Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

송곳니 X-연결된 근육 영양 실조에 칵테일 안티센스 올리고 뉴클레오티드를 사용하여 건너 뛰기 멀티 엑손

doi: 10.3791/53776 Published: May 24, 2016
* These authors contributed equally

Summary

엑손 스키핑은 현재 뒤 시엔 느 근이영양증 (DMD)에 대한 가장 유망한 치료 옵션입니다. DMD 환자의 적용 가능성을 확장하고, 생성 된 절단 디스트로핀 단백질의 안정성 / 기능을 최적화하기 위해, 칵테일 안티센스 올리고 뉴클레오티드를 사용하는 방식을 스킵 멀티 엑손이 개발되어 우리 개 모델에서 전신 디스트로핀 구조를 입증 하였다.

Abstract

뒤 시엔 느 근이영양증 (DMD)는 전세계 디스트로핀 (DMD) 유전자의 돌연변이에 의해 야기되는 가장 흔한 유전 치명적인 질환이다. 엑손 스키핑은 독서 프레임을 복원하고 짧은하지만 기능적인 단백질을 생산 안티센스 올리고 뉴클레오티드 (AONs)라는 짧은 DNA / RNA와 같은 분자를 사용한다. (하나의 AON 약물로 치료 될 수있는 환자의 13 %까지) 제한 적용하고, 절단 된 단백질의 불확실 기능 : 그러나, 엑손 건너 뛰는 치료는 두 가지 주요 장애물에 직면 해있다. 이러한 문제는 칵테일 AON 방식으로 해결했다. DMD 환자의 약 70 %가 단일 엑손 스킵하여 (결합 모두 엑손)로 처리 할 수​​ 있지만 칵테일 안티센스 약물을 이용하여 스킵 여러 엑손이 실현 될 수 있다면, 하나의 잠재적 DMD 환자의 90 % 이상을 치료할 수있다. 송곳니의 X-연결 근​​이영양증 (CXMD) 개 모델, 그 표현형 인간의 DMD 환자에 더 유사하다는 전신 effic을 테스트하는 데 사용 된ACY과 엑손 6, 8 CXMD 개 모델의 멀티 엑손 스키핑의 안전 디스트로핀의 mRNA의 엑손 7의 부족으로 이어지는, 인트론 6 스플 라이스 사이트 변이를 항구. CXMD에서 독서 프레임을 복원하려면 엑손 6, 8의 멀티 엑손 스키핑이 필요합니다; 따라서, CXMD 멀티 엑손 스키핑의 효능과 안전성을 테스트하기위한 좋은 중간 크기의 동물 모델이다. 현재의 연구에서, 엑손 6 엑손 (8)을 대상으로 안티센스 morpholinos의 칵테일 설계되었으며 그것은 몸 전체의 골격 근육 디스트로핀 식을 복원. 형질 전환 / 칵테일 올리고 주입과 효능 및 CXMD 개 모델에서 멀티 엑손 스키핑의 안전성 평가를위한 방법을 제시한다.

Introduction

뒤 시엔 느 근이영양증 (DMD) 먼저 박사 기욤 - 벤자민 - AMAND 뒤 시엔 느 (드 불로뉴 1)에 의해 설명 진보적 인 근육 약화 특징으로하는 X 연결된 열성 근육 질환이다. DMD는 매년 2,3 태어난 약 2 만 영향을받는 아이들과 함께, 전 세계적으로 약 1 3,500에서 소년에 영향을 미치는 일반적인 유전 질환이다. 모터 개발이 지연되고, 보행 장애는 초기 청소년에 대한에 휠체어 의존성 다음에, 유아 (4)에서 볼 수 있습니다. 죽음은 일반적으로 인한 호흡이나 심장 장애 5-8 20 30 세 사이에 발생합니다. DMD에 대한 치료법은 없습니다. 글루코 코르티코이드로 처리하고 어느 정도의 근육 퇴행의 진행을 느리게 할 수 있지만, 비만 및 당뇨병 2,7,8 포함한 심각한 부작용과 관련된다. DMD는 기능 디스트로핀의 PROTEI의 손실로 이어지는은 디스트로핀 (DMD) 유전자에 돌연변이의 결과n은. DMD는 2 백만 염기쌍 79 엑손 9, 10으로 매우 큰 유전자이다. 아웃 오브 프레임 돌연변이로 이어지는 삭제, 넌센스, 및 중복 돌연변이는 DMD 표현형의 가장 흔한 원인이다. 9 엑손 (45) - - 엑손 3의 지역 대부분의 환자는 유전자의 이러한 부분에서 삭제 돌연변이를 가지고 55 DMD 환자 3,9,11-16에 비 기능 디스트로핀을 선도, "돌연변이 핫스팟"이라고한다. 근육 세포막의 안정화에서 중요한 역할을 갖는 디스트로핀 당단백 복합체 (DGC) 내의 디스트로핀 기능한다. 중앙로드 도메인이 덜 중요한 역할을한다 3,9,17하면서 N- 말단 및 C는 함수의 가장 중요한 영역이다. 주로 DMD 유전자 내의 프레임 내 돌연변이의 결과 베커 근이영양증 (BMD)과 연관된 경증 표현형의 준수는 DMD의 치료 스킵 엑손의 적용을 고무. BMD 환자는 단축하지만 functiona 한말단 3,6,18 모두를 유지 리터, 디스트로핀 단백질. 엑손 스킵 이론적 BMD 3,19에서 보이는 것과 유사한 단축-하지만 관능 디스트로핀 단백질의 결과로, 판독 프레임을 복원 할 수있다.

안티센스 올리고 뉴클레오티드 (AONs)의 여러 유형 2'O - 메틸화 포스 포로 (2'OMePS) 및 phosphorodiamidate의 모르 폴리 노 올리고머 (PMOS)를 포함하여 임상 시험에서 테스트되었습니다. 이 AONs를 사용하여 건너 뛰기 엑손 (51) 및 (53)는 조사 된 결과가 유망한 동안 돌연변이 별 3, 19, 20, 21, 22 ~ 26대로, 단일 엑손 스키핑은 적용이 제한되어 있습니다. 질문은 하나의 엑손이 22, 23 스킵로부터 생성 된 결과적인 단축 디스트로핀 단백질의 안정성에 대해 남아있다. 또한, 일부 환자는 하나의 엑손보다가 독서 프레임 (3)을 복원하기 위해 제외 될 필요합니다. 기술적으로 더 어려운 반면, 멀티 엑손 스키핑은 하나의 방법입니다이러한 문제 3,19를 해결할 수 있습니다. 멀티 엑손 스키핑 이전 이영 개, 시험관에서 인간 세포주에서 입증되었다. 또한, mdx52 마우스와 개 X-연결 근이영양증 (CXMD) 개 모델에서 생체에 사용 된 22, 24 ~ 27을 연구. 송곳니 X 결합 근이영양증 (일본 CXMD J) CXMD J의 판독 프레임은 엑손 (6, 8) 또는 추가 엑손 (즉, 엑손은 3-9)의 멀티 엑손 스킵에 의해 복원 될 수있는 비글 여기에 사용 하였다 (도 1). 비글 기반 CXMD는 골든 리트리버 근이영양증 (GRMD) 모델과 동일한 변이 패턴을 공유하지만 비글 견 따라서 DMD (28, 29)에 유용한 모델을 제공하기 때문에 자신의 신체 크기에 작은 및 유지 관리를 저렴합니다. CXMD 개는 더 밀접하게 설치류 같은 작은 동물 모델보다 인간의 DMD 표현형을 모방, 및 독성 학적 평가 3,22,30,31을 더 신뢰할 수있는 (그림 2)>입니다. CXMD 개는 DMD에서 본 것과 유사한 진보적 인 근육의 붕괴, 보행 장애, 심장 및 호흡기 문제를 표시합니다. 단일 엑손 스킵과 비교하여 멀티 - 엑손 스키핑 환자의 더 큰 비율에 적용 가능하다. 가장 일반적인 세 돌연변이 유형 (삭제, 넌센스, 및 중복) 중 80 - 모든 DMD 환자의 45 %가 이익을 얻을 수있는 동안 환자의 98 %는 구체적으로 건너 뛰는 엑손 (45), 멀티 엑손은 14,32,33를 건너 뛰는를 통해 처리 될 수있다 - 55 3,19,22,34.

변성 morpholinos의 발달로, 엑손 스킵 촉진에 AON 칵테일의 효율이 개선되었다. 아르기닌이 풍부한 세포 침투 펩타이드 결합 된 PMOS (PPMOs), 및 생체-morpholinos (vPMOs)은 크게 세포 침투 능력과 안정성 3,35-38을 향상 AON 화학이다. 우려는 장기 AON 독성에 대한 유지; 그러나, 상당한 진전만들어졌다. morpholinos에 대한 화학 수정은 크게 오프 대상 효과를 감소 및 사전 임상 연구는 유의 한 독성 효과 3,22,39,40을보고있다. 멀티 엑손 스키핑을위한 남은 과제는 각각의 단일 AON의 현재 요구 사항 칵테일 3,19,22,41,42으로 대신 함께 하나의 약물로, 단독으로 독성 시험을하여야한다. 심장을 대상으로 스킵 핑 하나 모두 다 엑손을 포함하는 DMD의 연구에서, 이영 심장 조직에 약간의 개선이 있었다. 마음에 morpholinos의 효능 때문에 가난한 세포 침투 능력이 낮은 것으로 생각된다. 펩타이드 공액 PPMOs 심장 3,19,38에 기능성 구조 디스트로핀 단백질의 양을 증가, 심장 세포 침투 AONs의 능력을 개선하고있다.

여기서, 우리 AON 칵테일 접근법 ESEfinder 소프트웨어 (43)를 사용 AON 서열의 설계를 포함하여 길이로 논의된다. Protoc멀티 엑손 스키핑와 개 실험에 대한 OLS도 설명되어 있습니다. CXMD J의 비글 견은 엑손 6, 8 스킵 실험에 사용 하였다. CXMD 개 모델에서 건너 뛰는 멀티 엑손은 유망한 결과를 보여 주지만, 문제는 임상 적으로 적용 할 수 있습니다 전에 필요가 극복해야 할 남아있다.

Protocol

아래에 나열된 모든 프로토콜은 일본의 국립 신경 센터와 정신과 (NCNP)에 의해 규정 된 동물 관리 지침에 따라 있습니다. 모든 실험은 NCNP의 기관 동물 관리 및 사용위원회에 의해 승인되었습니다.

안티센스 올리고 1. 디자인

  1. , 45-47을 ESE 사이트 (44)를 검출하는 구조 ESE 및 ESEfinder 프로그램을 사용합니다.
  2. 대상이되어야한다 엑손에 안티센스있는 디자인 25 염기쌍 (bp의) 시퀀스. 대상 엑손 6 개 모델 (8) (그림 1).
    1. PMOS 30 bp의 시퀀스 (표 1) 또는 2'OMePS 25 bp의 - (25)를 사용합니다. 25 염기쌍 서열을 설계 대상 영역 내에있는 서열을 선택한다. 안정적인 시퀀스 (43)를 생성하는 이차 구조, 이종의 회피, 엑손 접합 증강 주제 및 GC 함량을 고려하십시오. 전술 한 강도로 식별 AONs는 ESE 사이트 중 적어도 하나를 대상으로해야tware.
    2. 미만 4 연속 'G의, 및 포함되지 않은 자체 상보적인 서열로, 미만 65 % 인 GC 함량이 선택 AONs. 오프 대상 어닐링 사이트 22,48,49를 예측하기 위해 NCBI 폭발 소프트웨어를 사용합니다.
  3. 적절한 AON 백본 화학을 선택합니다. 시험 관내 실험 2'O 메틸 올리고 뉴클레오티드 (2'OMePS) 또는 morpholinos를 사용합니다. 생체 실험을 위해, 2'OMePS, morpholinos 또는 vPMOs를 사용합니다. 3,19,48,50

생체 외 실험 2. (엑손 6, 8 CXMD 모델에 건너 뛰기)

  1. 개 근육 아세포의 2'OMePS 형질
    1. 6 웰 플레이트에서 성장 배지 3 ㎖ 문화 CXMD의 근육 아세포. 씨앗 1-5 × 103 세포 / cm 2 0.5 ㎖ / 근육 아세포에 대한 매체의 cm 2. 성장 배지를 들어, 10 % 소 태아 혈청 (FBS) 및 1 %로 둘 베코 변성 이글 배지 (DMEM)를 사용하여페니실린 / 스트렙토 마이신 (P / S) 40.
    2. 80 % 합류 - 60까지 37 ° C에서 품어. 이 약 12​​ ~ 24 시간이 걸립니다.
    3. (1 비율 트랜 에이전트 : AONs 예, 대 리포 펙틴 10㎕를 5 μg의 AONs 2) 감소 된 혈청 배지 100 μL의 총 양이온 리포좀 트랜 제를 희석. 45 분 - 혼합물을 30 동안 실온에서 방치한다.
    4. 감소 된 혈청 배지에서 100 μL의 최종 부피 AONs (2'OMePS 또는 morpholinos)을 희석.
    5. 희석 AONs로 희석 된 형질 에이전트를 결합하고 10 RT 부화 - 15 분.
    6. 트랜 에이전트 / AON 혼합물을 RT에 앉아있는 동안, 흡입을 통해 세포에서 이전 미디어를 제거하고 미디어 세포를 씻는다.
    7. 트랜 에이전트 / AON 혼합물에 0.8 ml의 미디어를 추가 한 다음 갓 씻어 세포에 전체 솔루션을 추가합니다. 37 ° C에서 3 시간 동안 품어.
    8. 배양 후, differentiat와 미디어를 교체이온 미디어 (DM); 분화 10 일까지 걸릴 수 있습니다. 주변에 일 3. 차별화 미디어에서 시작 분화가 발생했는지 여부를 확인하는 것은 2 % 말 혈청과 DMEM, 200 U / ㎖ 페니실린, 200 ㎎ / ㎖ 스트렙토 마이신, 10 μg의 / ㎖ 인슐린이다.
  2. 개 근육 아세포의 모르 폴리 노 형질
    1. 단계 2.1에 기재된 바와 같이 배양 CXMD 성장 배지 아세포.
    2. 차별화 매체 (DM)로 전환하고, 최종 농도 1 μM을 만들기 위해 각 웰에 0.1 mM의 스톡 모르 폴리 노를 추가합니다. 형질 전환 또는 주입하기 전에 10 분 동안 65 ° C에서 열 칵테일 morpholinos는 AON 응집을 방지 할 수 있습니다. 펩타이드 전달 39,51 시약을 첨가하고 3의 최종 농도로 조정 - 6 μM.
    3. 16 후 - 배양 48 시간, RNA 추출을위한 세포를 수집합니다. 접시에서 세포를 분리하는 세포에 1 ml의 산 구 아니 디늄 티오 시아 네이트 - 페놀 - 클로로포름을 추가합니다. RNA의 extrac를 수행이 단계 이후 기.
      1. 대안 적으로, 모든 셀을 덮도록 트립신을 추가하고, 37 ℃에서 2 분간 배양한다.
        참고 : 면역 화학을 수행 배양을위한 챔버 슬라이드 안경을 사용하려는 경우. 분화 후, 세포는 파라 포름 알데히드 (PFA) (10 분 동안 4 %)를 사용하여 고정 될 수있다.
  3. RNA 추출 및 역전사 중합 효소 연쇄 반응 (RT-PCR)
    1. 세포가 myotubes로 분화되면, 중간 제거하고 1 ml의 산 구 아니 디늄 티오 시아 네이트 - 페놀 - 클로로포름을 추가; 실온에서 10 분 동안 품어.
    2. 1.5 ml의 튜브에 전송합니다. 200 μl의 클로로포름과 결합하고 세 개의 층이 보일 때까지 2 분 동안 RT에서 배양한다. 위로부터 아래로 세 층이다 :는 RNA 층, DNA 층 및 단백질 층.
    3. 4 ℃에서 15 분 동안 12,000 × g에서 원심 분리기. 500 & #와 튜브의 상위 계층 상층 액과 장소를 제거(181), L의 이소프로판올 (여기 중지하는 경우, -80 ° C에서 뜨는을 저장). 원심 분리기 4 ° C에서 10 분 동안 12,000 × g에서 뜨는; 원심 분리 한 후, 생성 된 RNA 펠렛을 유지하고 상층 액을 버린다.
    4. 4 ° C에서 5 분 동안 8,000 XG에 에탄올과 원심 분리기와 펠렛을 씻으십시오. 15 분 동안 튜브를 반전시켜 잔류 에탄올을 증발 한 후 추가 15 -의 RNase가없는 물을 30 μL. 260 nm에서 US / VIS 분광을 사용하여 총 RNA 농도를 정량화.
    5. 1.5 ㎕의 10 μM 역방향 프라이머, 1 μL의의 dNTP, 5 ㎕의 한 단계 PCR 키트의 완충액, 0.7 ㎕의 RNA 분해 효소 억제제, 1 ㎕의 효소 혼합물로부터 액형, 1.5 ㎕의 10 μM 정방향 프라이머는 RT-PCR 반응에 필요한 시약을 겸용 PCR 키트와 RNA의 200 NG 단계. 이러한 혼합 한 후, 25 μL의 최종 볼륨에 물을 추가합니다.
    6. 항온 자전거 타는 사람에 혼합물을 배치합니다. 50 ° C, 15 분에서 30 분주기를 실행0; 95 ° C에서 사이클 후 1 분 동안 94 ° C의 35주기, 1 분 동안 60 ℃, 1 분 동안 72 ° C. 마지막으로, 72 ° C에서 10 분주기를 실행. 4 ° C 또는 -20 ° C에서 냉장고에 보관 PCR 제품
  4. 보완 DNA (cDNA를) 시퀀싱
    1. 아가로 오스 겔 전기 영동을 사용하여 9 스킵 밴드 - 엑손 6을 확인합니다. 부하 20 분 후, 120 V 5 1.5 % 아가로 스겔의 웰에 각 샘플 μL, 5 분 동안 겔을 통해 135 V를 실행. 다음에, 30 분 동안 RT에서 DNA 겔 염색에서 겔을 배양한다. 이미지 소프트웨어를 이용하여 밴드를 시각화.
    2. 겔 추출 키트를 사용하여 관심있는 밴드를 절제.
      1. DNA 단편을 절제 200 μL의 NTI / 100 mg의 겔을 사용하는 겔 슬라이스를 용해. 이 50 ° C의 물을 욕조에 5 분 ~ 10 동안 앉아 보자. 그리고 막 튜브를 대 실리카에 전송합니다.
      2. 30 초 동안 11,000 XG에 원심 분리기. 가전​​ 전에 700 ㎕를 NT3 버퍼로 두 번 세척30 초 동안 11,000 XG에 다시 ntrifuging.
      3. 1 분 동안 11,000 XG에서 원심 분리하여 실리카 막을 건조.
      4. 30 μL의 NE 버퍼가 1 분 동안 실온에서 앉을 수 - 15를 추가합니다. 그런 다음, 1 분 동안 11,000 XG에 원심 분리기. 실리카 겔을 분리하여 튜브의 내용을 유지한다.
    3. 제조사의 프로토콜에 따른 시퀀스를 결정하기 위해 시퀀싱 키트를 사용한다.

3. 근육 주사 또는 Open 근육 생검

  1. 생존 수술시 무균 조건의 유지 관리를 위해 수술 사이트 (뒷다리)를 주변 지역에 가위를 사용하여 머리를 제거합니다. 살균제로 Iodophors, 소 디움 하이포 클로 또는 클로로 헥를 사용합니다. 배치하고 전체 동물과 운영 식탁을 확보하여 수술 부위에 대한 멸균 커튼을 사용합니다.
    1. 수술실 52, 53 클린 스크럽, 얼굴 마스크, 헤드 커버, 멸균 장갑, 특수 신발을 착용하십시오.
    2. </ OL>
    3. 20 mg을 가진 CXMD 개를 주사 / 티 오펜 탈 나트륨 kg 그들을 마취합니다. 건조에서 눈을 방지하기 위해 눈에 수의사 연고를 사용합니다.
    4. 전신 마취 (그림 3)를 유지하기 위해 3 %의 이소 플루 란 흡입 - 2를 사용합니다. 근육의 반사 신경을 확인하고 심장을 모니터링하고 속도를 호흡하는 것은 마취의 깊이를 평가하기 위해. RR : 다음과 같이 전신 마취하에 정상적인 호흡 속도 (RR), 심박수 (HR) 및 SPO 2는 10-20 호흡 / 분; SPO 2 : 95~100%, HR : 80 - 분 (BPM) 당 120 비트.
    5. 메스를 사용하여, 또한 전 경골근 (TA)로 알려진 뇌 경골 (CT)을 통해 피부를 잘라 내고 (젊은 성인 개) 약 5cm 길이 방향으로 하나의 컷을합니다. 사출 사이트를 표시하려면, 수술 바늘과 수술 스레드를 사용하여 깊은 근막 스티치와 2cm 간격으로 두 개의 스티치 마커를 확인합니다.
    6. 27 G 바늘로 근육에 AONs의 원하는 농도를 주입한다. 원하는 concentration은 처리 조건 사이에 다릅니다. CT의 경우, 칵테일 PMOS 1.2 mg의 총 (0.4 mg을 각각 PMO) 또는 칵테일 vPMOs 0.4 밀리그램 (0.13 mg의 각 vPMO)에 대해, 1 ml의 볼륨 각각이 주사를 제공합니다. 신근 수근 척골 쪽 손목 펴짐 근 (ECU) 앞다리 근육의 경우, 칵테일 PMOS 1.2 mg의 총 (0.4 mg을 각각 PMO) 또는 칵테일 vPMOs 0.4 밀리그램 (0.13 mg의 각 vPMO) 0.5 ml를 각각 두 개의 볼륨을 주입. 1 분 동안 바늘에 둡니다. 칵테일 각 AON의 동일한 양을 사용합니다.
    7. 수술 용 메스를 사용하여 CT 근육에서 근육 조직의 조각을 길이 약 2cm를 제거하여 오픈 근육 조직 검사를 수행합니다.
    8. 근육 샘플 준비를 위해 6.5 단계로 이동합니다.
    9. 바늘을 사용하여 전신 마취에서 각성하기 전에 / kg 프레 노르 핀 염산염 0.02 mg을 근육 주사를 관리 할 수​​ 있습니다. 다시 근육을 통해 근육의 근막과 피부를 놓고 근육의 근막과 피부 폐쇄, respectiv의 3-0 흡수 실 및 3-0 나일론 실을 사용하여 이러한 스티치엘리.
    10. 입이 열려 채, 개그 반사 반환 여부를 확인; 개그 반사가 반환 될 때, 개를 extubate.
    11. 감염을 방지하기 위해 정맥 또는 근육 주사를 통해 15 밀리그램 / 최대 3 일 동안 kg 세파 졸린 또는 세팔 렉신 (항생제) 30를 관리 할 수​​ 있습니다.
    12. 7 일 이내에 봉합사를 제거합니다. 이 흉골 드러 누움을 유지하기 위해 충분한 의식을 회복하고 완전히 회복이 될 때까지 개는 다른 동물과 상호 작용하는 것을 허용하지 않습니다 때까지 개를 방치하지 마십시오. 가능한 한 오랫동안 장소에서 기관 내 튜브를 유지하고 동물이 씹거나 삼키기 시작하면 제거합니다. 그들이 안정적이고 정상 범위 내에 있는지 확인하기 위해 동물의 심장 박동, 호흡, 그리고 수화를 모니터링합니다.
    13. 수술 후 케어, 조용하고 어두운 휴식 장소, 적절한 상처와 붕대 유지 보수, 부드러운 포함 삼일 (예, 부 프레 노르 핀 0.01 ㎎ / ㎏) 및 간호 지원을 위해 진통제를 제공휴식 표면, 경구 또는 비경 유체와 수분 보충, 매우 맛 식품이나 취급의 사용을 통해 일반 공급에 반환. 어떤 동물이 추가 약물이 필요한 경우, 통증 증상에 따라 부토 르파 놀 타르트 레이트 0.3 ㎎ / ㎏의 근육 내 주사를 제공합니다.
      참고 : 고통 개, 물린 상처, 또는 고통스러운 지역을 보호하고 취급하면, 비정상적으로 우려 또는 공격적이 될 수도있다. 또한, 하나 사지에 통증은 일반적으로 파행하거나 사용하려는 시도에 영향을받는 사지의 유지 업을 초래한다. 8 시간 - 이러한 상황에서, 부 프레 노르 핀 염산염 0.02 ㎎ / ㎏ 매일 6의 근육 내 주사를 준다.

    4. 전신 주사

    참고 :이 절차는 주 원하는 번호를 매주 또는 격주로 반복 될 수있다.

    1. 누워 개를 받고 수동으로 부드럽게 개를 억제하고 t에 걸쳐 장소에서 개를 잡아 어깨와 엉덩이 위에 팔을 드레이프그 절차.
    2. AONs을 주입; 120-240 ㎎ / ㎏ 칵테일 PMOS - (A 두부 또는 복재 정맥라고도 함) 다리 정맥에 정맥 유치 바늘을 사용하여 (40 80 mg의 각 AON). 주입 AON 량은 실험 조건에 의존한다. 칵테일 각 AON의 동일한 양을 사용합니다.
    3. 제조업체의 지침에 따라, 20 분 동안 / 분 2.5 ML의 속도로 50 ml의 총을 주입하는 주입 펌프 또는 주사기 드라이버를 사용하십시오. 격주로 매주 또는 반복 주사 디스트로핀 표현이 반복 주사로 축적되므로 (매 2 주) 이상 5 배.
    4. 독성을 조사하기 위해 매주 혈액 검사를 수행합니다.
      1. 완전한 혈액 카운트 (CBC) 0.5 mL 및 다른 사람을 위해 2.5 ml의 - - 전면 또는 사지의 피하 정맥 중 하나에서 바늘을 사용하여, 혈액의 3 ㎖를 수집합니다. CBC, 감마 글루 타밀 트랜스퍼 라제 (GGT), 아스 파르 테이트 아미노 트랜스퍼 라 아제 (AST), 혈액 요소 질소 (BUN)를 포함 알라닌 aminotransferase (ALT), 크레아틴 키나제 (CK), 및 크레아티닌 평가 혈액 검사 키트에서 제조업체의 지침에 따라, 수집 된 혈액을 테스트. 40,54

    개 5. 임상 등급

    1. 비디오 카메라 및 녹화 개 행동과 걸음 걸이를 설정합니다. 개를 채점 할 때이 기준 역할을 같이 개 전체 만남을 기록; 이 각각의 비디오는 강아지의 능력과 의지에 따라 다른 길이 될 것입니다 의미합니다. 기본 기록 매개 변수를 사용합니다. 그것이 나중에 검토 할 수 있도록 촬영은 등급의 기록을 작성합니다.
    2. 학년 보행 및 운동 장애.
      1. 보행 운동 장애를 들어, 다음의 등급을 사용
        1 등급 = 없음, 뒷다리와 함께 앉아 학년 2 = 확장, 3 학년 = 뒷다리와 토끼 홉, 4 학년 = 셔플 거리, 그리고 5 학년 = 걸을 수 없습니다.
      2. GR 1 등급 = 없음 : 이동 방해를 들어, 다음 학년을 사용ADE 2 = 정상보다 뒷다리, 4 학년에 점프 할 수 없습니다 3 학년을 = 누워 주위에 이동 어려움, 그리고 5 학년 = 일어나서 주위를 이동할 수 없습니다 증가.
    3. 15m를 실행하려면이 개를 걸리는 시간. , 15m를 측정 출발 선에서 개를 배치하고 15m 마크까지 실행하도록 권장합니다.
    4. 다음 등급 척도를 사용하여 사지의 근육 위축을 확인합니다 :
      1 등급 = 없음, 2 등급 = 용의자 경도, 3 학년은 = 경도를 느끼게하거나 성적 3과 5 사이의 얇은, 4 학년 = 나타날 수 있습니다 학년 5 = 매우 얇은 하드.
    5. 등급은 다음과 스케일을 사용하여 침을 흘리고 없습니다 : 1 등급 = 없음, 등급 2 = 먹거나 음주, 그리고 5 학년 = 연속 잠꼬대 때, 3 학년 = 일부 먹는 잠꼬대과 음주, 4 학년 = 잠꼬대의 문자열을 앉아 때 가끔 침을 드리블.
    6. 혀 (대설) 다음과 같은 스케일을 사용 학년 비대 : 1 등급 = 없음, 2 등급 = 약간 확대, 3 학년 = 확장 outsi드 치열, 4 학년 = 확대 약간 두껍게, 그리고 5 학년 = 확대 및 농축.
    7. 학년 이하 규모의 사용 삼키는 강아지의 능력 : 1 학년 = 더 어려움, 2 등급 =가, 씹는에 접시에서, 4 학년 = 어려움을 음식을 복용 음식, 3 학년 = 어려움을 복용 삼키는 시간과 노력이 필요하거나 음주를 식사를하고, 5 학년 = 수 없습니다.
    8. (55) (15 미터 주행 시험 제외) 각 카테고리에서 점수를 추가하여 총 점수를 계산합니다.
      주 : 바이어스를 도입하지 않도록 연구를 멀게한다.

    (6) 자기 공명 영상 (MRI)

    1. 뒷다리 - 사지의 T2 강조 영상을 얻기 위해 3 테슬라 (3T) MRI와 18cm 직경 / 18cm 길이 인간의 말단 코일을 사용합니다.
    2. 티 오펜 탈 20 ㎎ / ㎏으로 CXMD 개를 주입하여 동물을 마취. 건조에서 눈을 방지하기 위해 눈에 수의사 연고를 사용합니다. 전신 마취를 유지하기 위해 2~3% 이소 플루 란 흡입을 사용합니다.
      1. 근육의 반사 신경을 확인하고 심장을 모니터링하고 속도를 호흡하는 것은 마취의 깊이를 평가하기 위해. 95~100%, HR : 80 - 분 당 120 비트 (BPM : - RR : 20 호흡 / 분, SPO 2~10 다음과 같이 정상적인 호흡 속도 (RR), 심박동 수 (HR) 및 전신 마취 SPO 2는 ).
    3. T2 강조 영상 획득하기 위해 다음 설정을 사용 TR / TE는 = 4000 / 85 밀리 초, 슬라이스 두께 = 6mm, 슬라이스 격차 = 0mm,보기 = 18cm의 필드 X 18cm를, 매트릭스 크기 = 256 X 256, 및 빠른 스핀 에코 (그림 4) 동안 인수 = 3의 수입니다.

    7. 근육 샘플링 및 준비 (부검)

    참고 : 근육은 지난 AON 주입 후 1 또는 2 주 샘플링해야합니다.

    1. 20 mg을 가진 개를 주사 / 티 오펜 탈 나트륨 kg 그들을 마취합니다. 눈의 건조를 방지하기 위해 마취 동안 눈에 수의사 연고를 사용합니다.
    2. anes을 유지하기 위해 이소 플루 란 흡입 3 % - 2를 사용하여thesia. 근육의 반사 신경을 확인하고 심장을 모니터링하고 속도를 호흡하는 것은 마취의 깊이를 평가하기 위해. RR : 다음과 같이 전신 마취하에 정상적인 호흡 속도 (RR), 심박수 (HR) 및 SPO 2는 10-20 호흡 / 분; SPO 2 : 95~100%, HR : 80-120 BPM.
      1. (부검 전용) 전신 마취 하에서 방혈하여 개를 안락사. 분자 분석 혈액 유래 인자 (예를 들어, 심장 근육)에 의한 영향을 피하기 위해 깊은 전신 마취 하에서 방혈을 사용합니다.
    3. 해부 다음과 같은 근육 (그림 5) : CT, 신근 심지 longus (EDL), 비복근, 가자미근, 대퇴 이두근, 직근 대퇴골, 상완 이두근, 삼두근 상완, 삼각근, ECU, 신근 요측 수근 (ECR), 굴곡 수근의 척골 쪽 손목 펴짐 근 (FCU ), 요측 수근 굴근 (FCR), 박근, 늑간, 복부 근육, 다이아 프램, 측면 dorsi, 식도, 흉쇄, 심장. 독성 검사, 신장 및 리를 수집버전 샘플. 사용 에반스와 해부 기술 (56)에 대한 기준으로 알렉산더 드 Lahunta (2009).
    4. 잘라 CT, EDL, 비복근, 가자미근, 대퇴 이두근, 직근 대퇴골, 상완 이두근, 삼두근 상완, 삼각근, ECU, ECR, FCU, FCR, 박근, 늑간, 복부 근육, 측면 dorsi, 식도, 흉쇄, 심장, 신장, 작은 부분 약 1로 간 - 길이가 1.5 cm. 최대 조리개 롤 다음 1로 잘라 - 1.5 cm 섹션 56.
    5. 코르크 디스크에 1cm 두께 -이 약 0.5가되도록 트라가 칸트 고무를 놓습니다. 트라가 칸트 검과 반대측 동물의 식별 및 근육 이름 라벨 디스크.
    6. 트라가 칸트 검의 코르크에 수직 자신의 종축과 근육을 놓습니다.
    7. 액체 질소에 앉아 이소 펜탄의 용기에 마개를 놓습니다. 1 분 또는 완전히 고정 될 때까지 핀셋으로 끊임없이 주위를 이동합니다. 코르크에 저장 근육-80 ° C에서 유리 병입니다. 운반시, 드라이 아이스에 튜브를 넣어.
    8. 동물 식별 / 근육 이름과 날짜가 표시 유리 슬라이드를 준비합니다.
    9. 그라 이오 스탯은 -25 ° C로 냉각에서 스탠드에 코르크를 탑재합니다. 원하는 수준의 단면 두께를 설정한다. 면역 조직 화학 8 μm의 헤 마톡 실린 및 에오신 (HE) 염색 12 μm의를 사용합니다. 웨스턴 블롯 샘플 15 μm의를 사용합니다. 적절한 근육 샘플링 평면 근육을 얻을 근육 1/4 정도 트림.
    10. 계획이 면역 조직 화학에 대한 샘플을 사용하거나 HE는 염색하면 한 번에 근육의 한 부분을 절단, 같은 유리 슬라이드에 매 6 번째 섹션을 배치합니다. -80 ° C에서 튜브 및 상점에서 40 절 - 서양 말에 대한 샘플을 사용하는 경우, 30했습니다.
    11. 슬라이드의 준비를 한 후, 슬라이드는 실온에서 1.5 시간 동안 건조 할 수 있습니다. 스토어는 -80 ° C에서 슬라이드.

    8. 면역 조직 화학

    1. 저장소에서 준비된 슬라이드를 제거하고에 배치수분을 분리 챔버 슬라이드를 유지하고 수분을 유지한다. 아래는 그냥 물 (물 약 1mm)으로 덮여되도록 습기 챔버를 입력합니다.
    2. 공기 건조 0.5 시간 동안. 소수성 장벽 펜을 사용하여 슬라이드에 근육 샘플을 둘러싸는 사각형을 그립니다.
    3. 인산염 완충 식염수 (PBS)에 15 %의 염소 혈청을 추가하고 시약을 차단에서 실온에서 2 시간 동안 품어.
    4. (150 희석 1) 개 디스트로핀 염색에 대한 안티 디스트로핀로드 도메인 (DYS-1) 마우스 단일 클론 차 항체, 또는 C- 말단 단일 클론 항체 (DYS-2)를 추가합니다. PBS의 1.25 ml의 차단 에이전트를 사용하여 희석. O / N 냉장고에 4 °에 C를 품어.
    5. 5 분 동안 PBS로 세척을 3 회 반복. (2,500 일) (DYS-1) 또는 IgG2 (DYS-2) 마우스의 IgG1에 대해 이차 항체 알렉사 594 염소 항체를 추가합니다. PBS에서 차단 시약은 페놀에 톡실 레이트 옥틸 0.1 %를 함유하는 희석. 실온에서 0.5 시간 동안 품어.
    6. 5 분, 삼t PBS로 세척IME를. 슬라이드가 건조하도록 허용합니다. 2 방울 (4) (3 NG / ㎖) ', 6 diamidino-2-페닐 인돌 (DAPI) 장착 솔루션 - 1을 추가합니다. 핀셋을 사용하여 거품을 방지 섹션의 맨 위에 유리 슬립을 배치합니다.
    7. 보기 dystrophin- (DYS-1 / DYS-2) 20X 배율에서 594 nm에서 형광 현미경으로 긍정적 인 섬유.

    9. 웨스턴 블로 팅

    1. 극저온 절편 얼음에 샘플 버퍼 150 μL에에서 수집 된 근육 섹션을 추가합니다.
    2. 손을 균질기를 사용하여 간단히 단백질 시료 균질화. 5 분 - 3 95 ℃에서 가열 블럭 배양기에서 1.5 ㎖의 튜브에 열 샘플. 원심 분리기와 15 분 동안 16,500 × g에서하면 뜨는를 수집합니다.
    3. -70 ℃에서 상등액 스토어 분취. 100 배 희석 증류수를 사용합니다.
    4. 제조사의 프로토콜에 따라 상업적 키트를 사용하여 단백질 농도를 결정한다. 3 분 동안 샘플 및 열에 배 램 믈리 SDS 로딩 버퍼를 추가 &# 160; 95 ° C에서.
    5. 3에로드 샘플 - 150 V.에서 3 시간 동안 그것을 실행하기 전에 8 % 트리스 - 아세테이트 젤은 몇 희석 된 야생형 (WT) 샘플을 포함합니다 (예를 들어, 1 %, 10 %, 50 %) 정량. 디스트로핀의 1 % 미만 WT 수준은이 방법을 발견해야한다.
    6. 20 분 동안 음극 버퍼에 젤을 놓습니다. )이 각각.이이 시간 동안 여과지 9 곡을 음극 버퍼 [+], 애노드 완충액 (에 (전송 버퍼 3 종이를 넣어 - - [] [], 및 농축 애노드 버퍼 감도 (도 6)을 증가하는 반건식 전송 방법을 설명한다.
    7. 20 초 동안 메탄올에서 PVDF 멤브레인을 만끽하고 양극 버퍼에 배치합니다.
      반 건조 전송을 위해 멤브레인과 겔을 설정하고 RT 또는 추운 방에서 400mA에서 1.5 시간을 실행할 수 있습니다.
    8. PBS와 멤브레인을 씻으십시오. 2 시간 동안 트윈 20 (PBST) 및 5 % 분유와 PBS의 혼합물 막을 인큐베이션.
    9. PBST로 DYS-1 (일차 항체)를 희석하고 1~5% 우유 분말 혼합물 : 100 희석. 막에 추가하고 적어도 1 시간 동안 배양 할 수 있습니다. 15 분마다 100 ㎖의 PBST로 3 회 씻는다.
    10. 1에서 65 μL / HRP 복합 이차 항체 (DYS1에 대한 항 - 마우스의 IgG2a)의 차선을 추가 : 5,000 희석 어두운 영역에서 실온에서 1 시간 동안. 그런 다음, 20 분 동안 200 ML의 PBST로 3 회 씻어. 지시에 따라 검출 키트에서 솔루션을 섞는다. 1 분 동안 품어.
    11. 밴드를 감지하고 ImageJ에 소프트웨어 48,57,58으로 분석 할 수있는 필름을 개발한다.

Representative Results

생체 외 실험에서

아세포는 각 AON의 효과를 비교하기 위해 다양한 2'OMePS 처리 조건과 함께 형질 감염시켰다. 600 nm의 Ex6A, Ex6B, Ex8A, 또는 Ex8B 각각의 단일 AON 치료는 600 nm의 4 AON 시퀀스의 각각 칵테일 치료뿐만 아니라, 수행되었다. RNA 샘플은 사일 형질 전환 후 수집 하였다. RT-PCR 후, 각각의 처리를위한 샘플은 미처리 (NT) 시료와 함께 겔상에서 실행 하였다. 겔에 더 높은 밴드는 아웃 오브 프레임 DMD 제품을 나타냅니다; 이 밴드는 NT, Ex8A에서 볼되었고, Ex8B는 근육 아세포를 처리 하였다. Ex6A, Ex6B, Ex8A 및 칵테일 처리 된 근육 아세포는에서 프레임 제품을 보여 주었다. Ex8A 단지 30 %의 프레임 제품을 (도 7)을 보였다 칵테일 및 Ex6A / B는 100 %의 프레임의 제품을 나타내었다. 엑손 스키핑 및 복원을 확인하려면판독 프레임은, cDNA의 서열 분석을 실시 하였다; 9 사실 (도 7) 스킵되었던 - 결과가 엑손 6 것으로 나타났다. 면역은 AON 처리 개는 NT 샘플 (그림 8)에 비해 디스트로핀 양성 섬유를 증가했던 것으로 나타났다.

생체 실험에서

다양한 AON 처리 조건의 효율성을 비교하기 위해, CXMD 개 (0.5-5 세) 1.2 mg을 Ex6A 또는 다양한 용량에서 Ex6A, Ex6B 및 Ex8A의 칵테일 한 번 주사 하였다. 2 주 후, 주입, 근육 시료를 수집하고, 디스트로핀 양성 섬유의 수를 비교 DYS-1 염색. 모든 칵테일 처리 된 샘플은 NT 샘플에 비해 증가 디스트로핀 발현을 보였다. 디스트로핀 양성 섬유는 AON 투여 (그림 9) 증가 하였다. 다음과 같은 시스템IC 주입은, 야생형 (WT), NT, 칵테일 처리 CXMD 근육 샘플 DYS-1 (도 10)으로 염색 하였다. 칵테일 처리 CXMD 개는 CT와 심장 근육 샘플 모두, NT CXMD 개에 비해 디스트로핀의 발현을 증가 보였다. 그러나, AON 처리 골격근 (CT)의 처리에 비하여 심근 디스트로핀의 더 높은 발현을 보였다. WT, NT, 다양한 모르 폴리 노 칵테일 처리 된 근육을 비교 면역이 같은 결론을 이끌어 냈다. 처리 된 골격 근육 샘플에서 디스트로핀 식의 큰 범위는 (그림 10)도 있었다. 헤 마톡 실린 및 에오신 (HE) 염색 CXMD를 ​​처리 한 것으로 나타났다 NT 개 CXMD 개 (도 11)에 비해 중앙 핵 섬유 (CNF)의 상당한 감소와 개선 된 병리를 보였다. 이것은 NT 개에서 발생하는 더 퇴보 / 재생, 이영 근육 병리의 표시가 나타냅니다. 또한, 처리 개는 빨리했다임상 등급 규모에 배 향상된 점수를 실행할 수 있습니다. 치료 CXMD 개는 모든 범주에서 NT CXMD 개 (그림 12)보다 더 나은 점수를 보였다.

그림 1
CXMD 강아지와 엑손 6 그림 1. 돌연변이 패턴 -. 안티센스 칵테일을 사용하여 8 건너 뛰기 전략 CXMD 개는 이영 개의 mRNA의 엑손 7의 손실로 이어지는 엑손 6의 점 돌연변이가있다. 이 mRNA를 분실 아웃 오브 프레임과 디스트로핀 단백질 생산되는 결과. AON 칵테일 처리 개에 회색 막대가 짧은 AON 시퀀스를 나타내는 8 - 짧은 AON 서열은 효과적으로 6 엑손을 건너 뛰는 mRNA의 접합 결과 6, 8, 엑손에 결합하도록 설계되었습니다. 엑손 9는 힌지 도메인을 코딩 때로는 자발적 짧은 단백질이지만 함수 디스트로핀위한 엑손 6 및도 8에 대해 AONs 얻어진 mRNA의 코드를 접합되고알은. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
1 세 개 X-연결된 근육 영양 장애 (CXMD) 동물 그림 2. 주요 임상 증상. 1 년 된 야생 형 비글과 CXMD 개 표시됩니다. 근위, 사지, 시간적 근육의 참여는 일반적으로 세 2 개월에서 관찰된다. 공동 구축 및 골반의 이동이 세 4 개월 명백한입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
) Intramuscul 개. A에 대한 그림 3. 전신 마취아칸소 주사 및 근육 생검은 이소 플루 란과 전신 마취하에 수행됩니다. B) 전신 주사에 대한 동물의 들고. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
야생형도 4의 자기 공명 영상 (MRI)을 CXMD 비 처리 및 CXMD를 처리 하였다. 뒷다리의 MRI 스캔 3 개월 WT 및 NT 개 CXMD 5 개월. 및 AON의 후 분사 (첫 번째 주입 전에 일주) 처리 CXMD 뒷다리 자기 공명 영상 사전의 두 샘플 이미지가 표시됩니다. 2703MA 200 ㎎ / ㎏ 칵테일 morpholinos와 7 배 주간을 처리 하였다. 2001MA 120 밀리그램 / kg 칵테일 morpholinos의 배 주간 IV 주입으로 처리 하였다. 제어 및 처리 개는 나이 일치했다. 처리 된 개는 T2 신호를 감소 보여줍니다. 이미지는 ADAP 있습니다 요코타 등의 등의 허가와 테드. (저작권 2009 년, 존 와일리 & 선즈) (40)는 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 5. 근육 개. A에 대한 생검 절차) 낮은 사지 근육 생검에 대한 고정된다. B) 포셉의 도움으로, 더 낮은 사지가 개최됩니다. 다) CT 근육이 노출된다. 오픈 생검 기술은 주사 부위의 근육 샘플들을 획득하기 위해 사용된다. 스레드 생검 샘플을 유지하는 데 사용됩니다. 절개 후 트라가 칸트 검에 D) 근육 샘플. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

/53776/53776fig6.jpg "/>
그림 6. 세미 드라이 전송 방법. 웨스턴 블로 팅의 반 건조 전송 방법의 표현이 표시됩니다. 집중 양극 버퍼에 배어 세 논문은 음극 단자에 규정되어있다; 애노드 버퍼에 담가 3 논문이 위에 적층된다. MB의 PVDF 페이퍼 6 종이 위에 배치되기 전에 메탄올과 양극 완충액에 침지된다. 음극 버퍼에 침지 된 겔은, 상기 PVDF 종이 위에 부드럽게 뻗어있다. 마지막으로, 음극 버퍼에 담가 3 논문 겔의 상부에 배치된다. 양극 단자 상부에 설정된다. 1 시간 동안, mA이 시스템을 통해 실행된다 (400). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 7
그림 7. CXMD 근육 아세포에서 엑손 스키핑. 등. 허가와 적응 (저작권 2009 존 와일리 & 선즈) 40. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 8
그림 8. 증가 Dystrop2'O - 메틸화 포스 (2'OMePS)에 힌 식 트랜 CXMD 근육 아세포. CXMD의 근육 아세포 단독 Ex6A 또는 칵테일 2'OMePS로 형질 감염시켰다. DYS-2 (빨강)과 DAPI (파란색) 염색이 표시됩니다. 처리 된 근육 아세포는 야생형 (WT) 및 비 처리 된 (NT) 아세포에 비교된다. 이미지는 요코타 등의 등의 허가를 맞게된다. (저작권 2009 존 와일리 & 선즈) 40. 바 = 50 μm의. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 9
근육 혼자 CXMD 개. 어느 Ex6A에서 Morpholinos의 주입 또는 Ex6A, Ex6B 및 Ex8A의 칵테일 디스트로핀 식의 그림 9. 구조는 CXMD 개의 CT 근육에 주입했다. 야생형의 디스트로핀 (DSY-1) 염색(WT), (NT) 비 처리 및 처리 CXMD 개가 표시됩니다. 개는 단독으로 1.2 mg을 Ex6A 또는 1.2 mg의 칵테일로 처리 하였다. 이미지는 요코타 등의 등의 허가를 맞게된다. (저작권 2009 존 와일리 & 선즈) 40. 바 = 100 μm의. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 10
CXMD 개. 디스트로핀의 전신 칵테일 모르 폴리 노 처리 (DYS-1) 후 그림 10. 증가 디스트로핀 표현은 염색 (NT) (음성 대조군) 비 처리, 야생형 (WT) (양성 대조군)에 디스트로핀 식을 비교하는 데 사용되었다 및 CXMD 개는 / kg 모르 폴리 노 칵테일 (각 AON 40 ㎎ / ㎏) 120 mg을 처리 하였다. 모르 폴리 노 칵테일 Ex6A, Ex6B 및 Ex8A 포함되어 있습니다. 개는 정맥 5 회 주사 하였다 우리이 칵테일 ekly. A) 디스트로핀 (WT), NT의 두개골 경골 (CT) 근육의 표현 및 처리 강아지의 비교. B) NT 및 모르 폴리 노 칵테일 처리 개 사이의 심장 조직에서 디스트로핀 식의 비교. 로딩 제어와 같은 최근 desmin과 디스트로핀에 대한 C) 면역 블롯은 WT, NT, 및 모르 폴리 노 칵테일 처리 개에 대해 표시됩니다. 다음 근육 치료 개를위한 표시됩니다 : 삼두근 상완 (TB), 상완 이두근 (BB), 다이아 프램 (DIA), 식도 (ESO), CT는 내전근 (ADD), 신근 심지 longus (EDL), 턱 (MAS) 마음. 이미지는 요코타 등의 등의 허가를 맞게된다. (저작권 2009 존 와일리 & 선즈) 40. 바 = 200 μm의. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 11
그림CXMD 개에서 조직 병리학 개선 11. 240 ㎎ / ㎏ 모르 폴리 노 칵테일로 7 주 동안 치료. 반 년에서 5 세까지의 CXMD 개는 일단 240 ㎎ / ㎏ 모르 폴리 노 칵테일 (Ex6A, Ex6B 및 Ex8A)을 정맥 주사 하였다 칠주에 대한 주. 열네 일 마지막 주사 후, 식도 근육이 촬영하고 헤 마톡 실린 및 에오신 (HE) 염색을 시행 하였다. HE 비 처리 (NT)에서 식도 근육의 염색 및 모르 폴리 노 칵테일 처리 (치료) CXMD 개 (40X 대물 렌즈). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 12
임상 등급에 그림 12. 향상된 점수와 모르 폴리 노 치료. 모르 폴리 노 처리 개 후 러닝 타임 15m는 비 처리 (NT) 한배의 새끼 비교 하였다에스. 그래프에서 오차 막대는 SEM을 나타냅니다. A) 임상 시험 성적 합계 스코어 치료 전후 산출하고, 처리 된 동물들은 NT 한배 새끼를 비교 하​​였다. B) 처리 및 NT 개 15m 실행 시간의 비교. B와 마찬가지로 C); 그러나, 이하의 개를 사용 하였다. 이미지가 요코타 등. 허가와 적응 (저작권 2009 존 와일리 & 선즈) 40. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

안티센스 올리고 뉴클레오티드 염기 서열
Ex6A GTTGATTGTCGGACCCAGCTCAGG
Ex6B ACCTATGACTGTGGATGAGAGCGTT
Ex8A CTTCCTGGATGGCTTCAATGCTCAC

표 1. 안티센스 올리고 뉴클레오티드 디자인.

Discussion

엑손 스키핑은 DMD의 치료를위한 유망한 치료 기술이다. 모두 시험 관내 및 생체 실험에서 멀티 엑손 스킵이 가능한 것으로 나타났다. 여기서, CXMD 개 모델의 사용이 설명되어 있습니다. 2'OMePS AON 화학은 CXMD의 근원 세포의 형질 전환 및 모르 폴리 노의 AON 백본 화학 생체 실험을 위해 선택되었다에 사용 된 8 - 첫째, AONs는 디스트로핀의 엑손 (6)를 대상으로 구조-ESE 및 ESEfinder 프로그램을 사용하여 설계되었다. vPMOs는 수정되지 않은 PMOS보다 더 효율적이지만 그들의 높은 독성으로 인해 그들은 전신 주사에 적합하지 않습니다. RNA 추출, RT-PCR 및 cDNA의 염기 서열은 CXMD의 아세포상에서 수행 하였다. PMO 칵테일 주사 개는 임상 증상에 어떤 개선을 평가하는 임상 등급 화했다. 개는 인도적으로 안락사시킨 후, 근육 샘플 촬영 및 극저온 절편을 준비 하였다. A로 유도 디스트로핀 단백질의 반감기2개월 - 기능은 약 1로 여겨지고 있습니다. 이 실험은 신생아 개 (5 세>) 이전 개를 사용하여 수행 할 수 있지만 젊은 성인 개는이 연구에 사용되었다. 준비 근육 섹션은 조직 병리학을 평가하고 웨스턴 블롯 및 면역 조직 화학 (48)를 통해 디스트로핀 단백질 구조를 평가하기 위해 사용되었다.

PMO 용액의 부피가 주입 전에 올바른지 확인하는 것이 중요하다; 그렇지 않을 경우 결과에 상당한 영향을 미칠 것입니다. 근육 주사 동안, 충분한 압력이 근육 섬유를 입력 할 필요가있다. 개 건강과 수술 부위의 검사 모니터링은 문제 해결을 위해 중요하다. 동물의 상태를 모니터링하기 위해, 매주 혈액 검사와 무게가 수행해야합니다. 동물 근육 샘플 준비 euthanization 후, 디스트로핀 단백질의 검출 감도를 확보하기위한 중요한 단계는 트리스 - 아세테이트 젤, 세미 드라이 블롯 방법 모두를 사용하는웨스턴 블로 팅 절차를 수행하는 동안.

대표적인 결과에 도시 된 바와 같이, 근육 아세포는 프레임 내 DMD 제품 제조 Ex6A, Ex6B, Ex8A 및 칵테일 (Ex6A, Ex6B, Ex8A 함유하고 Ex8B)로 처리 하였다. Ex8B 더 엑손 스킵 제품을 생성하지 않기 때문에, 이는 생체 내 실험에서 이후에 사용되지 않았다. 9 건너 뛰기 발생한 DYS-2 염색과 면역 세포 치료 샘플에서 디스트로핀 식을 복원 보였다 - cDNA의 염기 서열은 엑손 6 것으로 나타났다. AON 처리 된 개는 디스트로핀 양성 섬유의 상당한 증가를 나타내었다. 8 생략되고하고 단축 단백질이 생성되었다 -이 엑손 6가 있음을 나타냅니다. 디스트로핀 양성 섬유의 양은 AONs의 칵테일을 사용했을 때 증가 AON 투여 량에 비례 하였다. 면역 블롯은 전신 모르 폴리 노 처리 개에서 디스트로핀의 발현을 증가 보였다. 골격근은 디스트로핀 섬유의 가변 레벨을 가지고; 그러나, 모르 폴리 노 - 처리 된 심장 조직이 약간 보였다디스트로핀 발현의 향상. 디스트로핀은 높은 분자량 (427 kDa의)을 갖기 때문에, 디스트로핀 소량의 검출이 어려울 수있다. 최상의 결과를 위해, 트리스 - 아세테이트 겔 및 세미 드라이 전사 방법을 사용 하였다. 그는 모르 폴리 노 처리 강아지의 개선 조직 병리학을 보였다의 염색. 중앙 핵 섬유 (CNFs)는 건강에 해로운 근육의 표시이며, 근육의 변성과 재생의주기를 나타냅니다. 모르 폴리 노 - 처리 CXMD 개는 비 처리 CXMD 개 비교 CNFs의 비율의 감소를 보였다. 임상 등급은 모르 폴리 노 처리 된 동물에서 증가 산책과 실행 능력과 같은 증상의 개선을 밝혔다. 근육의 경도 따라서,이 등급 체계 (59)에 포함 된 근육 위축을 반영하는 것으로 생각된다. 대퇴부 (뒷다리) 근육의 경도를 평가 하였다; 그들은 CXMD에 비대보다는 위축을 나타내는 경향이 있기 때문에, 우리는 뇌 SARTORIUS 근육을 제외. 치료 개 표시낮은 등급의 점수를 에드와 15m 주행 시험에 빠른 시간을 가졌다. 15m 시험에 개선 된 시간은 개선 된 근육 기능 (40)을 나타내는입니다. 높은 전체 등급 점수는 건강이 좋지 증가 근육의 위축을 나타냅니다.

이러한 결과는 유망하지만, 멀티 - 엑손 스킵 여전히 임상 기술을 적용하기 전에 극복해야 할 많은 과제를 제시한다. 심장 조직은 여전히​​ 인해 심장과 골격 조직 사이의 세포 인신 매매의 차이로 AONs, 가능성의 감소 흡수를 표시합니다. 독성 효과는 현재 투여 섭생하에 동물에서 관찰되지 않았다; AON 칵테일의 사용은 임상 시험으로 이동하기 전에 그러나, 많은 작업 장기 독성을 평가하기 위해 수행 할 필요가있다. 규제 기관 고유 약물 각 AON 순서를 정의하기 때문에 AON 칵테일 약물에 대한 승인을 얻기 어렵다. 이 칵테일의 각 시퀀스는 개별적으로 보안 시스템을 테스트 할 필요가 있음을 의미Y는 더 많은 시간과 더 많은 돈을 요구. 임상 환경에서 멀티 엑손 스킵를 사용하는 또 다른 장벽 미지 함수 생성 중간 단백질 제품의 많은 양이다. 이 단백질은 잠재적으로 개인 돌연변이 (22)에 따라 예측할 수없는 부작용을 초래할 수 있습니다. 또한, 현재의 이영 개 모델에서 사용 가능한 돌연변이 패턴이 제한됩니다. 이 몇 자연 발생적인 돌연변이가 있고, 모든 돌연변이는 멀티 엑손 스키핑을 연구하는 데 유용하지. 이영 돼지 모델은 미래의 DMD 엑손은 연구 33, 34을 건너 뛰는에 대한 좋은 대안이 될 것을 약속드립니다.

DMD 개 모델은 다른 DMD의 모델에 비해 몇 가지 장점이있다. 더 큰 동물 모델 임상 등급 인 및 MRI보다 자세한 분석을 위해 허용 가능하다. 개는 큰 동물이기 때문에 그들은 또한 독성 연구에 더 적합하고 더 밀접하게 마우스 모델에 비해 인간의 질병을 나타냅니다. 개 models 또한 인간 23, 34, 45에 더 유사하다 DMD 유전자 서열을 가지고있다.

기술적 도전이지만, 멀티 엑손 스킵 방식은 궁극적 DMD 환자 24> 90 % 유익 할 수있다. 단일 엑손 스키핑 환자의 작은 부분 집합에만 적용 이것은, 그것은 단일 엑손 스키핑에 더 나은 대안이 있습니다. 또한, 멀티 - 엑손 스키핑은 단축 디스트로핀 단백질의 기능을 최적화 삭제 패턴을 선택하기 위해 사용된다. (55) 매우 가벼운 증상 또는 무증상 개인 14,19,60-63와 관련된 - 예를 들어, DMD의 삭제는 45 엑손. 엑손 (45)의 멀티 - 엑손 스킵 - 55 이미 vPMOs 22,26 전신 주사를 사용하여 엑손 52 삭제 (mdx52)과 DMD의 마우스 모델에서 입증되었다. 칵테일 vPMOs의 사용은 또한 근이영양증 다른 형태의 예에서 설명 된후쿠야마 선천성 근이영양증 (FCMD) 등. FCMD은 비정상적인 mRNA의 접합이 레트로 트랜스포존의 삽입으로 인해 발생하는 엑손 트래핑에 의해 발생합니다. vPMOs는 둘 다 FCMD 마우스 모델과 인간 세포주 (64)의 접합 패턴을 구하기 위해 도시되었다. 높은 효능과 낮은 독성을 나타내는 차세대 AON 화학 임상 응용에 멀티 엑손 스킵 방식의 효과적인 번역을 용이하게한다. 또한, 멀티 - 엑손 스킵 잠재적 예 dysferlinopathies 24, 65 등의 다른 유전 질환에 적용 할 수있다.

Materials

Name Company Catalog Number Comments
2'OMePS Transfection of Dog Myoblasts 
3 ml 6-well plates IWAKI 5816-006
Dulbecco’s modified Eagle’s medium (DMEM)  Gibco 11965-092
Fetal bovine serum (FBS)  HyClone SH30071.01
Penicillin  Sigma-Aldrich  P4333  200 U/ml 
Lipofectin  Invitrogen  18292-011 Total volume of 100 ml in opti-MEM media at a ratio of 2:1 for lipofectin. 
10 ml lipofectin for 5 mg RNA. 
2’OMePS Eurogentec  Ex6A (GUU GAUUGUCGGACCCAGCUCAGG), Ex6B (ACCUAUGA CUGUGGAUGAGAGCGUU), and Ex8A (CUUCCUGG AUGGCUUCAAUGCUCAC). 
Horse Serum  Gibco 16050-114 2%
streptomycin  Sigma-Aldrich P4333  200 μg/ml
Bovine serum albumin (BSA)  Sigma-Aldrich A9418 
Insulin
Morpholino transfection of dog myoblasts
All material from MePS Transfection of Dog Myoblasts for culturing
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
Endo-Porter Gene-tools
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT-PCR)
guanidinium thiocyanate-phenol-chloroform Invitrogen 15596-018 1 ml/plate
Chloroform Sigma-Aldrich P3803 200 μl 
1.5 ml Tubes  Eppendorf 22363204
Centrifuge  Beckman-Coulter
75% Ethanol  Sigma-Aldrich 34852
UV Spectrometer 
Forward primer in exon 5  Invitrogen CTGACTCTTGGTTTGATTTGGA                          
1.5 μl 10 μM
Reverse primer in exon 10  Invitrogen TGCTTCGGTCTCTGTCAATG                            
1.5 μl 10 μM
dNTPs Clontech 3040
One-Step RT-PCR kit  Qiagen  210210
Thermo-cycler Scinco
Complementary DNA (cDNA) Sequencing 
Gel extraction kit  Qiagen  28704
Centrifuge 
Terminator v3.1 Cycle Sequencing Kit  Applied Biosystems  4337454
Intramuscular injections or open muscle biopsy
Surgical Tools Scissors, scalpel, needle, surgical thread 
Vet Ointment 
Iodophors  webtextiles 12190-71-5
chlorohexidine Peridex 12134
Surgical Drapes 
Scrubs
Facial Mask 
Surgical Gloves 
Head Covering 
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Antisense morpholinos  Gene-tools Ex6A(GTTGATTGTCGGACCCAGC
TCAGG),
Ex6B(ACCTATGACTGTGGATGAG
AGCGTT), 
Ex8A(CTTCCTGGATGGCTTCAAT
GCTCAC)                          
Dilute to a final volume of 100 L in opti-MEM media.                  
120–200 mg/kg of morpholinos at 32 mg/ml in saline
27 G Needles TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225
buprenorphine hydrochloride
Tongue Depressor 
cephalexin 15 to 30 mg/kg 
cefazolin 15 to 30 mg/kg 
buprenorphine  0.01 mg/kg
buprenorphine hydrochloride  0.02 mg/kg
Systemic Injections
Syringe infusion pump  Muromachi 
22 G Indwelling needles TERUMO SG3-2225 
27 G Needles  TERUMO  SG3-2325 
50 ml syringe TERUMO SG2-03L2225 
Saline Ohtsuka-Pharmaceutical 28372
Clinical Grading of Dogs
Video Camera 
Stop watch 
Magnetic resonance imaging (MRI) 
3 Tesla MRI l 
18 cm diameter/18 cm length human extremity coil
Muscle sampling and preparation (necropsy)
Thiopental sodium  Mitsubishi Tanabe Pharma  20 mg/kg 
Isoflurane Abbott laboratories  05260-05 2-3%
Tragacanth gum 10-20 ml
Liquid Nitrogen 
Cork Discs Iwai-kagaku  101412-806
Dry Ice
Tweezers
Poly-L-lysine–coated slides Fisher 22-037-216
Cryostat Microsystem  Leica  cm1900 
Immunohistochemistry 
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
DYS2 Novocastra  NCL-DYS2  1:150 dilutions
Alexa 594 goat antimouse IgG1  Invitrogen A-21125 1:2,500 dilutions
Alexa 594 goat antimouse IgG2  Invitrogen A-11005 1:2,500 dilutions
DAPI  Invitrogen D1306 Contains mounting agent
Goat Serum  Invitrogen 10000C 15%
PBS
Moisture chamber  Scientific Devise Laboratory  197-BL
Chamber slide  Lab-tek  154453
Cover Glasses  Fisher 12-540A
Hydrophobic barrier pen 
Fluorescent microscope  594 nm at 20X magnification. 
Western Blotting 
Distillied Water 
Hand Homogenizer 
2× Laemmli SDS-loading buffer  0.1 M Tris–HCl (pH 6.6), 2% (w/v) SDS, 2% (0.28 M) beta-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue 
SDS gels  Bio-Rad  161-1210 5% resolving
SDS gels Invitrogen  Invitrogen, WG1601BOX 3-8%
PVDF membrane  GE 10600021
Methanol
Running buffer (10×)  250 mM of Tris-Base, 1,920 mM of Glycine
Running buffer (1×) 10% 10× buffer, 20% methanol 
0.05% PBS/Tween 20 (PBST)  2,000 ml              
3× 200 ml for washing
PBST/5% milk powder  100 ml
Protein Assay Kit BCA T9650
Tween 20  Sigma  P5927
Urea Sigma  U5378
Beta Mercaptoethanol  Millipore ES-007-E
SDS Sigma L3771
Tris-Acetate Sigma
Tris HCl Sigma T3253
Glycerol Sigma G8773
Loading/sample buffer for Western blotting NuPage Invitrogen NP007
NaCl Sigma S3014
PMSF Sigma P7626
Protease cocktail inhibitor  Roche 11836153001
Cathode Buffer 0.025 M Tris base + 40 mM 6-aminocaproic acid + 20% Methanol
Anode Buffer 0.03 M Tris Base + 20% Methanol
Concentred Anode Buffer 0.3 M Tris base + 20% Methanol
desmin antibody  Abcam ab8592
DYS1  Novocastra  NCL-DYS1  1:150 dilutions 
ImageJ Software

DOWNLOAD MATERIALS LIST

References

  1. Duchenne, A. The Pathology of Paralysis with Muscular Degeneration (Paralysie Myosclerotique), or Paralysis with Apparent Hypertrophy. Br Med J. 14, (2), 541-542 (1867).
  2. Zellweger, H., Antonik, A. Newborn screening for Duchenne muscular dystrophy. Pediatrics. 55, (1), 30-34 (1975).
  3. Echigoya, Y., Yokota, T. Skipping multiple exons of dystrophin transcripts using cocktail antisense oligonucleotides. Nucleic Acid Ther. 24, 57-68 (2014).
  4. Bushby, R. F., Birnkrant, D. J., et al. Diagnosis and management of Duchenne muscular dystrophy, part 1: diagnosis, and pharmacological and psychosocial management. The Lancet Neurology. 9, (1), 77-93 (2010).
  5. Eagle, M., Baudouin, S. V., Chandler, C., Giddings, D. R., Bullock, R., Bushby, K. Survival in Duchenne muscular dystrophy: improvements in life expectancy since 1967 and the impact of home nocturnal ventilation. Neuromuscul. Disord. 12, (10), 926-929 (2002).
  6. Heald, A., Anderson, L. V., Bushby, K. M., Shaw, P. J. Becker muscular dystrophy with onset after 60 years. Neurology. 44, (12), 2388-2390 (1994).
  7. Stöllberger, C., Finsterer, J. Worsening of heart failure in Becker muscular dystrophy after non-steroidal anti-inflammatory drugs. Med. J. 98, (4), 478-480 (2005).
  8. Passamano, L., et al. Improvement of survival in Duchenne Muscular Dystrophy: retrospective analysis of 835 patients. Acta Myol. 31, (2), 121-125 (2012).
  9. Hoffman, E. P., Brown, R. H., Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 51, (6), 919-928 (1987).
  10. Koenig, M., et al. Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50, (3), 509-517 (1987).
  11. Takeshima, Y., et al. Mutation spectrum of the dystrophin gene in 442 Duchenne/Becker muscular dystrophy cases from one Japanese referral. JHG. 55, (6), 379-388 (2010).
  12. White, S. J., et al. Duplications in the DMD gene. Hum. Mutat. 27, 938-945 (2006).
  13. Yokota, T., Duddy, W., Echigoya, Y., Kolski, H. Exon skipping for nonsense mutations in Duchenne muscular dystrophy: too many mutations, too few patients. Expert Opin. Biol. Ther. 12, (9), 1141-1152 (2012).
  14. Yokota, T., Duddy, W., Partridge, T. Optimizing exon skipping therapies for DMD. Acta Myol. 26, (3), 179-184 (2007).
  15. Magri, F., et al. Genotype and phenotype characterization in a large dystrophinopathic cohort with extended follow-up. J Neurol. 258, (9), 1610-1623 (2011).
  16. Yoshida, H. H., Ishikawa-Sakurai, M. Biochemical evidence for association of dystrobrevin with the sarcoglycan- sarcospan complex as a basis for understanding sarcogly- canopathy. Hum. Mol. Genet. 9, (7), 1033-1040 (2000).
  17. Bies, R. D., Caskey, C. T., Fenwick, R. An intact cysteine-rich domain is required for dystrophin function. J. Clin. Invest. 90, (2), 666-672 (1992).
  18. Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H., Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics. 2, (1), 90-95 (1988).
  19. Aoki, Y., Yokota, T., Wood, M. J. Development of multiexon skipping antisense oligonucleotide therapy for Duchenne muscular dystrophy. Biomed Res Int. 2013, (402369), (2013).
  20. Cirak, V. A. -G., Guglieri, M., et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. The Lancet. 378, (9791), 595-605 (2011).
  21. Goemans, N. M., et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 364, (16), 1513-1522 (2011).
  22. Echigoya, Y., et al. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45-55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol Ther Nucleic Acids. 4, (2015).
  23. Hoffman, E. P., et al. Restoring dystrophin expression in Duchenne muscular dystrophy muscle progress in exon skipping and stop codon read through. Am J Pathol. 179, (1), 12-22 (2011).
  24. Aartsma-Rus, A., et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 74, (1), 83-92 (2004).
  25. Aartsma-Rus, A., Kaman, W. E., Weij, R., Tden Dunnen, J., van Ommen, G. J., van Deutekom, J. C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol. Ther. 14, (3), 401-407 (2006).
  26. Aoki, Y., et al. Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery. Proc Natl Acad Sci U S A. 109, (34), 13763-13768 (2012).
  27. McClorey, G., Iversen, P. L., Moulton , H. M., Fletcher, S., Wilton, S. D. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13, (19), 1373-1381 (2006).
  28. Sharp, N. J., et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 13, (1), 115-121 (1992).
  29. Shimatsu, Y., et al. Canine X-linked muscular dystrophy in Japan (CXMDJ). Exp Anim. 52, (2), 93-97 (2003).
  30. Nguyen, F., Cherel, Y., Guigand, L., Goubault Leroux, I., Wyers, M. Muscle lesions associated with dystrophin deficiency in neonatal golden retriever puppies. J Comp Pathol. 126, (2-3), 100-108 (2002).
  31. Nakamura, A., Takeda, S. Mammalian models of Duchenne Muscular Dystrophy: pathological characteristics and therapeutic applications. J Biomed Biotechnol. 2011, (184393), (2011).
  32. Yokota, T., et al. A renaissance for anti-sense oligonucleotide drugs in neurology: Exon-skipping breaks new ground. Arch. Neurol. 66, 32-38 (2009).
  33. Aartsma-Rus, A., et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum. Mutat. 30, (3), 293-299 (2009).
  34. Yu, X., Bao, B., Echigoya, Y., Yokota, T. Dystrophin-deficient large animal models: translational research and exon skipping. Am. J. Transl. Res. 7, (8), 1214-1231 (2015).
  35. Yin, H., Moulton, H., Betts, C., Wood, M. CPP-directed oligonucleotide exon skipping in animal models of Duchenne muscular dystrophy. Methods Mol Biol. 683, 321-338 (2011).
  36. Moulton, H. M., Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta. 1798, (12), 2296-2303 (2010).
  37. Morcos, P. A., Li, Y., Jiang, S. Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. BioTechniques. 45, (6), 613-614 (2008).
  38. Betts, C., et al. A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Mol Ther Nucleic Acids. 14, (1), e38 (2012).
  39. Saito, T., et al. Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient. PLoS One. 5, (8), e12239 (2010).
  40. Yokota, T., et al. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol. 65, (6), 667-676 (2009).
  41. Melacini, P., et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromuscul. Disord. 6, (5), 367-376 (1996).
  42. Guncay, A., Yokota, T. Antisense oligonucleotide drugs for Duchenne muscular dystrophy: how far have we come and what does the future hold. Future Med. Chem. 7, (13), 1631-1635 (2015).
  43. Recognition and Alleviation of Pain and Distress in Laboratory Animals. National Research Council (US) Committee on Pain and Distress in Laboratory Animals. Distress in Laboratory Animals . National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK32658 (1992).
  44. Guide for the Care and Use of Laboratory AnimalsPhysical Restraint. National Research Council (US) Institute for Laboratory Animal Research. National Academic Press (US). Available from: http://www.ncbi.nlm.nih.gov/books/NBK54050 (1996).
  45. Fairbrother, W. G., Yeh, R. F., Sharp, P. A., Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science. 297, 1007-1013 (2002).
  46. Cartegni, L., Wang, J., Zhu, Z., Zhang, M. Q., Krainer, A. R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31, 3568-3571 (2003).
  47. Fairbrother, W. I. 11, Goldstein, P. RESCUE-ESE Web Server. MIT Burge Lab. Available from: http://genes.mit.edu/burgelab/rescue-ese/ (2016).
  48. Yokota, T., Hoffman, E., Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol Biol. 709, 299-312 (2011).
  49. Jenuth, J. P. The NCBI. Publicly available tools and resources on the Web. Methods Mol Biol. 132, 301-312 (2000).
  50. Yokota, T., et al. Extensive and Prolonged Restoration of Dystrophin Expression with Vivo-Morpholino-Mediated Multiple Exon Skipping in Dystrophic Dogs. Nucleic Acid Ther. (2012).
  51. Summerton, J. E. Endo-Porter: a novel reagent for safe, effective delivery of substances into cells. Ann. N. Y. Acad. Sci. 1058, 62-75 (2005).
  52. Mangram, A. J., et al. Guideline for Prevention of Surgical Site Infection. Am J Infect Control. 27, 97-134 (1999).
  53. Reichman, D. E., Greenberg, J. A. Reducing Surgical Site Infections. A Review . Rev Obstet Gynecol. 2, 212-221 (2009).
  54. Mizuno, H., Nakamura, A., Aoki, Y., Ito, N., Kishi, S., Yamamoto, K., Sekiguchi, M., Takeda, S., Hashido, K. Identification of muscle-specific microRNAs in serum of muscular dystrophy animal models: promising novel blood-based markers for muscular dystrophy. PloS one. 6, (2011).
  55. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 145-154 (2005).
  56. Evans, H., de Lahunta, A. Guide to the Dissection of the Dog. SAUNDERS. (2009).
  57. Girish, V., Vijayalakshmi, A. Affordable image analysis using NIH Image/ImageJ. Indian J Cancer. 41, (47), (2004).
  58. Bearer, E. L., et al. Overview of image analysis, image importing, and image processing using freeware. Current protocols in molecular biology. 14, (2003).
  59. Shimatsu, Y., et al. Major clinical and histopathological characteristics of canine X-linked muscular dystrophy inJapan, CXMDJ. Acta Myol. 24, 145-1454 (2005).
  60. Beroud, C., et al. Multiexon skipping leading to an artificial DMD protein lacking amino acids from exons 45 through 55 could rescue up to 63% of patients with Duchenne muscular dystrophy. Hum Mutat. 28, 196-202 (2007).
  61. Ferreiro, V., et al. Asymptomatic Becker muscular dystrophy in a family with a multiexon deletion. Muscle Nerve. 39, 239-243 (2009).
  62. Nakamura, A., et al. Follow-up of three patients with a large in-frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci. 15, 757-763 (2008).
  63. Yokota, T., Pistilli, E., Duddy, W., Nagaraju, K. Potential of oligonucleotide-mediated exon-skipping therapy for Duchenne muscular dystrophy. Expert Opin Biol Ther. 7, 831-842 (2007).
  64. Taniguchi-Ikeda, M., et al. Pathogenic exon-trapping by SVA retrotransposon and rescue in Fukuyama muscular dystrophy. Nature. 478, 127-131 (2011).
  65. Lee, J. J., Yokota, T. Antisense therapy in neurology. J Pers Med. 3, 144-176 (2013).
송곳니 X-연결된 근육 영양 실조에 칵테일 안티센스 올리고 뉴클레오티드를 사용하여 건너 뛰기 멀티 엑손
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).More

Miskew Nichols, B., Aoki, Y., Kuraoka, M., Lee, J. J. A., Takeda, S., Yokota, T. Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy. J. Vis. Exp. (111), e53776, doi:10.3791/53776 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter