei 260 nm.
    5. Kombinieren Sie die benötigten Reagenzien für eine RT-PCR-Reaktion: 1,5 ul 10 uM Vorwärtsprimer, 1,5 ul 10 uM Reverse-Primer, 1 & mgr; l dNTP, 5 ul Ein-Schritt-PCR-Kit-Puffer, 0,7 ul RNase-Inhibitor, 1 & mgr; l Enzymgemisch aus ein- Schritt-PCR-Kits und 200 ng RNA. Nachdem diese gemischt wurden, Wasser bis zu einem Endvolumen von 25 & mgr; l hinzuzufügen.
    6. Platzieren Mischung in einem Thermocycler. Führen Sie einen 30 Minuten-Zyklus bei 50 ° C, 15 min0; Zyklus bei 95 ° C, dann 35 Zyklen von 94 ° C für 1 min, 60 ° C für 1 min und 72ºC für 1 min. Schließlich eine 10 min Zyklus bei 72 ° C laufen. Store-PCR-Produkt in einem Kühlschrank bei 4 ° C oder -20 ° C
  4. Komplementäre DNA (cDNA) Sequencing
    1. Identifizieren Exon 6 - 9-übersprungenen Bänder mit Agarose-Gelelektrophorese. Last 5 & mgr; l jeder Probe in die Vertiefungen eines 1,5% igen Agarosegel laufen 135 V durch das Gel für 5 min und dann 120 V für 20 min. Als nächstes für 30 Minuten das Gel in der DNA-Gel-Färbung bei RT inkubiert. Visualisieren Sie die Bänder mit Imaging-Software.
    2. Excise die Band von Interesse ein Gel-Extraktions-Kits verwenden.
      1. Excise das DNA-Fragment und solubilisieren die Gelschnitte unter Verwendung von 200 & mgr; l NTI / 100 mg Gel. Lassen Sie diese für 5 bis 10 min in einem C-Wasserbad 50 ° sitzen. Dann übertragen Membranschlauch auf Kieselsäure.
      2. Zentrifuge bei 11.000 g für 30 Sekunden. Waschen Sie zweimal mit 700 & mgr; l NT3 Puffer vor centrifuging erneut bei 11.000 xg für 30 sec.
      3. Trocknen Sie die Silica-Membran durch bei 11.000 × g für 1 min zentrifugiert.
      4. Hinzufügen von 15 bis 30 & mgr; l Puffer NE und lassen es bei RT für 1 min zu sitzen. Dann wird bei 11.000 × g für 1 min zentrifugiert. Entfernen Sie das Kieselgel und halten Sie den Inhalt in die Röhre.
    3. Verwenden, um eine Sequenzierungs-Kit die Sequenz gemäß dem Protokoll des Herstellers zu bestimmen.

3. intramuskulär oder Open Muscle Biopsy

  1. Für die Versorgung der sterilen Bedingungen während Überleben Chirurgie, entfernen Haarschneider im Bereich der Operationsstelle umgibt (das Hinterbein) verwenden. Verwenden Sie Jodophoren oder Chlorhexidin als Desinfektionsmittel. Verwenden sterilen Tüchern für die Operationsstelle, indem sie und über das gesamte Tier und dem Operationstisch zu sichern.
    1. Tragen Sie saubere Peelings, Gesichtsmasken, Kopfbedeckung, sterile Handschuhe und spezielle Schuhe für den Operationssaal 52,53.
    2. </ Ol>
    3. Injizieren CXMD Hunde mit 20 mg / kg Thiopental-Natrium, sie zu betäuben. Verwenden Tierarzt Salbe auf die Augen, die Augen vor dem Austrocknen zu verhindern.
    4. Verwenden von 2 bis 3% Isofluran Inhalations Narkose (3) zu halten. Überprüfen Muskelreflexe und überwachen Herz und Atemfrequenz der Narkosetiefe zu bewerten. Die normale Atemfrequenz (RR), Herzfrequenz (HR) und SpO 2 unter Vollnarkose sind wie folgt: RR: 10 - 20 Atemzüge / min; SpO 2: 95-100%, HR: 80 - 120 Schläge pro Minute (bpm).
    5. Mit einem Skalpell, schneiden Sie die Haut über der Schädel Tibia (CT), die auch als tibialis anterior (TA) bekannt ist, und einen einzigen Schnitt machen etwa 5 cm in Längsrichtung (für junge erwachsene Hunde). Um die Injektionsstellen, stich die tiefe Faszie mit einer chirurgischen Nadel und chirurgischen Faden markieren und zwei Maschenmarkierer in 2 cm Abständen machen.
    6. Injizieren Sie die gewünschte Konzentration von AONs in den Muskel mit einer 27 G-Nadel. Die gewünschte Konzentration variiert zwischen den Bedingungen der Behandlung. Für CT, geben zwei Injektionen von 1 ml Volumen jeder, für insgesamt 1,2 mg Cocktail PMOs (0,4 mg je PMO) oder 0,4 mg Cocktail vPMOs (0,13 mg je vPMO). Für die extensor carpi ulnaris (ECU) forelimb Muskel injizieren zwei Volumen von 0,5 ml jeder für insgesamt 1,2 mg Cocktail PMOs (0,4 mg je PMO) oder 0,4 mg Cocktail vPMOs (0,13 mg je vPMO). Lassen Sie die Nadel in 1 min. Verwenden Sie die gleiche Menge von jedem AON für den Cocktail.
    7. Führen Sie offene Muskelbiopsie durch ein Stück Muskelgewebe etwa 2 cm in der Länge von CT Muskel mit einem chirurgischen Skalpell entfernen.
    8. Go 6.5 für Muskelprobenvorbereitung Schritt.
    9. Unter Verwendung einer Nadel, zu verwalten eine intramuskuläre Injektion von 0,02 mg / kg Buprenorphinhydrochlorid vor von Narkose erwacht. Legen Sie Muskelfaszie und die Haut wieder über Muskel-und nähen diese eine 3-0 resorbierbaren Fäden und 3-0 Nylon für Muskelfaszie und Hautverschluss Faden, JEWEILIGENely.
    10. Halten Sie bestimmen den Mund offen, ob der Würgereflex zurückgekehrt ist; wenn der Würgereflex zurückgekehrt ist, extubieren den Hund.
    11. Administrieren 15 bis 30 mg / kg Cefazolin oder Cephalexin (Antibiotika) für bis zu 3 Tage durch intravenöse oder intramuskuläre Injektion Infektion zu verhindern.
    12. Entfernen Nähte innerhalb von sieben Tagen. Nicht der Hund unbeaufsichtigt lassen, bis es genügend Bewusstsein zu halten Brustlage und nicht zulassen, den Hund mit anderen Tieren zu interagieren, bis eine vollständige Genesung wird wiedergewonnen hat. Halten Sie die Endotrachealschläuche an Ort und Stelle so lange wie möglich und sie zu entfernen, wenn das Tier zu kauen oder schlucken beginnt. Überwachen Sie die Herzfrequenz des Tieres, Atmung und Feuchtigkeit, um sicherzustellen, sie sind stabil und innerhalb der normalen Grenzen.
    13. Für postoperative Pflege, bieten Analgesie für 3 Tage (zB Buprenorphin 0,01 mg / kg) und Pflegeunterstützung, einschließlich einer ruhigen, dunklen Ruhestätte, entsprechende Wunde und Verband Wartung, einem weichenAuflagefläche, Rehydrierung mit oralen oder parenteralen Flüssigkeiten und eine Rückkehr zu normalen Fütterung durch die Verwendung von sehr schmackhaften Speisen oder Leckereien. Wenn irgendwelche Tiere die zusätzliche Medikation erfordern, eine intramuskuläre Injektion von 0,3 mg / kg Butorphanoltartrat geben auf die Schmerzsymptome ab.
      Hinweis: Hunde in Schmerz kann beißen, kratzen, oder schützen schmerzhaften Regionen, und wenn behandelt, kann ungewöhnlich ängstlich oder aggressiv. Darüber hinaus Schmerzen in einem Glied führt in der Regel Hinken oder Halte-up der betroffenen Extremität mit Versuchen, es zu benutzen. In solchen Situationen kann eine intramuskuläre Injektion von 0,02 mg / kg Buprenorphin-Hydrochlorid geben jeder 6 - 8 Stunden.

    4. Systemische Injections

    Hinweis: Dieses Verfahren kann für die gewünschte Anzahl von Wochen wöchentlich oder alle zwei Wochen wiederholt werden.

    1. Verhalt Hunde manuell und sanft durch den Hund immer hinlegen und dann drapieren Arme über die Schultern und Hüften, den Hund an Ort und Stelle im gesamten t zu haltener Prozedur.
    2. Injizieren AONs; 120-240 mg / kg Cocktail PMOs (40-80 mg jeweils AON) eine venöse Dauernadel in eine Vene Extremität (bekannt als cephalica oder einer Vena saphena) verwendet wird. Die Menge des injizierten AON hängt von der experimentellen Bedingungen. Verwenden Sie die gleiche Menge von jedem AON für den Cocktail.
    3. Verwenden einer Infusionspumpe oder Spritzenpumpe auf 50 ml Gesamt injizieren mit einer Rate von 2,5 ml / min für 20 min, nach den Anweisungen des Herstellers. Wiederholen Sie Injektionen wöchentlich oder alle zwei Wochen (alle zwei Wochen) mindestens 5-mal, wie Dystrophin-Expression mit wiederholten Injektionen ansammeln.
    4. Führen Sie Bluttests wöchentlich Toxizität zu untersuchen.
      1. Unter Verwendung einer Nadel, sammeln 3 ml Blut - 0,5 ml für komplette Blutbild (CBC) und 2,5 ml für andere - von einem der subkutanen Venen der vorderen oder hinteren Gliedmaßen. Fügen Sie CBC, Gammaglutamyltransferase (GGT), Aspartat-Aminotransferase (AST), Blutharnstoffstickstoff (BUN), Alanin aminotransferase (ALT), Kreatinkinase (CK) und Kreatinin Abschätzungen bei der Prüfung des gesammelten Blutes, nach den Anweisungen des Herstellers aus dem Blut Testkits. 40,54

    5. Klinische Einstufung der Hunde

    1. Stellen Sie eine Videokamera und Rekordhundeverhalten und Gang auf. Notieren Sie sich die gesamte Begegnung mit dem Hund, da dies als Referenz dienen soll, wenn der Hund Einstufung; Dies bedeutet, jedes Video eine andere Länge auf den Hund Fähigkeiten und die Bereitschaft abhängig sein wird. Verwenden Sie Standard-Aufnahmeparameter. Die Dreharbeiten erstellt einen Datensatz von der Einstufung, so dass es zu einem späteren Zeitpunkt überprüft werden können.
    2. Grade Gangart und Bewegungsstörungen.
      1. Für Gang- und Bewegungsstörungen, verwenden Sie die folgenden Qualitäten:
        Note 1 = keine, Grad 2 = mit Hinterbein sitzen verlängert, Grad 3 = Hase-Hopfen mit Hinterextremitäten, Grad 4 = schlurfenden Gang und Grad 5 = nicht in der Lage zu gehen.
      2. Für Mobilitätsstörungen, verwenden Sie die folgende Noten: Note 1 = keine, grade 2 = down mehr als normal liegen, Grad 3 = nicht auf Hinterbeine springen, Grad 4 = zunehmende Schwierigkeit bewegen, und Grad 5 = nicht in der Lage, aufzustehen und sich zu bewegen.
    3. Zeit, wie lange es den Hund 15 m zu laufen dauert. Messen Sie 15 m, legen Sie den Hund an der Startlinie und ermutigen sie, bis die 15 m Marke zu laufen.
    4. Bestimmen Sie Muskelatrophie des Beines mit dem folgenden Bewertungsskala:
      Note 1 = keine, Grad 2 = Verdächtiger Härte, Grad 3 = kann Härte fühlen oder erscheint dünn, Note 4 = zwischen Klassen 3 und 5 und Grad 5 = extrem dünn oder hart.
    5. Grade sabbern die folgende Skala: Note 1 = keine, Grad 2 = gelegentlich dribbelt Speichel beim Sitzen, Grad 3 = etwas Sabber beim Essen und Trinken, Grad 4 = Saiten sabbern beim Essen oder Trinken, und Grad 5 = Dauer sabbern.
    6. Grade Hypertrophie der Zunge (Makroglossie) unter Verwendung der folgenden Skala: Note 1 = keine, Grad 2 = leicht vergrößert, Grad 3 = extended OUTSIde Gebisses, Note 4 = vergrößert und leicht verdickt und Grad 5 = vergrößert und verdickt.
    7. Grade die Fähigkeit des Hundes anhand der folgenden Skala zu schlucken: Note 1 = keine Schwierigkeit, Grad 2 = braucht Zeit und Mühe in die Lebensmittel, Grad 3 = Schwierigkeiten bei der Einnahme von Nahrungs aus einer Platte, Note 4 = Schwierigkeiten beim Kauen, Schlucken, oder Trinken und Grad 5 = nicht in der Lage zu essen.
    8. Berechnen Gesamtnote durch die Partituren aus jeder Kategorie Zugabe ( mit Ausnahme des 15 m Lauftest) 55.
      Hinweis: Die Studien geblendet werden sollte, um nicht Bias einzuführen.

    6. Magnetic Resonance Imaging (MRI)

    1. Verwenden Sie ein 3-Tesla (3T) MRT und 18 cm Durchmesser / 18 cm Länge menschlichen Extremitäten Spule T2-gewichteten Bilder von hinteren Extremitäten zu erhalten.
    2. Anesthetize Tiere durch die Injektion von CXMD Hunde mit 20 mg / kg Thiopental. Verwenden Tierarzt Salbe auf die Augen, die Augen vor dem Austrocknen zu verhindern. Verwenden Sie 2-3% Isofluran Inhalation Allgemeinanästhesie zu halten.
      1. Überprüfen Muskelreflexe und überwachen Herz und Atemfrequenz der Narkosetiefe zu bewerten. Die normale Atemfrequenz (RR), Herzfrequenz (HR) und SpO 2 unter Vollnarkose sind wie folgt: RR: 10 - 20 Atemzüge / min, SpO 2: 95-100%, HR: 80 - 120 Schläge pro Minute (bpm ).
    3. Verwenden Sie die folgenden Einstellungen T2-gewichteten Bilder zu erhalten: TR / TE = 4000/85 ms, Schichtdicke = 6 mm, Scheibenspalt = 0 mm, Sichtfeld = 18 cm x 18 cm, Matrixgröße = 256 x 256, und Anzahl der Erfassungen = 3 bei schnellen Spin - Echo (Abbildung 4).

    7. Muskel Probenahme und der Vorbereitung (Necropsy)

    Hinweis: Die Muskeln sollten ein oder zwei Wochen nach der letzten Injektion AON beproben.

    1. Injizieren Hunde mit 20 mg / kg Thiopental-Natrium, sie zu betäuben. Verwenden vet Salbe auf die Augen während anesthetization Trocknen der Augen zu verhindern.
    2. Verwenden Sie 2 - 3% Isofluran Inhalation anes zu haltenThesia. Überprüfen Muskelreflexe und überwachen Herz und Atemfrequenz der Narkosetiefe zu bewerten. Die normale Atemfrequenz (RR), Herzfrequenz (HR) und SpO 2 unter Vollnarkose sind wie folgt: RR: 10 - 20 Atemzüge / min; SpO 2: 95-100%, HR: 80 - 120 bpm.
      1. Euthanize Hunde durch Ausbluten unter Allgemeinanästhesie (für Obduktion nur). Verwenden Ausbluten unter tiefer Narkose die Wirkungen von Blut abgeleiteten Faktoren in der molekularen Analyse (beispielsweise Herzmuskel) zu vermeiden.
    3. Präparieren Sie die folgenden Muskeln (Abbildung 5): CT, extensor digitorum longus (EDL), Gastrocnemius, Soleus, Bizeps femoris, Rectus femoris, Bizeps, Trizeps, Deltamuskel, ECU, extensor carpi radialis (ECR), Flexor carpi ulnaris (FCU ), Flexor carpi radialis (FCR), gracilis, intercostal, Bauchmuskeln, Zwerchfell, seitliche dorsi, Speiseröhre, sternocleidomastoid und Herz. Um zu untersuchen, Toxizität, sammeln Niere und liver Proben. Verwenden Evans und Alexander de Lahunta (2009) als Referenz für Dissektionstechnik 56.
    4. Schneiden Sie die CT, EDL, Gastrocnemius, Soleus, Bizeps femoris, Rectus femoris, Bizeps, Trizeps, Deltamuskel, ECU, ECR, FCU, FCR, gracilis, intercostal, Bauchmuskeln, seitlich dorsi, Speiseröhre, sternocleidomastoid, Herz, Niere, und Leber in kleine Abschnitte etwa 1-1,5 cm in der Länge. Rollen Sie die Membran nach oben und dann schneiden Sie es in 1 bis 1,5 cm Abschnitte 56.
    5. Legen Sie Tragant, so dass es etwa 0,5 - 1 cm dick auf Korkscheiben. Label Scheiben mit dem Tieridentifizierungs und Muskelnamen auf der gegenüberliegenden Seite des Tragantgummi.
    6. Platzieren Muskeln mit ihrer Längsachse senkrecht zu den Korken in der Tragantgummi.
    7. Platzieren Sie die Korken in einem Behälter von Isopentan, das in flüssigem Stickstoff sitzt. Verschieben Sie es um ständig mit einer Pinzette für 1 min oder bis vollständig gefroren. Shop Muskeln auf Korkenin Ampullen bei -80 ° C. Beim Transport, setzen Fläschchen auf Trockeneis.
    8. Bereiten Glasobjektträger beschriftet mit Tieridentifikation / Muskel Namen und Datum.
    9. In einem Kryostaten auf -25 ° C abgekühlt, montieren Sie den Korken auf den Ständer. Stellen Sie die Schnittdicke auf das gewünschte Niveau. Verwenden Sie 8 um für die Immunhistochemie und 12 & mgr; m für Hämatoxylin und Eosin (HE) Färbung. Verwenden Sie 15 & mgr; m für Western-Blot-Proben. Schneiden Sie etwa ein Viertel des Muskels einen flachen Muskel für die richtige Muskel Probenahme zu erhalten.
    10. Ein Abschnitt des Muskels zu einer Zeit , Schneiden, legen jeden 6. Abschnitt auf dem gleichen Objektträger aus Glas , wenn die Planung für die Immunhistochemie Proben zu verwenden oder HE - Färbung. Bei der Verwendung von Proben für Western-Blots, setzen 30 - 40 Abschnitte in einem Rohr und bei -80 ° C.
    11. Nach der Herstellung der Folien, Folien lassen für 1,5 h bei RT trocknen. Shop gleitet bei -80 ° C.

    8. Immunhistochemie

    1. Entfernen Sie vorbereitete Folien aus dem Speicher und legen Sie sie ineine Feuchtigkeitskammer die Folien getrennt zu halten und Feuchtigkeit halten. Füllen Sie den Feuchtigkeitskammer, so dass der Boden nur mit Wasser (ca. 1 mm Wasser) bedeckt ist.
    2. Lufttrockener 0,5 Stunden. Zeichnen Sie ein Quadrat der Muskelprobe auf dem Objektträger umschließt eine hydrophobe Barriere Stift.
    3. Hinzufügen, 15% Ziegenserum in Phosphat-gepufferter Salzlösung (PBS) und Inkubation für 2 h bei RT In Reagens blockiert wird.
    4. Hinzufügen anti-Dystrophin Stangenbereich (DYS-1) monoklonalen Maus primären Antikörper oder C-terminal monoklonaler Antikörper (DYS-2) für Hunde Dystrophin-Färbung (1: 150 Verdünnung). Verdünnte einem Blockierungsmittel in 1,25 ml PBS verwendet. Inkubieren O / N in einem Kühlschrank einen 4 ° C.
    5. Waschen mit PBS für 5 min dreimal wiederholt. Hinzufügen sekundären Antikörper Alexa 594 Ziegen-Antikörper gegen Maus-IgG1 (für DYS-2) oder IgG2 (für DYS-1) (1: 2.500). Verdünne mit einem Blockierungsreagenz in PBS, enthaltend 0,1% Octylphenol-ethoxylat. Inkubieren für 0,5 Stunden bei RT.
    6. Waschen mit PBS für 5 Minuten, drei times. Erlauben slide trocknen. Merken 1 - 2 Tropfen (3 ng / ml) von 4 ', 6-diamidino-2-phenylindole (DAPI) Befestigungslösung. Mit einer Pinzette, einen Glas Rutsch über die Oberseite der Abschnitte, die Vermeidung Blasen.
    7. Ansicht dystrophin- (DYS-1 / DYS-2) positive Fasern unter einem Fluoreszenzmikroskop bei 594 nm bei 20facher Vergrößerung.

    9. Western Blotting

    1. In gesammelter Muskelpartien von Kryo-sectioning bis 150 & mgr; l Probenpuffer auf Eis.
    2. Mit einer Hand-Homogenisator homogenisieren kurz die Proteinproben. Wärme Proben in einem 1,5-ml-Röhrchen in einem Inkubator Heizblock bei 95 ° C für 3 - 5 min. Zentrifuge bei 16.500 × g für 15 min und sammeln den Überstand.
    3. Store Aliquots des Überstandes bei -70 ° C. Verwenden Sie destilliertes Wasser bis 100x zu verdünnen.
    4. Bestimmen Proteinkonzentration eines kommerziellen Kits nach Herstellerprotokoll. In 2x Laemmli SDS-Ladepuffer zu den Proben und Wärme für 3 min &# 160; bei 95 ° C.
    5. Laden Sie die Proben in 3 bis 8% Tris-Acetat - Gel , bevor es für 3 Stunden bei 150 V Fügen Sie mehrere verdünnte Wildtyp (WT) Proben (zB 1%, 10% und 50%) für die Quantifizierung läuft. Weniger als 1% WT Ebenen Dystrophin sollte mit diesem Verfahren nachgewiesen werden.
    6. Legen Sie das Gel in Kathodenpuffer für 20 min. Während dieser Zeit nehmen neun Stücke aus Filterpapier und steckte sie in den Transferpuffer (3 Papiere in Kathodenpuffer [+], der Anodenpuffer ([-] und der konzentrierten Anodenpuffer [-], beziehungsweise) Dies. beschreibt eine halbtrockenen Transferverfahren , die Empfindlichkeit (Abbildung 6) zunimmt.
    7. Einweichen eine PVDF-Membran in Methanol für 20 Sekunden und dann in die Anodenpuffer platzieren.
      Stellen Sie das Gel mit der Membran für halbtrockene Transfer und erlauben es 1,5 Stunden bei 400 mA in RT oder in einem kalten Raum zu laufen.
    8. Waschen Sie die Membran mit PBS. Inkubieren der Membran in einem Gemisch aus PBS mit Tween 20 (PBST) und 5% Milchpulver 2 Stunden.
    9. Verdünnte DYS-1 (primärer Antikörper) in PBST und 5% Milchpulver Mischung auf eine 1: 100 Verdünnung. Fügen Sie es zu der Membran und lassen Sie es für mindestens 1 Stunde inkubiert. Waschen dreimal mit je 100 ml PBST 15 min je.
    10. Hinzufügen 65 & mgr; l / Bahn von HRP konjugierten Sekundärantikörper (anti-Maus-IgG2a für DYS1) bei 1: 5,000 Verdünnung für 1 h bei RT in einem dunklen Bereich. Dann wäscht mit dreimal mit je 200 ml PBST 20 min. Mix-Lösungen aus einer Nachweis-Kit, wie verwiesen. Inkubation für 1 min.
    11. Entwickeln Folienbänder zu erfassen und zu analysieren , mit ImageJ Software 48,57,58.

Representative Results

In - vitro - Experimente

Myoblasten wurden mit verschiedenen 2'OMePS Behandlungsbedingungen, um transfizierte die Wirksamkeit der einzelnen AON zu vergleichen. Einzel AON Behandlungen mit 600 nM jeweils Ex6A, Ex6B, Ex8A oder Ex8B wurden durchgeführt, sowie eine Cocktail-Behandlung mit 600 nM jedes aller 4 AON-Sequenzen. RNA-Proben wurden vier Tage nach der Transfektion gesammelt. Nach der RT-PCR wurden Proben für jede Behandlung wurden zusammen mit nicht-behandelten (NT) Proben auf einem Gel laufen gelassen. Bands höher auf dem Gel darstellen out-of-frame DMD Produkte; Diese Banden wurden in NT, Ex8A und Ex8B behandelt Myoblasten gesehen. Ex6A, Ex6B, Ex8A und die Cocktail-behandelten Myoblasten zeigten in-Frame-Produkte. Der Cocktail und Ex6A / B zeigte eine 100% in-frame Produkte, während Ex8A nur 30% in-frame - Produkte (7) gezeigt. Um zu bestätigen, Exon-Skipping und Wiederherstellung vonder Leserahmen wurde cDNA-Sequenzierung durchgeführt; Die Ergebnisse zeigten , dass die Exons 6 bis 9 waren in der Tat (Figur 7) übersprungen worden. Immunhistochemie zeigte , dass AON-behandelten Hunden Dystrophin-positive Fasern im Vergleich zu NT - Proben (8) angestiegen war.

In - vivo - Experimente

Um die Effizienz der verschiedenen AON Behandlungsbedingungen CXMD dogs vergleichen (0,5 - 5 Jahre alt) wurden in verschiedenen Dosierungen einmal mit 1,2 mg Ex6A oder einem Cocktail aus Ex6A, Ex6B und Ex8A injiziert. Zwei Wochen nach der Injektion, Muskelproben wurden gesammelt und gefärbt mit DYS-1 die Anzahl der Dystrophin-positive Fasern zu vergleichen. Alle Cocktail-behandelten Proben zeigten eine erhöhte Dystrophin-Expression im Vergleich zu NT-Proben. Dystrophin-positiven Fasern erhöht mit AON Dosierung (Abbildung 9). Nach Systemic - Injektion, Wildtyp (WT), NT und Cocktail-behandelten CXMD Muskelproben wurden mit DYS-1 (Abbildung 10) gefärbt. Cocktail-behandelten CXMD Hunde zeigten erhöhte Expression Dystrophin im Vergleich zu NT CXMD Hunde, die beide in der CT und der Herzmuskelproben. Allerdings AON-behandelten Skelettmuskel (CT) zeigte viel höhere Expression von Dystrophin im Vergleich zu behandelten Herzmuskel. Ein Immunoblot führte WT, NT und verschiedene Morpholino Cocktail-behandelten Muskeln zu dem gleichen Ergebnis zu vergleichen. Es gab auch eine große Auswahl an Dystrophin - Expression in den behandelten Skelettmuskelproben (Abbildung 10). Hematoxylin und Eosin (HE) Färbung ergab, dass CXMD behandelt Hunde zeigten verbesserte Histopathologie, mit einer signifikanten Abnahme der zentral nukleierten Fasern (CNF) im Vergleich zu NT CXMD Hunden (Abbildung 11). Dies zeigt an, dass mehr Degeneration / Regeneration ist in dem Hund NT auftritt, ein Zeichen der dystrophischen Muskel Pathologie. Zusätzlich hatte behandelten Hunde schnellerZeiten und eine verbesserte Werte auf der klinischen Bewertungsskala läuft. Behandelte CXMD Hunde zeigten bessere Ergebnisse als NT CXMD Hunde in allen Kategorien (Abbildung 12).

Abbildung 1
Abbildung 1. Mutationsmuster des CXMD Hund und Exons . 6 - 8 Skipping Strategien Verwendung eines Antisense - Cocktail CXMD Hunde haben eine Punktmutation in Exon 6 führt zu einem Verlust von Exon 7 in dystrophischen Hund mRNA. Dies führt zu der mRNA ist out-of-Frame und Dystrophin-Protein-Produktion verloren. Kurze AON-Sequenzen sind so konzipiert, zu binden, 6 zu Exon und 8, die in mRNA-Spleißen führt effektiv Exons Überspringen 6 - 8. Der graue Balken in den AON-Cocktail-behandelten Hunden kurze AON-Sequenzen darstellt. Exon 9 kodiert für ein Gelenk-Domäne und manchmal spontan mit AONs gegen Exon 6 und 8. Die resultierenden mRNA für Proteine ​​codiert Dystrophin, die kürzer aber Funktion gespleißt outal. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Die wichtigsten klinischen Symptome einer 1-jährigen Canine X-chromosomal - Muskeldystrophie (CXMD) Tier. Ein 1-jährige Wildtyp - Beagle und ein CXMD Hund gezeigt. Die Beteiligung der proximalen, des Körpers und zeitliche Muskeln sind in der Regel aus Alter von 2 Monaten beobachtet. Gemeinsame Kontraktur und eine Verschiebung des Beckens sind offenkundige 4 Monate alt. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Allgemeine Anästhesie für einen Hund. A) Intramuscular Injektionen und Muskelbiopsien werden unter Vollnarkose mit Isofluran durchgeführt. B) Halten des Tieres für systemische Injektionen. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. Magnetic Resonance Imaging (MRI) von Wild-Typ, nicht behandelt CXMD und behandelte CXMD. MRT - Scans des Hinterbein nach 3 Monaten und 5 Monate in WT und NT CXMD Hunde. Zwei Musterbilder von behandeltem CXMD Hinterbein MRIs prä- (1 Woche vor der ersten Injektion) und nach der Injektion von AON gezeigt. 2703MA wurde 7x wöchentlich mit 200 mg / kg Cocktail Morpholinos behandelt. 2001MA wurde mit 5x wöchentlich intravenöse Injektion von 120 mg / kg Cocktail Morpholinos behandelt. Kontrolle und behandelten Hunden waren altersgleichen. Die behandelten Hunde zeigen T2 Signale verringert. Die Bilder sind ADAP ted mit freundlicher Genehmigung von Yokota et al. (copyright 2009, John Wiley & Sons) 40 Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5. Muskelbiopsie Verfahren für einen Hund. A) Eine untere Extremität wird für Muskelbiopsie fixiert. B) Mit Hilfe der Zange wird die untere Extremität gehalten. C) Die CT Muskel ausgesetzt ist. Die offene Biopsie-Technik wird verwendet, um Muskelproben von injiziertem Websites erhalten. Themen werden verwendet, Biopsieproben zu halten. D) Muskelproben auf Tragant nach der Sektion. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

/53776/53776fig6.jpg "/>
Abbildung 6. Halbtrocken - Übertragungsmethode. Eine Darstellung der halbtrockenen Transferverfahren für Western - Blot dargestellt. Drei Papiere getränkt in konzentrierter Anodenpuffer sind an dem negativen Anschluß festgelegt sind; 3 Papiere in Anodenpuffer getränkt sind oben auf dieser gestapelt. Die Mb PVDF Papier wird in Methanol und dann Anodenpuffer getränkt, bevor sie auf der Oberseite der 6 Papiere gelegt werden. Das Gel, das in Kathodenpuffer getränkt worden ist, wird sanft über die PVDF Papier gelegt. Schließlich 3 in Kathodenpuffer getränkte Papiere sind auf der Oberseite des Gels gelegt. Der positive Anschluss ist auf der Oberseite eingestellt. 1 h, 400 mA durch das System ausgeführt wird. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

7
Abbildung 7. Exon - Skipping in CXMD Myoblasten. et al. (Copyright 2009, John Wiley & Sons) 40. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Abbildung 8
Abbildung 8. Erhöhte DystropHin Expression in 2'O- methyliert Phosphorothioat (2'OMePS) Transfizierte CXMD Myoblasten. CXMD Myoblasten wurden allein mit Ex6A transfiziert oder mit Cocktail 2'OMePS. DYS-2 (rot) und DAPI (blau) Färbung gezeigt. Die behandelten Myoblasten sind im Vergleich zum Wildtyp (WT) und nicht behandelten (NT) Myoblasten. Die Bilder werden mit freundlicher Genehmigung von Yokota et al angepasst. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 & mgr; m. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

9
Abbildung 9. Rettung von Dystrophin Expression mit intramuskuläre Injektionen von Morpholinos in CXMD Hunde. Entweder Ex6A allein oder einem Cocktail aus Ex6A, Ex6B und Ex8A wurden in die CT Muskeln von CXMD Hunden injiziert. Dystrophin (DSY-1) Färbung von Wildtyp(WT), nicht behandelte (NT), und behandelt CXMD Hunde gezeigt. Die Hunde wurden entweder mit 1,2 mg Ex6A allein oder 1,2 mg Cocktail behandelt. Die Bilder werden mit freundlicher Genehmigung von Yokota et al angepasst. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 & mgr; m. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

10
Abbildung 10. Erhöhte Dystrophin - Expression nach Systemische Cocktail Morpholino Behandlung in CXMD Hunde. Dystrophin (DYS-1) Färbung wurde verwendet , um Dystrophin - Expression in Wildtyp (WT) (positive Kontrolle), nicht behandelte (NT) (Negativkontrolle) zu vergleichen, und CXMD Hunde mit 120 mg / kg morpholino-Cocktail (40 mg / kg jeder AON) behandelt. Der Morpholino Cocktail enthielt Ex6A, Ex6B und Ex8A. Die Hunde wurden intravenös 5 mal injiziert wirekly mit diesem Cocktail. A) Ein Vergleich der Dystrophin-Expression in Schädel Tibia (CT) Muskeln von WT, NT und behandelten Hunden. B) Ein Vergleich der Dystrophin-Expression im Herzgewebe zwischen NT und Morpholin Cocktail-behandelten Hunden. C) Immunoblot für Dystrophin mit Desmin als Ladekontrolle für WT, NT und morpholino Cocktail-behandelten Hunden gezeigt. Folgende Muskeln sind für die behandelten Hunden gezeigt: Trizeps (TB), Bizeps (BB), Membran (DIA), der Speiseröhre (ESO), CT, Adduktoren (ADD), extensor digitorum longus (EDL), Kaumuskeln (MAS), und Herz. Die Bilder werden mit freundlicher Genehmigung von Yokota et al angepasst. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 & mgr; m. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

11
Zahl11. Verbesserte Histopathologie in CXMD Hunde behandelt 7 Wochen mit 240 mg / kg Morpholino Cocktail. CXMD Hunde von einem halben Jahr bis zu fünf Jahren im Bereich intravenös mit 240 mg / kg Morpholin - Cocktail (Ex6A, Ex6B und Ex8A) einmal injiziert Woche 7 Wochen. Vierzehn Tage nach der letzten Injektion wurden Speiseröhre Muskeln aufgenommen und Hämatoxylin und Eosin (HE) Färbung wurde durchgeführt. HE - Färbung der Speiseröhre Muskeln von nicht behandelten (NT) und Morpholin Cocktail-behandelt (behandelt) CXMD Hunde (40X Objektiv). Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

12
Abbildung 12. Verbesserte basiert auf klinischen Grading und 15 m Laufzeit nach Morpholino Behandlung. Morpholino-behandelten Hunden wurden im Vergleich zu nicht behandelten (NT) littermates. Die Fehlerbalken in der Grafik zeigen SEM. A) Gesamtpunktezahl auf der klinischen Einstufung Prüfung wurde berechnet, vor und nach der Behandlung und behandelten Tiere wurden im Vergleich zu NT littermates. B) Ein Vergleich von 15 m Laufzeiten der behandelten und NT Hunde. C) Wie B; jedoch wurden jüngere Hunde eingesetzt. Bilder angepasst sind , mit freundlicher Genehmigung von Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bitte hier klicken , um eine größere Version dieser Figur zu sehen.

Antisense - Oligonukleotids Nucleotid - Sequenz
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tabelle 1. Antisense - Oligonukleotid - Design.

Discussion

Exon-Skipping ist eine vielversprechende therapeutische Technik zur Behandlung von DMD. Sowohl in vitro und in vivo Versuche haben gezeigt , dass die Multi-Exon - Skipping führbar ist. Hier wird die Verwendung des CXMD Hundemodell diskutiert. Zunächst wurden AONs entwickelt , um die Rettungs ESE und ESEfinder Programme mit Dystrophin - Exons 6 bis Ziel - 8. Die 2'OMePS AON Chemie für CXMD Myoblasten Transfektion und Morpholin AON Rückgrat Chemie wurde für In - vivo - Experimente ausgewählt verwendet wurde. vPMOs sind effizienter als unmodifizierte PMOs aber aufgrund ihrer höheren Toxizität sind sie für die systemische Injektionen nicht geeignet. RNA-Extraktion, RT-PCR und cDNA-Sequenzierung wurden auf den CXMD Myoblasten durchgeführt. Hunde mit dem PMO Cocktail injiziert waren klinisch abgestufter keine Besserung der klinischen Symptome zu bewerten. Nachdem die Hunde artgerecht eingeschläfert wurden, wurden Muskelproben und für Kryo-Schnitte vorbereitet genommen. Die Halbwertszeit von Dystrophin-Protein, induziert durch AONs wird angenommen, dass etwa 1 zu sein - 2 Monaten. Junge erwachsene Hunde wurden in dieser Studie verwendet wurden, obwohl diese Versuche mit neugeborenen Hunden und älteren Hunden durchgeführt werden (> 5 Jahre). Vorbereitete Muskelabschnitte wurden verwendet , Histopathologie zu bewerten und Dystrophin - Protein Rettung durch Western Blotting und Immunhistochemie 48 beurteilen.

Es ist wichtig sicherzustellen, dass das Volumen der Lösung vor der PMO-Injektionen korrekt ist; haben so erhebliche Auswirkungen auf die Ergebnisse zu tun, andernfalls wird. Während intramuskuläre Injektionen wird ein ausreichender Druck erforderlich, um die Muskelfasern zu gelangen. Die Überwachung der Hundegesundheit und Inspektion der Operationsstelle sind wichtig für die Fehlerbehebung. Um die Tiergesundheit, wöchentliche Bluttests überwachen und mit einem Gewicht durchgeführt werden sollte. Nach Euthanasie der Tiere und Herstellung von Muskelproben, Empfindlichkeit ein kritischer Schritt für die Gewährleistung Dystrophin-Protein bei der Erkennung sowohl des Tris-Acetat-Gel und halbtrockenen Blotting-Verfahren zu verwenden,während der Western-Blot-Verfahren.

Wie in den repräsentativen Ergebnissen gezeigt, behandelt Myoblasten mit Ex6A, Ex6B, Ex8A, und der Cocktail (mit Ex6A, Ex6B, Ex8A und Ex8B) im Rahmen DMD Produkte hergestellt. Da keine Ex8B Exon-übersprungenen Produkte produziert, wurde es nicht in den nachfolgenden in vivo Experimenten verwendet. cDNA-Sequenzierung ergab, dass die Exons 6 - 9-Skipping aufgetreten und Immunzytochemie mit DYS-2-Färbung zeigten Dystrophin-Expression in behandelten Proben wiederhergestellt. AON-behandelten Hunden zeigten eine signifikante Zunahme der Dystrophin-positive Fasern. Dies zeigt, dass die Exons 6 bis 8 wurden übersprungenen und ein verkürztes Protein wurde hergestellt. Die Menge an Dystrophin-positiven Fasern erhöht, wenn ein Cocktail von AONs verwendet wurde, und war zu AON Dosierung proportional. Immunoblots zeigten Dystrophin-Expression in systemischen morpholino-behandelten Hunden erhöht. Der Skelettmuskel hatte variable Mengen an Dystrophin-Fasern; jedoch morpholino-behandelten Herzgewebe zeigte wenigVerbesserung der Dystrophin-Expression. Da Dystrophin mit hohem Molekulargewicht (427 kDa) hat der Nachweis von geringen Mengen des Eiweißes kann schwierig sein. Für die besten Ergebnisse, Tris-Acetat-Gel und die halbtrockenen Transferverfahren verwendet wurden. HE-Färbung zeigte verbesserte Histopathologie in den Morpholino-behandelten Hunden. Zentral-nukleiert Fasern (CNF) sind ein Zeichen für ungesunde Muskel und Zyklen von Muskeldegeneration und Regeneration darstellen. Morpholino behandelten CXMD Hunde zeigten eine Abnahme des Anteils der CNFs im Vergleich zu nicht behandelten CXMD Hunden. Klinische Einstufung ergab eine Verbesserung der Symptome, wie erhöhte Geh- und Lauffähigkeit, in morpholino-behandelten Tiere. Die Härte der Muskeln wird angenommen , dass Muskelatrophie zu reflektieren, damit es in der Benotungsskala 59 aufgenommen wurde. Die Härte des Oberschenkels (Hinterschenkel) Muskeln bewertet wurde; jedoch ausgeschlossen wir Schädel Schneidermuskel Muskeln, weil sie Hypertrophie zeigen neigen eher als Atrophie in CXMD. Die behandelten Hunde zeigened niedrigere Einstufung Partituren und hatte eine bessere Zeit auf der 15 m Lauftest. Verbesserte Mal auf der 15 - m - Prüfung sind ein Anzeichen für eine verbesserte Muskelfunktion 40. Höhere Gesamt Einstufung Werte zeigen schlechte Gesundheit und eine erhöhte Muskelatrophie.

Während diese Ergebnisse vielversprechend sind, präsentiert Multi-Exon-Skipping noch viele Herausforderungen, die überwunden werden müssen, bevor die Technik klinische Anwendbarkeit hat. Herzgewebe zeigt noch verminderte Aufnahme von AONs, wahrscheinlich aufgrund der Differenz in der zellulären Handel zwischen Herz- und Skelettgewebe. Keine toxischen Wirkungen wurden bei Tieren unter den gegenwärtigen Dosierungsschemata beobachtet; jedoch muss mehr getan werden, die Langzeittoxizität zu bewerten, bevor die Verwendung von AON-Cocktails zu klinischen Studien bewegen kann. Es ist schwierig, die Genehmigung für AON Cocktail Drogen zu gewinnen, weil jede Regulierungsagentur AON-Sequenz als ein einzigartiges Medikament definieren. Dies bedeutet, dass jede Sequenz in einem Cocktail individuell müssten für Safet getestet werdeny, mehr Zeit und mehr Geld erfordern. Ein weiteres Hindernis für den Einsatz von Multi-Exon-Skippings in einer klinischen Umgebung ist eine große Menge an Zwischenproteinprodukte mit unbekannten Funktionen erzeugt. Diese Proteine ​​können potenziell führen zu unvorhersehbaren Nebenwirkungen in Abhängigkeit von der einzelnen Mutation 22. Darüber hinaus sind die Mutation Muster innerhalb von aktuellen dystrophischen Hund Modelle begrenzt. Es gibt nur wenige natürlich vorkommende Mutationen, und nicht alle Mutationen sind nützlich zur Untersuchung von Multi-Exon-Skipping. Die dystrophischen Schweinemodell verspricht eine gute Alternative für die zukünftige DMD Exon - Skipping - Studien 33, 34 zu sein.

Die DMD Hund Modelle haben einige Vorteile gegenüber anderen DMD-Modelle. Als ein größeres Tiermodell, klinische Sortier- und MRT sind möglich, für eine detailliertere Analyse zu ermöglichen. Da Hunde große Tiere sind, sind sie auch geeignet für Toxikologiestudien und enger die menschliche Krankheit im Vergleich zu dem Maus-Modell darstellen. Hund modelle haben auch Sequenzen DMD - Gen , das ähnlicher zu 23 Menschen sind, 34, 45.

Obwohl technisch anspruchsvoll , das Multi-Exon - Skipping Ansatz letztlich profitieren könnten> 90% der DMD - Patienten 24. Dies macht es eine viel bessere Alternative zu Single-Exon-Skipping, als Single-Exon-Skipping nur für einen kleinen Teil der Patienten ist. Darüber hinaus wird Multi-Exon-Skipping ermöglichen es uns, die Löschmuster auszuwählen, die die Funktionalität der verkürzten Dystrophin-Proteine ​​zu optimieren. Zum Beispiel das Löschen von DMD Exons 45 - 55 mit außergewöhnlich milde Symptome oder asymptomatischen Personen 14,19,60-63 verbunden ist. Die Multi-Exon - Skipping des Exons 45 bis 55 bereits in einem Mausmodell der DMD mit einem Exon 52 Deletion (mdx52) unter Verwendung systemische Injektionen von vPMOs 22,26 nachgewiesen. Die Verwendung von Cocktails vPMOs wurde auch in anderen Formen von Muskeldystrophie gezeigt worden, wie beispielswie Fukuyama kongenitale Muskeldystrophie (FCMD). FCMD durch Exon-Trapping verursacht, in denen aberrante mRNA Splicing durch Retrotransposon Insertion verursacht wird. vPMOs wurden 64 das Splicing - Muster in sowohl einem FCMD Mausmodell und in menschlichen Zelllinien zu retten gezeigt. Next-Generation AON Chemien höhere Wirksamkeit und eine geringere Toxizität aufweisen würde die effektive Umsetzung des Multi-Exon-Skipping-Ansatz in die klinische Anwendung zu erleichtern. Zusätzlich könnte Multi-Exon - Skipping potentiell auf andere genetische Erkrankungen angewendet werden, wie beispielsweise die dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Auslassen von Multi-Exon-Verwendung Cocktail Antisense-Oligonucleotiden in der Canine X-chromosomal-Muskeldystrophie
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter