Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Multi-esone skipping Utilizzando oligonucleotidi antisenso Cocktail nella distrofia muscolare Canine X-linked

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

Exon skipping è attualmente un'opzione terapeutica più promettente per distrofia muscolare di Duchenne (DMD). Per espandere l'applicabilità per pazienti DMD e per ottimizzare la stabilità / funzione delle proteine ​​distrofina troncate risultanti, un multi-esone skipping approccio utilizzando cocktail oligonucleotidi antisenso stato sviluppato e abbiamo dimostrato salvataggio distrofina sistemica in un modello del cane.

Abstract

Distrofia muscolare di Duchenne (DMD) è una delle malattie genetiche letali più comuni in tutto il mondo, causata da mutazioni nel gene della distrofina (DMD). Exon skipping impiega breve DNA / RNA-come le molecole chiamate oligonucleotidi antisenso (AONs) che ripristinano il quadro di lettura e di produrre le proteine ​​più brevi ma funzionali. Tuttavia, esone skipping terapia deve affrontare due ostacoli principali: limitata applicabilità (fino a solo il 13% dei pazienti possono essere trattati con un singolo farmaco AON), e la funzione delle proteine ​​incerta troncati. Questi problemi sono stati affrontati con un approccio cocktail AON. Mentre circa il 70% dei pazienti DMD possono essere trattati con sola skipping esone (tutti gli esoni combinati), si potrebbe potenzialmente trattare più del 90% dei pazienti DMD se esone skipping multipli usando cocktail farmaci antisenso può essere realizzato. Il cane X-linked distrofia muscolare (CXMD) modello di cane, il cui fenotipo è più simile a pazienti DMD umani, è stato utilizzato per testare la effic sistemicaACY e la sicurezza di multi-exon skipping degli esoni 6 e 8. modello cane Il CXMD ospita un sito di splice mutazione in introni 6, che porta ad una mancanza di esone 7 in distrofina mRNA. Per ripristinare la fase di lettura CXMD richiede multi-exon skipping degli esoni 6 e 8; Pertanto, CXMD è un buon modello animale di medie dimensioni per testare l'efficacia e la sicurezza di multi-exon skipping. In questo studio, un cocktail di Morpholinos antisenso di targeting esone 6 e esone 8 è stato progettato e restaurare l'espressione della distrofina nei muscoli scheletrici wide-body. Metodi di trasfezione / iniezione di oligonucleotidi cocktail e valutazione dell'efficacia e della sicurezza di multi-exon skipping nel modello cane CXMD sono presentati.

Introduction

Distrofia muscolare di Duchenne (DMD) è una malattia muscolare recessiva X-linked caratterizzata da debolezza muscolare progressiva, in primo luogo descritto dal Dr. Guillaume-Benjamin-Amand Duchenne (de Boulogne) 1. DMD è una malattia genetica comune che colpisce circa 1 bambino su 3500 in tutto il mondo, con circa 20.000 bambini affetti nati ogni anno 2,3. Lo sviluppo del motore è in ritardo e disturbi dell'andatura sono visti nella prima infanzia 4, seguita da dipendenza sedia a rotelle sui primi anni dell'adolescenza. La morte si verifica in genere tra i 20 e 30 a causa di insufficienza respiratoria o cardiaca 5-8 tra. Non vi è attualmente alcuna cura per la DMD. Il trattamento con glucocorticoidi può rallentare la progressione della degenerazione muscolare in una certa misura, ma è associato a significativi effetti collaterali, tra cui obesità e diabete mellito 2,7,8. DMD deriva da mutazioni nel gene della distrofina (DMD), portando ad una perdita di Protei distrofina funzionalen. DMD è estremamente un grande gene con oltre 2 milioni di coppie di basi e 79 esoni 9,10. La cancellazione, senza senso, e duplicazione mutazioni che portano alla out-of-frame mutazioni sono la causa più comune del fenotipo DMD. Le regioni di esoni 3 - 9 e esoni 45 - 55 sono denominate "mutazione hotspots", come la maggior parte dei pazienti hanno mutazioni per delezione all'interno di queste porzioni del gene, portando a distrofina non funzionale in pazienti DMD 3,9,11-16. funzioni distrofina all'interno del complesso distrofina-glicoproteina (DGC), che ha un ruolo importante nella stabilizzazione della membrana muscolare. La N- e C-terminali sono i domini più importanti per la funzione, mentre il dominio asta centrale svolge un ruolo meno importante 3,9,17. L'osservanza di un fenotipo lieve associato con distrofia muscolare di Becker (BMD), che si traduce per lo più da mutazioni in-frame all'interno del gene DMD, ha ispirato l'applicazione di esone skipping per il trattamento di DMD. pazienti BMD hanno un ridotto, ma functional, la proteina distrofina che mantiene sia termini 3,6,18. Exon skipping, in teoria, in grado di ripristinare il quadro di lettura, con conseguente proteine ​​distrofina funzionali accorciato, ma-simili a quelli visti in BMD 3,19.

Diversi tipi di oligonucleotidi antisenso (AONs) sono stati testati in studi clinici, tra cui fosforotioati 2'O-metilata (2'OMePS) e oligomeri phosphorodiamidate morpholino (PMO). Saltare esoni 51 e 53 che utilizzano questi AONs è stato esaminato e mentre i risultati sono promettenti, single-exon skipping ha limitato l'applicabilità, in quanto è di 3, 19, 20,21, 22-26 specifiche mutazione. Le domande rimangono anche sulla stabilità delle proteine ​​distrofina accorciati derivanti prodotte da single-esone skipping 22,23. Inoltre, alcuni pazienti richiedono più di un singolo esone da saltare per ripristinare il quadro di lettura 3. Anche se tecnicamente più difficile, multi-exon skipping è un metodo chepotrebbe affrontare questi problemi 3,19. Multi-exon skipping è stato precedentemente dimostrato nel cane distrofici e linee di cellule umane in vitro. Inoltre, mdx52 X-linked modelli cane topo e canino distrofia muscolare (CXMD) sono stati utilizzati per studi in vivo 22, 24-27. Canine distrofia muscolare legata al cromosoma X Japan (CXMD J) beagle sono stati utilizzati qui, come il quadro di lettura di CXMD J può essere ripristinato da Multi-exon skipping degli esoni 6 e 8, o esoni aggiuntivi (ad esempio, esoni 3-9) (Figura 1). Beagle-based CXMD condivide lo stesso schema mutazione come il modello Golden Retriever distrofia muscolare (GRMD), ma beagles sono più piccoli e meno costosi da mantenere a causa della loro dimensione del corpo, fornendo così un utile modello per DMD 28,29. Cani CXMD più da vicino imitare il fenotipo DMD umana rispetto ai modelli animali più piccoli, come roditori, e sono più affidabili per le valutazioni tossicologiche 3,22,30,31 (Figura 2). cani CXMD mostrano progressivo decadimento muscolare, disturbi della deambulazione, e problemi cardiaci e respiratori simili a quelli osservati in DMD. Rispetto al singolo-exon skipping, multi-exon skipping è applicabile a una percentuale molto maggiore di pazienti. Tra i tre tipi di mutazioni più comuni (delezioni, senza senso, e duplicazioni), 80-98% dei pazienti potrebbe essere trattata con multi-esone skipping 14,32,33, mentre il 45% di tutti i pazienti DMD potrebbe trarre vantaggio da esoni specificamente saltare 45 - 55 3,19,22,34.

Con lo sviluppo della morpholinos modificati, l'efficienza di cocktail AON a facilitare skipping esone è migliorata. Arginina-ricchi PMOs peptide coniugato cellule penetrante (PPMOs), e vivo-Morpholinos (vPMOs) sono chimiche AON che hanno notevolmente migliorato la capacità e la stabilità 3,35-38 cellula-penetrante. Le preoccupazioni rimangono circa la tossicità AON a lungo termine; Tuttavia, i progressi significativiè stato fatto. Modificazioni chimiche apportate al Morpholinos ridurre notevolmente gli effetti off-target e studi pre-clinici hanno riportato effetti tossici significativi 3,22,39,40. Una sfida rimanente per multi-esone skipping è il requisito corrente per ogni singolo AON da testare per la tossicità da solo, come un singolo farmaco, anziché insieme come un cocktail 3,19,22,41,42. In studi DMD che coinvolgono sia singolo e multi-esone skipping mirato al cuore, c'è stato un piccolo miglioramento nel tessuto cardiaco distrofici. L'efficacia di Morpholinos nel cuore è pensato per essere bassa a causa della scarsa capacità delle cellule-penetrante. PPMOs peptide coniugato hanno migliorato la capacità di AONs di penetrare cellule cardiache, aumentando la quantità di proteina distrofina funzionale salvato nel cuore 3,19,38.

Qui, il nostro approccio cocktail AON è discusso a lungo, compresa la progettazione di sequenze AON utilizzando il software ESEfinder 43. ProtoCOLS per esperimenti di cani con multi-exon skipping sono anche descritti. CXMD J beagles sono stati utilizzati per esoni 6 e 8 esperimenti saltare. Multi-esone skipping nel modello cane CXMD mostra risultati promettenti, ma le sfide restano che devono essere superate prima che siano clinicamente applicabile.

Protocol

Tutti i protocolli elencati di seguito sono in conformità con le linee guida per la cura degli animali stabilite dal Centro Nazionale di Neurologia e Psichiatria (NCNP) in Giappone. Tutti gli esperimenti sono stati approvati dal Comitato di Cura e uso istituzionale degli animali del NCNP.

1. Progettazione di antisenso Oligos

  1. Utilizzare ESE di soccorso e programmi ESEfinder per rilevare siti ESE 44, 45-47.
  2. Progettazione 25 coppie di basi (bp) sequenze che sono antisenso per esoni che devono essere mirati. Esoni target 6 e 8 del modello cane (Figura 1).
    1. Usare 25 - 30 sequenze di BP per PMO (Tabella 1) o 25 bp per 2'OMePS. Per progettare le sequenze 25 bp, selezionare le sequenze che si trovano all'interno della regione di destinazione. Considerate struttura secondaria, di evitare di eterodimeri, motivi enhancer esone splicing, e il contenuto GC per creare sequenze stabili 43. AONs dovrebbero target almeno uno dei siti ESE individuati dal suddetto software.
    2. Selezionare i AONs con un contenuto di GC che è inferiore al 65%, con meno di 4 G, e non contengono sequenze auto-complementare consecutivi. Utilizzare il software Blast NCBI per prevedere i siti di ricottura fuori bersaglio 22,48,49.
  3. Selezionare un appropriato AON spina dorsale chimica. Per gli esperimenti in vitro utilizzare oligonucleotidi 2'O-metile (2'OMePS) o Morpholinos. Per gli esperimenti in vivo, utilizzare 2'OMePS, Morpholinos o vPMOs. 3,19,48,50

2. Gli esperimenti in vitro (esoni 6 e 8 Salto nel Modello CXMD)

  1. 2'OMePS trasfezione di mioblasti Dog
    1. Cultura mioblasti CXMD in 3 ml di terreno di coltura a 6 pozzetti. Seme: 1 - 5 x 10 3 cellule / cm 2 con 0,5 ml / cm 2 di media per mioblasti. Per il terreno di coltura, usare modificato medie Dulbecco di Eagle (DMEM) con siero fetale bovino al 10% (FBS) e 1%la penicillina / streptomicina (P / S) 40.
    2. Incubare a 37 ° C fino a 60 - 80% confluenti. Questa operazione richiede circa 12 a 24 ore.
    3. Diluire un agente liposomiale transfecting cationico per un totale di 100 ml in media siero ridotto (2: agente transfecting 1 ratio: AONs, ad esempio, 10 ml Lipofectin vs 5 mcg AONs). Lasciare miscela a riposo a temperatura ambiente per 30 - 45 min.
    4. Diluire AONs (2'OMePS o morpholinos) ad un volume finale di 100 microlitri di mezzo siero ridotto.
    5. Unire l'agente transfecting diluito con AONs diluite e incubare a temperatura ambiente per 10 - 15 minuti.
    6. Mentre la miscela agente trasfezione / AON è seduto a temperatura ambiente, rimuovere i vecchi supporti dalle cellule tramite aspirazione e lavare le cellule con i media.
    7. Aggiungere 0,8 ml di mezzi di comunicazione per la miscela agente di trasfezione / AON e quindi aggiungere l'intera soluzione alle cellule appena lavate. Incubare per 3 ore a 37 ° C.
    8. Dopo l'incubazione, sostituire il supporto con differentiatmezzi di ioni (DM); differenziazione può richiedere fino a 10 giorni. Verificare se si è verificata una differenziazione a partire da circa il giorno 3. I mezzi di differenziazione è DMEM con il 2% siero di cavallo, 200 U / ml di penicillina, 200 mg / ml di streptomicina, e 10 mg / ml di insulina.
  2. Morpholino trasfezione di mioblasti Dog
    1. Cultura CXMD mioblasti in terreno di coltura come descritto al punto 2.1.
    2. Passa alla media di differenziazione (DM), e aggiungere 0,1 mM magazzino morfolino a ciascun pozzetto per rendere la concentrazione finale 1 micron. morpholinos cocktail di calore a 65 ° C per 10 min prima di trasfezione o iniezione per evitare AON aggregazione. Aggiungere un reagente di consegna peptide 39,51 e regolare ad una concentrazione finale da 3 - 6 ìm.
    3. Dopo 16-48 ore di incubazione, raccogliere le cellule per l'estrazione di RNA. Aggiungere 1 ml di acido guanidina tiocianato-fenolo-cloroformio alle cellule per staccare le cellule dalla piastra. Eseguire RNA 'estrazionezione dopo questo passaggio.
      1. In alternativa, aggiungere tripsina in modo da coprire tutte le cellule e incubare per 2 minuti a 37 ° C.
        Nota: se intenda eseguire immunochimica, usare occhiali di diapositive camerata per la coltura. Dopo differenziazione, le cellule possono essere fissate con paraformaldeide (PFA) (4% per 10 min).
  3. RNA Estrazione e trascrizione inversa della polimerasi Chain Reaction (RT-PCR)
    1. Una volta che le cellule si differenziano in miotubi, rimuovere medio e aggiungere 1 ml di acido guanidina tiocianato-fenolo-cloroformio; incubare per 10 minuti a RT.
    2. Trasferimento in provette da 1,5 ml. Combinate con 200 microlitri cloroformio e incubare a temperatura ambiente per 2 minuti fino a tre strati separati può essere visto. I tre strati dall'alto verso il basso sono: uno strato RNA, uno strato DNA, e uno strato di proteine.
    3. Centrifugare a 12.000 g per 15 minuti a 4 ° C. Rimuovere il surnatante strato superiore e mettere in un tubo con 500 & #181; l isopropanolo (se fermarsi qui, conservare il surnatante a -80 ° C). Centrifugare il surnatante a 12.000 xg per 10 min a 4 ° C; dopo centrifugazione, mantenere l'RNA a pellet risultante ed eliminare il surnatante.
    4. Lavare il pellet con etanolo e centrifugare a 8000 xg per 5 minuti a 4 ° C. Far evaporare l'etanolo residuo invertendo il tubo per 15 minuti e poi aggiungere 15 - 30 ml di acqua RNase-free. Quantificare la concentrazione totale di RNA utilizzando la spettroscopia US / VIS a 260 nm.
    5. Unire i reagenti necessari per una reazione di RT-PCR: 1,5 microlitri 10 micron di primer in avanti, 1,5 microlitri 10 micron di primer inverso, 1 ml dNTP, 5 ml di uno stadio kit per la PCR tampone, inibitore della RNasi 0,7 ml, 1 ml miscela di enzimi da one step kit per la PCR, e 200 ng di RNA. Una volta che questi sono stati mescolati, aggiungere acqua ad un volume finale di 25 microlitri.
    6. Mettere composto in una termo-cycler. Eseguire un ciclo di 30 min a 50 ° C, 15 min0; ciclo a 95 ° C, quindi 35 cicli di 94 ° C per 1 min, 60 ° C per 1 minuto, e 72 ° C per 1 min. Infine, eseguire un ciclo di 10 min a 72 ° C. Conservare prodotto di PCR in frigorifero a 4 ° C o -20 ° C
  4. DNA complementare (cDNA) Sequencing
    1. Identificare esone 6 - 9 bande-saltati con elettroforesi su gel di agarosio. Carico 5 microlitri di ciascun campione nei pozzetti di un gel di agarosio 1,5%, gestito 135 V attraverso il gel per 5 minuti, e poi 120 V per 20 min. Successivamente, incubare il gel in gel DNA macchia a temperatura ambiente per 30 min. Visualizzare le bande che utilizzano software di imaging.
    2. Accise L'banda di interesse utilizzando un kit di estrazione gel.
      1. Asportare il frammento di DNA e solubilizzare la fetta gel con 200 ml NTI / 100 mg di gel. Sia questo riposare per 5 a 10 minuti in un bagno d'acqua a 50 ° C. Poi il trasferimento alla silice tubo membrana.
      2. Centrifugare a 11.000 xg per 30 sec. Lavare due volte con 700 microlitri di buffer NT3 prima centrifuging nuovamente a 11.000 xg per 30 sec.
      3. Essiccare la membrana di silice per centrifugazione a 11.000 xg per 1 min.
      4. Aggiungere 15 - tampone NE 30 microlitri e lasciare riposare a temperatura ambiente per 1 min. Poi, centrifugare a 11.000 xg per 1 min. Rimuovere il gel di silice e mantenere il contenuto nel tubo.
    3. Utilizzare un kit di sequenziamento per determinare la sequenza secondo il protocollo del produttore.

3. intramuscolari iniezioni o aperto muscolare Biopsia

  1. Per la manutenzione delle condizioni di sterilità durante l'intervento chirurgico la sopravvivenza, rimuovere i capelli utilizzando Clippers nella zona circostante il sito chirurgico (l'arto posteriore). Utilizzare iodofori o clorexidina come disinfettante. Utilizzare teli sterili per il sito chirurgico, inserendo e fissandoli sull'intera animale e il tavolo operatorio.
    1. Indossare scrub pulite, maschere, copricapo, guanti sterili, e scarpe speciali per la sala operatoria 52,53.
    2. </ Ol>
    3. Iniettare cani CXMD con 20 mg / kg di tiopentale sodico per anestetizzare loro. Utilizzare veterinario pomata sugli occhi per evitare che gli occhi si secchi.
    4. Utilizzare 2 - 3% inalazione isoflurano per mantenere l'anestesia generale (figura 3). Controllare riflessi muscolari e monitorare il cuore e la frequenza respiratoria per valutare la profondità dell'anestesia. Il tasso normale di respirazione (RR), la frequenza cardiaca (HR), e SpO 2 in anestesia generale sono i seguenti: RR: 10 - 20 respiri / min; SpO 2: 95-100%, HR: 80 - 120 battiti al minuto (bpm).
    5. Usando un bisturi, tagliare la pelle sopra il tibiale craniale (CT), noto anche come il tibiale anteriore (TA), e fare un unico taglio circa 5 cm in senso longitudinale (per i giovani cani adulti). Per contrassegnare i siti di iniezione, cucire la fascia profonda utilizzando un ago chirurgico e filo chirurgico e fare due marcatori punto ad intervalli di 2 cm.
    6. Iniettare la concentrazione desiderata di AONs nel muscolo con un ago 27 G. La concen desideratozione varia tra condizioni di trattamento. Per CT, dare due iniezioni di 1 volume ml ciascuna, per un totale di 1,2 mg di PMO cocktail (0,4 mg ogni PMO) o 0,4 mg di vPMOs cocktail (0,13 mg ogni vPMO). Per il muscolo zampa anteriore estensore ulnare del carpo (ECU), iniettare due volumi da 0,5 ml ciascuna, per un totale di 1,2 mg di PMO cocktail (0,4 mg ogni PMO) o 0,4 mg di vPMOs cocktail (0,13 mg ogni vPMO). Lasciare l'ago in per 1 min. Utilizzare una quantità uguale di ogni AON per il cocktail.
    7. Eseguire aperto biopsia muscolare, eliminando un pezzo di tessuto muscolare di circa 2 cm di lunghezza dal muscolo CT utilizzando un bisturi chirurgico.
    8. Passare al punto 6.5 per la preparazione del campione muscolare.
    9. Utilizzando un ago, somministrare una iniezione intramuscolare di 0,02 mg / kg buprenorfina cloridrato prima del risveglio dall'anestesia generale. Lay fascia muscolare e la pelle indietro sopra il muscolo e ricamare questi utilizzando un filo 3-0 filo assorbibile e 3-0 in nylon per fascia muscolare e la chiusura della pelle, respectively.
    10. Mentre si tiene la bocca aperta, determinare se il riflesso del vomito è tornato; quando il riflesso del vomito è tornato, estubare il cane.
    11. Somministrare 15 a 30 mg / kg cefazolina o cefalexina (antibiotici) per un massimo di 3 giorni via iniezione endovenosa o intramuscolare per prevenire l'infezione.
    12. Rimuovere suture entro sette giorni. Non lasciare il cane incustodito fino a quando non ha ripreso conoscenza sufficiente a mantenere decubito sternale e non permettere al cane di interagire con altri animali fino a quando viene fatto un recupero completo. Mantenere i tubi endotracheali in luogo più a lungo possibile e rimuoverli quando l'animale comincia a masticare o deglutire. Monitorare la frequenza cardiaca, la respirazione e l'idratazione degli animali per assicurarsi che essi sono stabili e nei limiti della norma.
    13. Per la cura post-operatorio, fornire l'analgesia per 3 giorni (per esempio, buprenorfina 0,01 mg / kg) e il supporto di cura, tra cui un posto tranquillo, scuro di riposo, ferita e manutenzione adeguati benda, un morbidopiano di appoggio, reidratazione con liquidi per via orale o parenterale, e un ritorno alla normale alimentazione attraverso l'uso di alimenti altamente appetibile o tratta. Se tutti gli animali richiedono il farmaco aggiuntivo, dare una iniezione intramuscolare di 0,3 mg / kg di butorfanolo tartrato a seconda dei sintomi di dolore.
      Nota: Cani nel dolore possono mordere, graffiare, o guardia regioni dolorose, e se maneggiato, possono essere particolarmente apprensivi o aggressivo. Inoltre, dolore in un arto solito si traduce in zoppicante o la detenzione-up dell'arto interessato con i tentativi di usarlo. In tali situazioni, dare una iniezione intramuscolare di 0,02 mg / kg di buprenorfina cloridrato ogni 6-8 h.

    4. Iniezioni sistemiche

    Nota: Questa procedura può essere ripetuta settimanale o bisettimanale per il numero desiderato di settimane.

    1. Trattenere i cani manualmente e delicatamente ottenendo il cane a sdraiarsi e poi drappo braccia sulle spalle e fianchi per tenere il cane in luogo per tutta tProcedura di lui.
    2. Iniettare AONs; 120 - PMOs 240 mg / kg cocktail (40 - 80 mg ogni AON) utilizzando un ago venoso a permanenza in vena arto (noto come cefalica o una vena safena). La quantità di AON iniettato dipende dalle condizioni sperimentali. Utilizzare una quantità uguale di ogni AON per il cocktail.
    3. Utilizzare una pompa per infusione o un driver siringa per iniettare 50 ml totale ad una velocità di 2,5 ml / min per 20 minuti, seguendo le istruzioni del produttore. Ripetere l'iniezione settimanale o bisettimanale (ogni due settimane) per almeno 5 volte, come espressione della distrofina si accumulerà con iniezioni ripetute.
    4. Effettuare esami del sangue ogni settimana per esaminare la tossicità.
      1. Utilizzando un ago, raccogliere 3 ml di sangue - 0,5 ml per emocromo completo (CBC) e 2,5 ml per gli altri - da una delle vene sottocutanee di primo piano o di arti posteriori. Include CBC, gamma-glutamil transferasi (GGT), aspartato aminotransferasi (AST), azoto ureico nel sangue (BUN), aminotra alaninansferase (ALT), creatina chinasi (CK), e la valutazione di creatinina durante il test del sangue raccolto, seguendo le istruzioni del produttore di kit per il test del sangue. 40,54

    5. classificazione clinica di cani

    1. Impostare una videocamera e registrare il comportamento del cane e l'andatura. Registrare l'intero incontro con il cane come questo agirà come riferimento quando la classificazione del cane; questo significa che ogni video sarà una lunghezza diversa a seconda delle capacità e la volontà del cane. Utilizzare parametri di registrazione di default. Le riprese crea un record della classificazione in modo che possa essere rivisto in un secondo momento.
    2. Grade andatura e movimento disturbi.
      1. Per andatura e movimento disturbi, utilizzare i seguenti gradi:
        grado 1 = nessuno, grado 2 = seduto con arti posteriori esteso, grado 3 = bunny-luppolo con arti posteriori, grado 4 = passeggiata mischiare e grado 5 = in grado di camminare.
      2. Per la mobilità disturbo, utilizzare i seguenti gradi: grado 1 = nessuno, grade 2 = sdraiati più del normale, grado 3 = non può saltare su arti posteriori, grado 4 = crescenti difficoltà a muoversi in giro, e di grado 5 = in grado di alzarsi e muoversi.
    3. Ora quanto tempo ci vuole il cane a correre 15 m. Misurare 15 m, posizionare il cane sulla linea di partenza e incoraggiarla a correre fino a quando il segno di 15 m.
    4. Determinare atrofia muscolare dell'arto utilizzando la seguente scala di valutazione:
      grado 1 = nessuno, grado 2 = durezza sospetto, grado 3 = può sentire la durezza o appare sottile, di grado 4 = tra gradi 3 e 5, e di grado 5 = estremamente sottile o difficile.
    5. Grado sbavando utilizzando la seguente scala: grado 1 = nessuno, grado 2 = affare di tanto in tanto saliva quando si è seduti, grado 3 = qualche bava quando mangiare e bere, grado 4 = stringhe di bava quando mangiare o bere, e di grado 5 = bava continua.
    6. Grado l'ipertrofia della lingua (macroglossia) utilizzando la seguente scala: grado 1 = nessuno, grado 2 = leggermente allargata, grado 3 = outsi estesade dentizione, grado 4 = allargata e leggermente ispessita e grado 5 = allargata e addensato.
    7. Grade la capacità del cane a ingoiare utilizzando la seguente scala: grado 1 = nessuna difficoltà, di grado 2 = richiede tempo e fatica a prendere il cibo, grado 3 = difficoltà a prendere il cibo da un piatto, grado 4 = difficoltà di masticazione, deglutizione, o bere e grado 5 = in grado di mangiare.
    8. Calcolare grade totale sommando i punteggi di ciascuna categoria (tranne per il test di funzionamento 15 m) 55.
      Nota: Gli studi dovrebbero essere accecati in modo da non introdurre bias.

    6. risonanza magnetica (MRI)

    1. Utilizzare un 3 Tesla (3T) MRI e 18 cm di diametro / 18 cm di lunghezza bobina estremità umano per ottenere immagini pesate in T2 di arti posteriori.
    2. Anestetizzare gli animali iniettando cani CXMD con 20 mg / kg di tiopentale. Utilizzare veterinario pomata sugli occhi per evitare che gli occhi si secchi. Utilizzare 2-3% inalazione isoflurano per mantenere l'anestesia generale.
      1. Controllare riflessi muscolari e monitorare il cuore e la frequenza respiratoria per valutare la profondità dell'anestesia. Il tasso normale di respirazione (RR), la frequenza cardiaca (HR) e SpO 2 in anestesia generale sono i seguenti: RR: 10 - 20 respiri / min, SpO 2: 95-100%, HR: 80 - 120 battiti al minuto (bpm ).
    3. Utilizzare le seguenti impostazioni per ottenere immagini pesate in T2: TR / TE = 4,000 / 85 msec, spessore della fetta = 6 mm, fetta gap = 0 mm, campo di vista = 18 cm x 18 cm, dimensione della matrice = 256 x 256, e numero di acquisizioni = 3 in fase di spin echo veloce (Figura 4).

    7. muscolare campionamento e la preparazione (Necropsy)

    Nota: I muscoli devono essere campionati una o due settimane dopo l'ultima iniezione AON.

    1. Iniettare cani con 20 mg / kg di tiopentale sodico per anestetizzare loro. Utilizzare veterinario pomata per gli occhi durante l'anestesia per evitare l'essiccazione degli occhi.
    2. Utilizzare 2 - 3% inalazione isoflurano per mantenere AnesThesia. Controllare riflessi muscolari e monitorare il cuore e la frequenza respiratoria per valutare la profondità dell'anestesia. Il tasso normale di respirazione (RR), la frequenza cardiaca (HR) e SpO 2 in anestesia generale sono i seguenti: RR: 10 - 20 respiri / min; SpO 2: 95-100%, HR: 80-120 bpm.
      1. Euthanize cani per dissanguamento in anestesia generale (per necroscopia solo). Utilizzare dissanguamento in anestesia generale profondi per evitare gli effetti provocati da fattori derivati ​​dal sangue nell'analisi molecolare (ad esempio, muscoli cardiaci).
    3. Sezionare i seguenti muscoli (Figura 5): CT, estensore lungo delle dita (EDL), femorale gastrocnemio, soleo, del bicipite femorale, retto, bicipite brachiale, tricipiti brachiale, deltoide, ECU, estensore radiale del carpo (ECR), flessore ulnare del carpo (FCU ), flessore radiale del carpo (CFR), gracile, intercostali, muscoli addominali, diaframma, dorsi laterali, esofago, sternocleidomastoideo, e il cuore. Per esaminare la tossicità, la raccolta dei reni e licampioni ver. Usa Evans e Alexander de Lahunta (2009) come punto di riferimento per la tecnica di dissezione 56.
    4. Tagliare il CT, EDL, gastrocnemio, soleo, del bicipite femorale, retto femorale, bicipite brachiale, tricipite brachiale, deltoide, ECU, ECR, FCU, FCR, gracile, intercostali, i muscoli addominali, dorsi laterali, esofago, sternocleidomastoideo, cuore, rene, e il fegato in piccole sezioni ca. 1 - 1,5 cm di lunghezza. Arrotolare il diaframma e poi tagliarla in 1 - 1,5 cm sezioni 56.
    5. Posizionare adragante in modo che sia di circa 0,5 - 1 cm di spessore su dischi di sughero. dischi etichette con l'identificazione e muscolare nome dell'animale sul lato opposto della gomma adragante.
    6. Posizionare muscoli con il loro asse longitudinale perpendicolare al sughero nel gomma adragante.
    7. Posizionare i tappi in un contenitore di isopentano che è seduto in azoto liquido. Spostarla costantemente con le pinzette per 1 minuto o fino a quando completamente congelato. muscoli Negozio su tappi di sugheroin fiale a -80 ° C. Durante il trasporto, messo fiale in ghiaccio secco.
    8. Preparare vetrini etichettati con animali nome di identificazione / muscolare e la data.
    9. In un criostato raffreddata a -25 ° C, montare il tappo al supporto. Impostare lo spessore di taglio al livello desiderato. Utilizzare 8 micron per immunoistochimica e 12 micron per ematossilina ed eosina (HE) colorazione. Utilizzare 15 micron per i campioni Western Blot. Trim circa un quarto del muscolo per ottenere un muscolo piatto per una corretta campionamento muscolare.
    10. Taglio una sezione del muscolo alla volta, posizionare ogni sezione 6 ° sullo stesso vetrino se state programmando di usare campioni per immunoistochimica o HE colorazione. Se si utilizza campioni per Western blot, mettere 30 - 40 sezioni in un tubo e conservare a -80 ° C.
    11. Dopo la preparazione dei vetrini, lasciate asciugare per diapositive 1,5 ore a temperatura ambiente. Conservare scivola a -80 ° C.

    8. immunoistochimica

    1. Rimuovere vetrini preparati dallo stoccaggio e metterli inuna camera umida per mantenere i vetrini separati e mantenere l'umidità. Riempire la camera di umidità in modo che il fondo sia appena coperto con acqua (circa 1 mm di acqua).
    2. Aria secca per 0,5 ore. Disegnare un quadrato che racchiude il campione del muscolo sul vetrino utilizzando una penna barriera idrofoba.
    3. Aggiungere 15% di siero di capra in tampone fosfato salino (PBS) e incubare per 2 ore a temperatura ambiente in blocco reagente.
    4. Aggiungere dominio anti-distrofina rod (DYS-1) del mouse anticorpo monoclonale primario, o anticorpo monoclonale C-terminale (DYS-2) per il cane distrofina colorazione (1: 150 diluizione). Diluire con un agente bloccante in 1,25 ml di PBS. Incubare O / N in frigorifero a 4 ° C.
    5. Lavare con PBS per 5 minuti, ripetuto tre volte. Aggiungere anticorpo secondario Alexa anticorpi 594 di capra contro IgG1 del mouse (per DYS-2) o IgG2 (per DYS-1) (1: 2.500). Diluire con un reagente di blocco in PBS contenente 0,1% ottil fenolo etossilato. Incubare per 0,5 ore a temperatura ambiente.
    6. Lavare con PBS per 5 minuti, tre tIME. Lasciare scivolo asciugare. Aggiungere 1 - 2 gocce (3 ng / ml) di 4 ', 6-diamidino-2-fenilindolo (DAPI) soluzione di montaggio. Usando le pinzette, posizionare una scivolata di vetro sopra la parte superiore delle sezioni, evitando le bolle.
    7. Vista dystrophin- (DYS-1 / DYS-2) fibre positive sotto un microscopio a fluorescenza a 594 nm a 20X di ingrandimento.

    9. Western Blotting

    1. Aggiungere sezioni muscolari raccolti da Cryo-sezionamento a 150 ml di tampone campione sul ghiaccio.
    2. Utilizzando un omogeneizzatore mano, omogeneizzare brevemente i campioni di proteine. campioni di calore in una provetta da 1,5 ml in un incubatore piastra riscaldante a 95 ° C per 3 - 5 min. Centrifugare a 16.500 g per 15 minuti e raccogliere il surnatante.
    3. Conservare aliquote del surnatante a -70 ° C. Utilizzare acqua distillata per diluire a 100x.
    4. Determinare la concentrazione di proteine ​​usando un kit commerciale secondo il protocollo del produttore. Aggiungere 2x tampone Laemmli SDS-caricamento di campioni e di calore per 3 min &# 160; a 95 ° C.
    5. Caricare i campioni in 3-8% gel Tris-acetato prima di eseguirlo per 3 ore a 150 V. includere diversi campioni diluiti wild-type (WT) (ad esempio, 1%, 10% e 50%) per la quantificazione. Meno dell'1% i livelli di distrofina WT devono essere rilevati con questo metodo.
    6. Porre il gel in tampone catodo per 20 min. Durante questo tempo, prendere nove pezzi di carta filtro e metterli nei buffer di trasferimento (3 carte nel buffer di catodo [+], il buffer anodo ([-], e il buffer dell'anodo concentrato [-], rispettivamente) Questo. descrive un metodo di trasferimento semi-dry che aumenta la sensibilità (Figura 6).
    7. Immergere una membrana PVDF in metanolo per 20 sec e poi posto nel buffer di anodo.
      Impostare il gel con la membrana per il trasferimento semi-dry e farlo girare 1,5 ore a 400 mA in RT o in una stanza fredda.
    8. Lavare la membrana con PBS. Incubare la membrana in una miscela di PBS con Tween 20 (PBST) e 5% di latte in polvere per 2 ore.
    9. Diluire DYS-1 (anticorpo primario) in PBST e 5% miscela di latte in polvere ad una diluizione 1: 100. Aggiungere alla membrana e lasciate incubare per almeno 1 ora. Lavare tre volte con 100 ml PBST per 15 minuti ciascuno.
    10. Aggiungere 65 ml / corsia di HRP anticorpo secondario coniugato (anti-topo IgG2a per DYS1) a 1: 5000 diluizione per 1 ora a temperatura ambiente in una zona scura. Poi, lavare con tre volte con 200 ml PBST per 20 min. Mescolare le soluzioni da un kit di rilevamento come diretto. Incubare per 1 min.
    11. Sviluppare pellicola per rilevare le bande e analizzare con il software ImageJ 48,57,58.

Representative Results

Esperimenti in vitro

Mioblasti sono state trasfettate con diverse condizioni di trattamento 2'OMePS al fine di confrontare l'efficacia di ogni AON. Trattamenti singoli AON con 600 Nm ciascuno dei Ex6A, Ex6B, Ex8A, o Ex8B sono state fatte, così come un trattamento cocktail con 600 Nm ciascuno di tutte e 4 le sequenze di AON. campioni di RNA sono stati raccolti quattro giorni dopo la trasfezione. Dopo RT-PCR, campioni per ogni trattamento sono stati analizzati su un gel insieme campioni (NT) non trattati. Bande superiori sul gel rappresentano out-of-frame DMD prodotti; queste bande sono stati osservati in NT, Ex8A, e Ex8B mioblasti trattati. Ex6A, Ex6B, Ex8A, ei mioblasti cocktail-trattati hanno mostrato i prodotti in-frame. Il cocktail e Ex6A / B hanno mostrato 100% prodotti in-frame, mentre Ex8A ha mostrato solo il 30% dei prodotti in-frame (Figura 7). Per confermare exon skipping e restauro dila cornice di lettura, è stata eseguita cDNA sequenziazione; i risultati indicano che esoni 6 - 9 erano effettivamente stati saltati (Figura 7). L'immunoistochimica ha dimostrato che i cani AON-trattati erano aumentate fibre distrofina-positive rispetto ai campioni NT (Figura 8).

In esperimenti in vivo

Per confrontare l'efficienza di diverse condizioni di trattamento AON, cani CXMD (0,5 - 5 anni) sono stati iniettati una volta con 1,2 mg Ex6A o un cocktail di Ex6A, Ex6B, e Ex8A a vari dosaggi. Due settimane dopo l'iniezione, campioni di muscolo sono stati raccolti e colorati con DYS-1 per confrontare il numero di fibre distrofina-positive. Tutti i campioni cocktail-trattati hanno mostrato un aumento dell'espressione della distrofina rispetto ai campioni NT. Fibre distrofina-positivi aumentava con AON dosaggio (Figura 9). A seguito di sistemainiezione ic, wild-type (WT), NT, e campioni di muscolo CXMD cocktail trattate sono state colorate con DYS-1 (Figura 10). Cocktail-trattati cani CXMD hanno mostrato un aumento dell'espressione della distrofina rispetto ai cani NT CXMD, sia in CT e campioni di muscolo cardiaco. Tuttavia, AON trattati muscolo scheletrico (CT) ha mostrato molto più elevata espressione di distrofina rispetto al muscolo cardiaco trattato. Un immunoblot confrontando WT, NT, e vari morpholino muscoli cocktail-trattati ha portato alla stessa conclusione. C'era anche una vasta gamma di distrofina espressione nei campioni di muscolo scheletrico trattate (Figura 10). Ematossilina e eosina (HE) colorazione rivelato che trattata CXMD cani hanno mostrato una migliore istopatologia, con una significativa diminuzione delle fibre in posizione centrale-nucleate (CNF) rispetto ai cani NT CXMD (Figura 11). Questo indica non vi è più la degenerazione / rigenerazione che si verificano nel cane NT, un segno di patologia muscolo distrofico. Inoltre, cani trattati hanno avuto più velocetempi di esecuzione ei punteggi migliorati sulla scala di valutazione clinica. Cani CXMD trattati hanno mostrato punteggi migliori di cani NT CXMD in tutte le categorie (Figura 12).

Figura 1
Figura 1. La mutazione del modello del cane CXMD e esoni 6 -. 8 Strategie Skipping Utilizzando un cocktail antisenso cani CXMD hanno una mutazione puntiforme nell'esone 6 che conduce ad una perdita dell'esone 7 nel cane distrofici mRNA. Ciò comporta l'mRNA essere fuori-di-frame e la produzione della proteina distrofina è perduto. Brevi sequenze AON sono progettate per legarsi a esone 6 e 8, che si traduce in mRNA splicing saltare efficacemente esoni 6 - 8. La barra grigia nelle AON cani cocktail-trattata rappresenta brevi sequenze AON. Exon 9 codifica un dominio cerniera ed è a volte spontaneamente impiombato con AONs contro esone 6 e 8. I codici di mRNA che derivano per distrofina proteine ​​che sono più brevi, ma la funzioneal. Clicca qui per vedere una versione più grande di questa figura.

figura 2
Sono mostrati Figura 2. I principali sintomi clinici di una 1-year-old animali Canine collegata a X distrofia muscolare (CXMD). A 1-year-old wild-type beagle e un cane CXMD. Il coinvolgimento di prossimale, arti e muscoli temporali sono tipicamente osservato da 2 mesi di età. Contrattura comune e uno spostamento del bacino sono palesi dai 4 mesi di età. Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. L'anestesia generale per un cane. A) Intramusculiniezioni ar e biopsie muscolari vengono eseguiti in anestesia generale con isoflurano. B) Tenendo dell'animale per preparazioni iniettabili sistemici. Cliccate qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. risonanza magnetica (MRI) di Wild-tipo, non trattati CXMD, e trattati CXMD. Risonanza magnetica degli arti posteriori a 3 mesi e 5 mesi in WT e NT CXMD cani. sono mostrati due immagini campione di trattati CXMD posteriori degli arti risonanza magnetica pre (1 settimana prima della prima iniezione) e post-iniezione di AON. 2703MA è stato trattato settimanale 7x con 200 mg / kg Morpholinos cocktail. 2001MA è stato trattato con 5x IV iniezione settimanale di 120 mg / kg Morpholinos cocktail. Controllo e cani trattati sono stati pari età. cani trattati mostrano diminuite segnali T2. Le immagini sono adap Ted con il permesso di Yokota et al. (copyright 2009, John Wiley & Sons) 40 Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5. muscolare procedura di biopsia per un cane. A) un arto inferiore è fissato per la biopsia muscolare. B) Con l'aiuto di pinze, dell'arto inferiore si svolge. C) Il muscolo CT è esposto. tecnica aperta biopsia viene utilizzato per ottenere campioni di muscolo di siti iniettati. Le discussioni sono utilizzati per contenere campioni di biopsia. Campioni D) muscolosi in gomma adragante dopo la dissezione. Cliccate qui per vedere una versione più grande di questa figura.

/53776/53776fig6.jpg "/>
Figura 6. semisecco metodo di trasferimento. Una rappresentazione del metodo di trasferimento semi-secco per Western blotting è presentato. Tre giornali imbevuti di buffer di anodo concentrato sono fissate al terminale negativo; 3 carte imbevuti di buffer di anodo sono accatastati in cima a questa. La carta Mb PVDF è intriso di metanolo e poi tampone anodo prima di essere posto sulla parte superiore delle 6 carte. Il gel, che è stato immerso in tampone catodo, viene posato dolcemente sul foglio PVDF. Infine, 3 carte imbevute di tampone di catodo sono disposti sulla parte superiore del gel. Il terminale positivo è impostato sulla parte superiore. Per 1 ora, 400 mA è gestito attraverso il sistema. Fai clic qui per vedere una versione più grande di questa figura.

Figura 7
Figura 7. Exon skipping in CXMD mioblasti. et al. (Copyright 2009, John Wiley & Sons) 40. Cliccate qui per vedere una versione più grande di questa figura.

Figura 8
Figura 8. Aumento Dystrophin espressione in 2'O-metilati fosforotioato (2'OMePS) trasfettate CXMD mioblasti. mioblasti CXMD sono state trasfettate con il solo Ex6A o con 2'OMePS cocktail. DYS-2 (rosso) e DAPI (blu) colorazione sono mostrati. I mioblasti trattati vengono confrontati con wild-type (WT) e mioblasti non trattati (NT). Le immagini vengono adattate con il permesso di Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 50 micron. Cliccate qui per vedere una versione più grande di questa figura.

Figura 9
Figura 9. Salvataggio di distrofina espressione con intramuscolare iniezioni di Morpholinos nel solo CXMD cani. Sia Ex6A o un cocktail di Ex6A, Ex6B, e Ex8A sono stati iniettati nei muscoli CT di cani CXMD. Distrofina (DSY-1) colorazione di wild-type(WT), non-trattati (NT), e cani CXMD trattati sono mostrati. I cani sono stati trattati con 1,2 mg da solo Ex6A o 1,2 mg cocktail. Le immagini vengono adattate con il permesso di Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 100 micron. Cliccate qui per vedere una versione più grande di questa figura.

Figura 10
Figura 10. aumento dell'espressione della distrofina Dopo sistemica Cocktail Morpholino trattamento in CXMD cani. Distrofina (DYS-1) colorazione è stato utilizzato per confrontare l'espressione della distrofina nel wild-type (WT) (controllo positivo), non trattato (NT) (controllo negativo), e cani CXMD trattati con 120 mg / kg morfolino cocktail (40 mg / kg di ogni AON). Il cocktail morfolino conteneva Ex6A, Ex6B, e Ex8A. I cani sono stati iniettati per via endovenosa 5 volte siamoekly con questo cocktail. A) Un confronto di espressione distrofina in tibiale craniale (CT) muscoli WT, NT e cani trattati. B) Un confronto di espressione della distrofina nel tessuto cardiaco tra il NT e morpholino cani cocktail-trattata. C) Immunoblot per distrofina con desmina come controllo di caricamento viene mostrato per WT, NT, e morpholino cani cocktail-trattata. I seguenti muscoli sono indicati per cani trattati: tricipite brachiale (TB), bicipite brachiale (BB), il diaframma (DIA), esofago (ESO), CT, adduttore (ADD), estensore lungo delle dita (EDL), massetere (MAS), e il cuore. Le immagini vengono adattate con il permesso di Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Bar = 200 micron. Cliccate qui per vedere una versione più grande di questa figura.

Figura 11
figura11. Miglioramento istopatologia in CXMD cani trattati per 7 settimane con 240 mg / kg Morpholino cocktail. Cani CXMD che vanno da un anno e mezzo a cinque anni sono state iniettate per via endovenosa con 240 mg / kg morfolino cocktail (Ex6A, Ex6B, e Ex8A) una volta al settimana per 7 settimane. Quattordici giorni dopo l'ultima iniezione, muscoli esofago sono state prese e ematossilina e eosina (HE) colorazione è stato fatto. HE colorazione dei muscoli dell'esofago da non trattato (NT) e morfolino cocktail-trattati (trattato) cani CXMD (40X lente obiettivo). Clicca qui per vedere una versione più grande di questa figura.

Figura 12
Figura 12. I punteggi migliorate sulla classificazione clinica e 15 m Durata Dopo cani Morpholino trattamento. Morpholino-trattati sono stati confrontati con non trattato-littermate (NT)S. Le barre di errore nel grafico indicano SEM. A) Punteggio totale per l'esame di classificazione clinica è stato calcolato prima e dopo il trattamento e animali trattati sono stati confrontati con i fratellini NT. B) Un confronto di 15 m tempi di esecuzione dei cani trattati e NT. C) simili a B; tuttavia, sono stati utilizzati cani più giovani. Le immagini vengono adattate con il permesso di Yokota et al. (Copyright 2009, John Wiley & Sons) 40. Cliccate qui per vedere una versione più grande di questa figura.

oligonucleotidi antisenso sequenza nucleotidica
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

Tabella 1. antisenso oligonucleotide Design.

Discussion

Exon skipping è una tecnica terapeutica promettente per il trattamento della DMD. Sia in vitro ed in vivo hanno dimostrato che il multi-esone skipping è fattibile. Qui, l'uso del modello del cane CXMD è discusso. In primo luogo, AONs sono stati progettati utilizzando i programmi di salvataggio-ESE e ESEfinder di indirizzare gli esoni distrofina 6 - 8. La chimica 2'OMePS AON è stato utilizzato per CXMD mioblasti trasfezione e la spina dorsale chimica morfolino AON è stato scelto per gli esperimenti in vivo. vPMOs sono più efficienti di PMOs non modificati, ma a causa della loro maggiore tossicità non sono adatti per iniezioni sistemiche. estrazione di RNA, RT-PCR, e cDNA sequenziamento sono state effettuate su mioblasti CXMD. I cani iniettati con il cocktail PMO erano clinicamente graduata per valutare un miglioramento dei sintomi clinici. Dopo che i cani sono stati umanamente eutanasia, campioni di muscolo sono stati prelevati e preparati per crio-sezionamento. L'emivita della proteina distrofina indotta da AOn è creduto di essere di circa 1 - 2 mesi. cani giovani adulti sono stati utilizzati in questo studio, anche se questi esperimenti può essere fatto con i cani neonatali e cani anziani (> 5 anni). Sezioni muscolari preparati sono stati utilizzati per valutare l'istopatologia e valutare salvataggio della proteina distrofina attraverso Western blotting ed immunoistochimica 48.

È importante garantire che il volume della soluzione PMO sia corretto prima iniezione; non riuscendo a farlo avrà effetti significativi sui risultati. Durante iniezioni intramuscolari, pressione sufficiente è necessario per entrare nelle fibre muscolari. Monitoraggio della salute del cane e l'ispezione del sito chirurgico sono importanti per la risoluzione dei problemi. Per monitorare la salute degli animali, gli esami del sangue settimanali e la pesatura devono essere eseguiti. Dopo euthanization dell'animale e preparazione dei campioni di muscolo, un passaggio critico per assicurare sensibilità nella rilevazione distrofina è di utilizzare sia il gel Tris-acetato e il metodo blotting semi-drydurante la procedura Western blotting.

Come mostrato nei risultati rappresentativi, mioblasti trattati con Ex6A, Ex6B, Ex8A, e il cocktail (contenente Ex6A, Ex6B, Ex8A, e Ex8B) prodotto in-frame DMD prodotti. Dal momento che Ex8B prodotto prodotti esone-saltato, non è stato utilizzato nei successivi esperimenti in vivo. cDNA sequenziamento ha dimostrato che esoni 6-9 salto si è verificato e immunocitochimica con DYS-2 ha mostrato colorazione restaurato espressione della distrofina nei campioni trattati. cani AON-trattati hanno mostrato un aumento significativo fibre distrofina-positive. Ciò indica che esoni 6-8 venivano saltati e una proteina accorciata è stato prodotto. La quantità di fibre distrofina-positive aumentata quando è stato usato un cocktail di AONs ed era proporzionale AON dosaggio. Immunoblot hanno mostrato un aumento dell'espressione della distrofina nei cani trattati con morpholino sistemici. Il muscolo scheletrico aveva livelli variabili di fibre distrofina; tuttavia, il tessuto cardiaco morfolino-trattati hanno mostrato pocomiglioramento dell'espressione della distrofina. Poiché distrofina ha un alto peso molecolare (427 kDa), rilevamento di piccole quantità di distrofina può essere difficile. Per i migliori risultati, sono stati usati gel Tris-acetato e il metodo di trasferimento semi-dry. HE macchiatura ha mostrato migliorato istopatologia nei cani morpholino-trattata. fibre in posizione centrale-nucleate (CNFs) sono un segno di muscolo malsano e rappresentano cicli di degenerazione muscolare e la rigenerazione. cani CXMD morfolino-trattati hanno mostrato una diminuzione della percentuale di CNFs rispetto ai cani CXMD non trattati. classificazione clinica ha rivelato un miglioramento dei sintomi, come l'aumento camminare e correre capacità, negli animali trattati con morpholino. La durezza dei muscoli è creduto per riflettere atrofia muscolare, in tal modo, è stato incluso nello schema di classificazione 59. La durezza della coscia (arti posteriori) dei muscoli è stata valutata; tuttavia, abbiamo escluso muscolo sartorio cranici perché tendono a mostrare l'ipertrofia piuttosto che l'atrofia in CXMD. cani trattati mostranocato punteggi più bassi di classificazione e aveva volte più veloce nel test di funzionamento 15 m. Volte migliorato il 15 m di prova sono indicativi di un miglioramento della funzione muscolare 40. Più alti punteggi complessivi di classificazione indicano cattive condizioni di salute e una maggiore atrofia muscolare.

Anche se questi risultati sono promettenti, multi-exon skipping presenta ancora molte sfide che dovranno essere superati prima che la tecnica ha applicabilità clinica. tessuto cardiaco mostra ancora ridotto assorbimento di AONs, probabilmente a causa della differenza di traffico cellulare tra tessuto cardiaco e scheletrico. Nessun effetto tossico è stato osservato negli animali sotto i regimi di dosaggio in corso; tuttavia, più lavoro deve essere fatto per valutare la tossicità a lungo termine prima che l'uso di cocktail AON può muoversi alla sperimentazione clinica. E 'difficile ottenere l'approvazione per AON farmaci cocktail perché le agenzie di regolamentazione definiscono ogni sequenza AON come farmaco unico. Ciò significa che ogni sequenza in un cocktail dovrebbe essere testato singolarmente per safety, che richiede più tempo e più soldi. Un'altra barriera all'utilizzo di multi-esone skipping in un ambiente clinico è una grande quantità di prodotti proteici intermedi prodotti con funzioni incognite. Queste proteine ​​possono potenzialmente portare ad imprevedibili effetti collaterali, a seconda dell'individuo mutazione 22. Inoltre, i modelli di mutazione disponibili negli attuali modelli di cani distrofici sono limitati. Ci sono alcuni mutazioni in natura, e non tutte le mutazioni sono utili per studiare multi-esone skipping. Il modello suino distrofico promette di essere una buona alternativa per il futuro DMD exon skipping studi 33, 34.

I modelli cane DMD hanno alcuni vantaggi rispetto ad altri modelli DMD. Essendo un grande modello animale, classificazione clinica e la RM sono possibili, consentendo un'analisi più dettagliata. Poiché i cani sono grandi animali sono anche più adatti per studi tossicologici e più strettamente rappresentano la malattia umana rispetto al modello di topo. Cane modelli hanno anche sequenze geniche DMD che sono più simili agli esseri umani 23, 34, 45.

Anche se tecnicamente impegnativo, l'approccio multi-skipping esone potrebbe infine beneficiare> 90% dei pazienti DMD 24. Questo lo rende una migliore alternativa al single-exon skipping, come single-exon skipping è applicabile solo a un piccolo sottogruppo di pazienti. Inoltre, multi-exon skipping ci permetterà di selezionare i modelli di eliminazione che ottimizzano la funzionalità delle proteine ​​distrofina accorciati. Ad esempio, la cancellazione di DMD esoni 45 - 55 è associata a sintomi lievi o eccezionalmente soggetti asintomatici 14,19,60-63. Il salto multi-esone di esoni 45 - 55 è già stata dimostrata in un modello murino di DMD con una esone 52 delezione (mdx52) utilizzando iniezioni sistemici di vPMOs 22,26. L'uso di vPMOs cocktail è stata dimostrata anche in altre forme di distrofia muscolare, qualicome Fukuyama distrofia muscolare congenita (FCMD). FCMD è causata da esone trapping, in cui aberranti splicing mRNA è causata da inserimento retrotrasposone. vPMOs hanno dimostrato di salvare il modello di splicing sia in un modello di FCMD mouse e in linee cellulari umane 64. Di prossima generazione chimiche AON espositrici maggiore efficacia e minore tossicità faciliterebbero la traduzione efficace dell'approccio multi-skipping esone in applicazioni cliniche. Inoltre, multi-esone skipping potrebbe potenzialmente essere applicata ad altre malattie genetiche, come la dysferlinopathies 24, 65.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
Multi-esone skipping Utilizzando oligonucleotidi antisenso Cocktail nella distrofia muscolare Canine X-linked
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter