Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Padronização Subtractive rápida de camadas de células vivas com uma Probe microfluídicos

Published: September 15, 2016 doi: 10.3791/54447

Abstract

A sonda microfluídico (MFP) facilita a execução de química local sobre substratos biológicos, confinando volumes nanolitros de líquidos. Usando uma implementação específica do MFP, o confinamento fluxo hidrodinâmico hierárquica (hHFC), vários líquidos são simultaneamente postos em contato com um substrato. ação química local e formação de líquido usando o hHFC, é explorada para criar padrões celulares por lise e remover células localmente. Ao utilizar a capacidade de digitalização da MFP, padrões definidos pelo usuário de monocamadas de células são criadas. Este protocolo permite a rápida, em tempo real e padronização de células espacialmente controlada, o que pode permitir a célula-célula e célula-selectiva de matriz estudos de interacção.

Introduction

Em seu ambiente nativo, as células em tecidos biológicos perceber uma série de pistas bioquímicas e físicas que dirigem o seu crescimento, organização e desenvolvimento. Entender essas pistas requer investigação seletiva de interações célula-célula e célula-matriz. Isto requer o desenvolvimento de métodos para monocamadas de células padronização. Métodos para diferentes tipos de células geometricamente separados em cultura (padronização) permitem amplos estudos de pistas físicas e químicas em biologia celular. A maioria das abordagens actuais para as camadas de células padronização 1-4 dependem depositar proteínas de adesão a células em superfícies ou utilizando matrizes microfabricados para o crescimento selectivo em substratos. Em contraste, aqui se apresenta um método para rapidamente monocamadas de células padrão in situ, isto é, as células em cultura, por remoção das células em regiões seleccionadas da monocamada. Métodos que executam tais subtrativo padronização 5-9 usually requerem substratos especializados, tratamento de superfície, operação complexa, de contato físico ou ablação usando um laser, afetando inadvertidamente as células vivas. Nós aqui usam uma sonda microfluídico (MFP) 10,11, um não-contato de varredura tecnologia microfluídica que hydrodynamically confina um líquido sobre um substrato. Um componente importante do MFP é a cabeça microfabricated contendo microcanais (Figura 1). A plataforma associado consiste em bombas de seringa para controle de líquidos, estágios para a digitalização de controle e um microscópio invertido para visualização e feedback (Figura 2). Na sua configuração básica, a cabeça MFP compreende dois microcanais com aberturas no ápice, um para injectar um líquido de processamento e a outra para aspirar o líquido de processamento injectado juntamente com algum líquido de imersão (Figura 3A). Durante a operação da MFP, o ápice é a uma distância fixa a partir do substrato. Quando o caudal de aspiração (QA) é sufficiently mais elevado do que o caudal de injecção (Q i), ou seja, um Q: Q i ≥ 2,5, o líquido de processamento é confinado no substrato. Isto resulta num confinamento fluxo hidrodinâmico (HFC). A região em que o líquido de processamento está em contacto directo com o substrato é denominado a pegada. Por condições normais de funcionamento, o fluxo do líquido de processamento no interior do HFC é caracterizado por um baixo número de Reynolds (Re ≈ 10 -2) e um elevado número de Péclet (Pe 10 ≈ 2). Isto implica fluxos líquidos em regime laminar com a convecção sendo o principal modo de transferência de massa de espécies químicas. Os modelos numéricos e analíticos para confinamento fluxo são descritos em outros lugares 12-14.

Neste trabalho, usamos a abordagem de confinar simultaneamente vários líquidos de processamento, que é chamado HFC hierárquica (hHFC) 14. Para implementar hHFC com o MFP, dois additional aberturas são necessários para fornecer uma fonte secundária de injecção e aspiração. Isso nos permite confinar um líquido dentro de um segundo líquido. Os interiores benefícios (de processamento) líquidos sejam protegidos de detritos de rua sobre o substrato pelo (blindagem) externa líquida. Além disso, hHFC permite o funcionamento em dois modos: (i) o modo de aninhada, em que o líquido de processamento nos contactos HFC interior da superfície (Figura 3B), e (ii) o modo comprimido, em que o líquido interno perde o contacto e apenas o líquido exterior está em contacto com o substrato (Figura 3C). A comutação entre os dois modos permite aos utilizadores para efectuar ou interromper o processamento do substrato e é conseguida por controlo da diferença de cabeça-a-superfície ou alterando a proporção entre os fluxos de injecção (Q I2 / I1 Q). Para uma determinada geometria do canal, a pegada do líquido de processamento sobre o substrato pode ser controlada pela modulação de condições de fluxo (Figura 3D). hydr de sódioóxido (NaOH) é utilizado como líquido de processamento interno para lisar as células, e o lisado é continuamente aspirado a partir da superfície. Porque os efeitos químicos de o líquido de processamento estão localizadas à pegada HFC interior, as células adjacentes permanecem não perturbada, o que permite estudos espaço-temporais de interacções célula-célula. A funcionalidade de digitalização da MFP permite a criação de geometrias definidas pelo usuário de padrões celulares (Figura 4). Além disso, a escolha de NaOH como líquido de processamento acomoda a análise do ADN a jusante (Figura 7).

Protocol

1. MFP Cabeça e Limpeza Platform e Preparação

NOTA: Este protocolo utiliza híbrido de silício de vidro verticalmente orientada MFP dirige 15,16. O componente de silicone da cabeça contém os microcanais, que são gravados a uma profundidade de 100 um. O silício gravado está ligado ao vidro utilizando ligação anódica. O design do canal compreende um padrão que consiste em seis canais, dois para cada injecção e aspiração, e dois para injectar o líquido de imersão (Figura 1). Os canais utilizados para a injecção de líquido de imersão repor os meios que circunda a amostra biológica, evitando, assim, as perdas devido à aspiração e a evaporação. Os canais interiores e exteriores canais utilizados no trabalho atual são 100 × 100 mm e 200 x 100 mm, respectivamente. Pós fabricação e processamento, cabeças MFP com canais claros e ápices polidas são obtidos.

  1. Preparação da estação de bombeamento e fluido manipulaçãoaparelho
    1. Use capilares com um 1/16 '' (1,59 mm) de diâmetro externo e 0,02 '' (0,51 mm) de diâmetro interior para todos os tubos ligados às seringas. Varie o tamanho capilar com base na aplicação e obter os conectores e acessórios apropriados para fazer a interface da cabeça MFP com as seringas. Use água ultrapura sempre diluições são necessárias.
    2. seringas limpas (250 - 500 Volume ul) e seringas êmbolos por sonicação em solução de água sanitária 0,5% em água ultrapura to- antes e pós-experimentos com células vivas. Lave-os bem com água. Enche-os com água por imersão suas pontas completamente em um banho de água e aspiração através do êmbolo. Purga-se o líquido enquanto dentro do banho de água com o eixo de seringa contactar a vedação na saída da seringa. Repita aspirado e purga até que não há bolhas de ar são vistos nas colunas de seringa.
    3. Conectar-se cheias com as bombas de seringa, usando conectores Luer-lock. Utilize uma válvula montada no interruptorbombas para dirigir o líquido a partir da seringa para um de dois capilares que conduzem, quer à cabeça MFP ou para os reservatórios de líquidos (Figura 6). (Se nenhuma válvula de interruptor está disponível ver secção 1.4.4). Purifica ambos os capilares com água a partir das seringas com um caudal de cerca de 10 - 50 mL / min, dependendo do tamanho da seringa, até cerca de 10 ul de água é deixado nas seringas.
    4. Pré-inserir os capilares expurgados em um microfluídico conector / adaptador apropriado que interage com as vias de canal na cabeça (por exemplo, conector M1 - ver materiais).
  2. Preparação cabeça MFP
    1. Limpe a cabeça de MFP por ultra-sons utilizando detergente copos para limpeza padrão ou 0,5% água sanitária para a limpeza rigorosa, por 5 min. Purgar com canais de água por imersão do vértice em água e aplicando vácuo à Vias.
    2. Inspecione canais sob um microscópio estereoscópico para possíveis obstruções (entupimento) e returfa etapa anterior, se necessário.
    3. Monte a cabeça limpa no suporte da cabeça e do parafuso do conector com o tubo pré-inserido e purgado na cabeça. Parafuso do suporte da cabeça para a fase Z, o qual é utilizado para o controlo da distância de folga entre a cabeça e a monocamada de células.
  3. Calibrar os estágios de digitalização da plataforma MFP
    1. Executar a calibração de ponto final do X, Y e Z estágios antes de a cabeça para a plataforma, de acordo com o protocolo do fabricante com uma interface de software apropriado. estágios calibrados garantir a precisão no posicionamento da cabeça MFP.
    2. Obter uma lacuna distância bruto zero (zero), trazendo a cabeça MFP sobre uma lâmina de câmara sem células e descer lentamente em 5 mm etapas. Em contacto sonda com o substrato, anéis de Newton devem ser observadas. Esta é uma estimativa grosseira. Uma posição precisa é para ser obtido, após ajuste coplanaridade do ápice da sonda até ao substrate.
    3. Para assegurar coplanaridade do ápice sonda, ajustar a inclinação da cabeça, usando um goniómetro (na interface da cabeça e a fase Z). Quando formada assegurar que os anéis de Newton são simétricas (Figura 1). Mova o MFP cabeça 20 mm de distância do substrato e ajustar a inclinação usando o goniômetro. Repita descer, zeragem e ajuste de inclinação até anéis de Newton são simétricas em contato. Com inclinação ajustados, defina a posição z que produz anéis de Newton simétricos como zero.
      NOTA: A Z-fase controla a distância cabeça-para-substrato, enquanto que a plataforma XY controla o varrimento do substrato (Figura 2). Uma explicação detalhada pode ser encontrada no nosso trabalho anterior 14.
  4. Produtos químicos para remoção de locais de camadas de células
    Cuidado: Se for o caso, os equipamentos de segurança de uso (por exemplo, luvas de borracha nitrílica, óculos de segurança) para os produtos químicos a ser preparado. Use um hoo fumed se for necessário para a preparação de soluções. Prepare todos os produtos químicos e buffers com água ultrapura como diluente.
    1. Preparar uma solução de NaOH 50 mM como o líquido de processamento para o canal de injecção interior (I2 com I2 fluxo Q na Figura 1).
    2. Preparar a solução de tampão de extracção necessária para a injecção exterior (I1 com I1 fluxo Q na Figura 1), composto por 1 mM de ácido etilenodiaminotetracético (EDTA), 0,5% de Tween 20, e 10 ^ M de rodamina B em 50 mM de Tris (hidroximetil) aminometano em pH 8. Para purgação, use água nas seringas de aspiração.
    3. Filtrar todas as soluções que utilizam um filtro de seringa de 0,2 um. Todas as soluções desgaseifica filtrada utilizando um exsicador, até à paragem de ar dissolvido borbulhar para a superfície.
    4. Usando a linha de drenagem ligado às bombas de seringa, purgar a água remanescente e aspirar as soluções desgaseificadas para as seringas de injecção em 40? L / min, até que as seringas são cheias (250 ou 500 uL).Isso garante o enchimento sem bolhas das seringas, conectores e capilares. O sistema de válvula de dois-capilar-seringa interruptor permite o enchimento das seringas meados de experiência. Na ausência de uma tal válvula de interruptor, desligar os capilares da cabeça e encher os capilares e a seringa com aspiração das soluções desgaseificadas antes de voltar a ligar-los para a cabeça.
    5. Aspirando o processamento e blindagem líquidos através dos capilares permite a utilização de pequenos volumes durante a operação. Se os produtos químicos podem ser preparados em grandes volumes, encher seringas com as soluções directamente necessárias. Por exemplo, as seringas de aspiração que contêm água pode ser enchido usando esta abordagem.
    6. Purgar os capilares para a cabeça MFP com os líquidos alocados para cada canal, tal como definido no ponto 1.4.1 e 1.4.2.
      NOTA: A solução tampão de extracção protege o NaOH no confinamento interno e o componente de rodamina no buffer facilita a visualização de thum e hHFC durante a operação.
    7. Se as células são sobre-confluentes, com agregados de células que aparecem na superfície cultivada, completar o tampão de extracção com 10% de proteinase K. Esta complementa a acção de NaOH nestes agregados por dissolução de proteínas desnaturadas como o lisado entra nos canais de aspiração. Isto evita o entupimento dos canais durante a operação.
  5. Preparação de monocamadas de células em lâminas de câmara
    Cuidado: Use uma capa de cultura de células para a cultura das células e manusear o equipamento de acordo com os regulamentos estabelecidos pelo oficial de biossegurança do laboratório. Nota requisitos especiais de linhas de células específicas e para adaptar o protocolo e equipamentos em conformidade.
    1. Incubadoras cultura Utilização celular (5% de CO 2 e a 37 ° C) para a cultura e a expansão de células para ser modelado. Realizar a expansão por meio de protocolos de cultura de células padrão 17,18 em frascos T. Use a mídia cultura como por exigências do cel específical linha (por exemplo, soro e antibiótico suplementado DMEM para a cultura MCF7 e MDAMB 231).
    2. Em atingindo a confluência celular nos frascos de cultura, trypsinize e recolher as células e sementes de 2 x 10 5 células / cm 2 em cada uma das corrediças 2-câmara para a padronização e cultura ao longo de 48 h. Use as células em uma das câmaras como um controlo para o crescimento celular e a viabilidade.
    3. Em atingindo a confluência celular nas lâminas de câmaras, incubar as células durante 45 minutos com 500 solução de corante célula-rastreador ul (por exemplo, verde - CMFDA ou laranja - CMRA) numa concentração de 10 uM preparadas em meio isento de soro. Isto é feito para visualização celular durante padronização. Lavam-se as células marcadas com PBS por lavagem de cada câmara suavemente com uma pipeta, e, subsequentemente, as células de cultura em meio suplementado com soro para os experimentos de padronização.
    4. Obter uma imagem de referência de superfície celular da célula-manchadas de Rastreio para o propósito da contagem de células. Isto é feito para assegurarconfluência da camada de células. Além disso, ele serve como um auxílio para experimentos de quantificação se a recuperação da amostra e análise de DNA são objetivos.
      NOTA: No caso em que a viabilidade celular é para ser avaliada durante a padronização, as células podem ser coradas com um kit de citotoxicidade Live / Morto em conformidade com as instruções do fabricante.

2. Criação da Hierarchical hidrodinâmica Fluxo de Confinamento (hHFC)

  1. Mover a MFP através da monocamada de células a uma distância de folga de 50 mm a partir da lâmina de vidro. Esta distância lacuna, assegurando simultaneamente o contacto do hHFC também é responsável por superfície monocamada e variação de espessura.
  2. Injectar NaOH em 6 ou 8 mL / min através i2. Avaliar outras taxas de fluxo (isto é, Q I1, Q A1 e A2 Q) usando as regras de fluxo na Figura 3.
  3. Modular o tamanho do HFC interior, alterando a proporção de Q I2 / I1 Q utilizando as seringas de injecção.Por exemplo, usar um Q I1 entre 1,3 ul / min e 4 mL / min, com a Q I2 fixado em 8 mL / min, o que resulta em uma pegada de NaOH de 150 - 300 células (100 - 200 um 2 / célula) ( Figura 3D).
  4. Injectar meio completo a partir dos mais exterior de aberturas na cabeça da MFP, a uma taxa de fluxo de 20 ul / min para ter em conta a evaporação dos meios de comunicação e durante a operação de aspiração do hHFC.

3. monocamadas de células padronização Usando hHFC

Nota: O padrão de varrimento determina as áreas da monocamada de células em que as células são extraídas (padronização subtractiva), deixando as restantes células para estudar questões biológicas específicas. Este padrão pode ser linhas rectas, ou uma matriz de pontos, por exemplo. padrões complexos exigem desenho de uma trajetória de digitalização adequado. Por exemplo, uma trajectória de varrimento quadriculada fornece uma grade de áreas de células (mostrado por exemplo na Figura 4A

  1. Defina o software estágio para digitalizar a cabeça da sonda sobre a monocamada de células em padrões definidos pelo usuário (definindo X, Y e Z coordenadas) a uma velocidade de digitalização de 10 mm / s, a uma distância intervalo de 50 mm.
  2. Com o hHFC aninhada em operação e em contacto com a monocamada, digitalizar o MFP com uma trajetória do padrão desejado para efectuar a remoção de células modelado.
  3. Para uma co-cultura após a primeira remoção do tipo de célula, propagar uma linha celular diferente para preencher os espaços vazios, utilizando métodos descritos na secção 1.5. Mover-se entre modos aninhados e beliscou (aumentando a distância de folga, por exemplo) para controlar a remoção de células.
    NOTA: A velocidade de digitalização pode ter que ser investifechado para outras linhas de células. A velocidade de varredura usada neste efeitos de demonstração de remoção de células completo sobre as regiões digitalizados para as linhas celulares utilizadas.

4. Processamento Downstream de amostragem e DNA Amplification

  1. Prepara-se o posto de amostragem para análise a jusante do ligado. Para a estação de amostragem, use um 3D impressa 8-strip suporte de tubos PCR. Alternativamente, escolher um suporte de tubo adequado para servir como este adaptador, que é capaz de ser montado dentro da gama de varrimento da cabeça fora do substrato. Limpar o suporte do tubo com 70% de etanol ou outros descontaminantes superfície com base no rigor desejado para a aplicação. Use um clipe magnético em suporte de tubos para fixá-lo no suporte do substrato.
  2. Depois de preparar a estação de amostragem, posicionar o MFP cabeça 100 mm a partir da monocamada. Começar a operar o hHFC com uma solução de NaOH a 50 mM como o líquido de processamento para o canal de injecção interior com o valor de 1, 6, -7 E -17,5 l / min para Q I1, I2 Q, Q e Q A1 A2, respectivamente.
    1. Uma vez que o fluxo de confinamento se estabilizou (em cerca de 10 segundos), descer a cabeça de sonda a uma distância de folga de 50 mm para realizar a lise local com base NaOH da sub-população escolhida de células com o hHFC. Uma vez que a lise da sub-população está completa (aproximadamente 30 segundos por pegada), dirigir a cabeça para os tubos na estação de amostragem. Ejectar o lisado recolhida nos tubos de PCR directamente (Figura 6).
  3. Para o processamento a jusante do ligado, primeiro neutralizar o pH da solução por mistura do lisado com tampão Tris (1: 1). Após a neutralização, aquecer o lisado a 95 ° C durante 30 min. Em seguida, carregar diretamente o lisado em um fluxo de trabalho qPCR padrão conforme definido pelo fornecedor do instrumento.

Representative Results

O protocolo descrito para a rápida padronização subtractiva de monocamadas de células é demonstrado usando uma plataforma multi componente MFP (Figuras 1 e 2). O protocolo emprega o confinamento fluxo hidrodinâmico hierárquica (hHFC; Figura 3) para tratar localmente e remover as células a partir de monocamadas de células, utilizando NaOH como o líquido de processamento. A configuração compreende um HFC hHFC interior e uma exterior de HFC. O NaOH confinado no interior hHFC introduz ação química e cisalhamento sobre as células em contato. Dentro deste pegada, as células são homogeneamente exposta à acção química de NaOH, devido à transferência de massa conduzida convecção dentro e com a difusão insignificante para a região fora do confinamento. O cisalhamento sobre as células, por outro lado, pode ser alterada fazendo variar a taxa de fluxo de NaOH. Para simplificar parâmetros operacionais, optamos por tornar a acção química o mecanismo dominante de remoção de células em comparação com o cisalhamento. Paraestimar a força de corte aplicada pelo hHFC na superfície, um modelo de elementos finitos foi construído usando COMSOL Multiphysics 5.0. Foram feitas simulações utilizando o módulo de CFD para os fluxos laminares. Foram aplicadas duas condições de contorno de entrada para as aberturas de injecção de geometria e duas condições de contorno de saída para as aberturas de aspiração (Figura 5) para a gama de taxas de fluxo e as dimensões de abertura utilizados na demonstração de corrente. No modelo obtido, as regras de fluxo ditou o perfil de corte, ao passo que as taxas de fluxo definida a magnitude do cisalhamento sobre a superfície. Na prática, uma combinação de ambos determina se o hHFC contacta com a superfície. Mantendo esses fatores em mente, partimos para encontrar uma gama de taxas de fluxo para a operação a fim de obter a remoção de células quimicamente dominante. Para criar uma hHFC, usamos a regra de fluxo de uma aspiração total à relação da taxa de fluxo de injeção de 3,5. As outras regras de fluxo utilizados foram definidos para minimizar a obstrução dentro dos canais de aspiração,que pode ser causada por proteínas desnaturadas que adere a superfícies de canal. Usando o modelo desenvolvido, encontramos taxas de fluxo de 5-10 ul / min traduzindo a um esforço de corte entre 1 e 3 N / m 2. Sem o efeito químico de NaOH, por exemplo, no caso de o tampão de extracção, a tensão de corte não seria suficientemente elevada para remover as células 19. Dentro do intervalo observado, nota-se que o funcionamento a velocidades de fluxo mais elevadas é mais prático devido a perturbações no percurso do fluxo, com o caudal de aspiração baixas (isto é, Q I2 <4 mL / min) devido à detritos celulares nos canais.

Considerando o perfil de cisalhamento estudada e considerações de ordem prática, taxas de fluxo de NaOH (Q I2) de 6 e 8 ul / min são utilizados para as experiências de modelação e Q I1, Q A1 e Q A2 de acordo com as regras de fluxo mostrado na Figura 3. A proporção de fluxos de injecção (Q I2 / I1 Q) permite us para modular ainda mais o tamanho da pegada hHFC (Figura 3D e a Figura 4B), com o princípio subjacente elaborado por Autebert et ai. 14. Usando a capacidade líquida de formação da hHFC juntamente com a capacidade de varredura de alta resolução de plataforma MFP, demonstramos geração grade de células vivas em múltiplas escalas e além disso mostrar a aplicação do protocolo dada no desenvolvimento de co-culturas (Figura 4C).

A plataforma também nos permite realizar a recuperação lisado amostra para análise a jusante. Para mostrar a qualidade do lisado obtido, foram amostrados localmente células lisadas a partir de um e cinco pegadas em duas experiências independentes, mostrando a variação das quantidades de ADN obtidos a partir do lisado (Figura 7). Aqui, nós amplificado DNA contido no ligado utilizando iniciadores de p-actina (para frente: GGATGCAGAAGGAGATCACT e inverter: CGATCCACACGGAGTACTTG ) Utilizando 4 ul de lisado neutralizado em cada reacção de PCR.

figura 1
Figura 1. Módulos da plataforma MFP ea cabeça. (A) Os módulos operacionais da plataforma incluem seringas, estágios motorizados e um controlador motorizado. O dispositivo multifuncional está ligado a um Z-platina motorizada para controlar a distância de folga entre a cabeça e o substrato, e o suporte do substrato está ligado ao X e Y-fases motorizadas que constituem o sistema de varrimento. (B) O chefe MFP tem vias fluídicos para conectar a estação de bombeamento, furos de montagem para montar a cabeça para o Z-palco, e canais que sai do ápice polido. O vértice é definida coplanares para o substrato de cultura de células. Os anéis de Newton simétrico pode ser observado quando o vértice e o substrato são coplanares e em contacto. p_upload / 54447 / 54447fig1large.jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. plataforma MFP. A plataforma de varredura de alta resolução está equipado com um suporte de cabeça usinado interface com o Z-estágio de alta precisão motorizados. O suporte do substrato está ligado à plataforma XY para fins de verificação. Para a recuperação do lisado para análise a jusante, uma estação de amostragem 3D impressa é cortado magneticamente para o lado do suporte do substrato (mostrado em detalhe). Bombas de seringa, um microscópio invertido, controladores e monitores estão localizados em torno da plataforma. Por favor clique aqui para ver uma versão maior desta figura.

3 "src =" / files / ftp_upload / 54447 / 54447fig3.jpg "/>
Figura 3. confinamento hierárquica fluxo hidrodinâmico (hHFC) para o controlo espacial e temporal da remoção celular. (A) Representação esquemática de um único HFC. (B) aninhada e (C) Modo de comprimido de operação hHFC. (D) Imagem da pegada por duas razões de fluxo de injecção / aspiração diferentes. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. Padrões de monocamadas de células usando o MFP. (A) geração de células-grid por varredura programada do MFP em uma monocamada de células MDA-MB-231. As células foram coradas com corante de células-tracker verde. (B) A pegada para as diferentes proporções de injecção (n) Sobre uma monocamada de células MCF7. O esquema mostra a variação esperado sob a forma de HFC interior com uma mudança no n. (C) modelado co-cultura, padronização subtrativo de MCF7 monocamada seguido de semeadura de células MDA-MB-231 nas regiões subtraídos. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5. A tensão de cisalhamento na superfície ao aplicar hHFC. A tensão de cisalhamento na superfície aumenta linearmente com o caudal de injecção interior. O ponto mais alto cisalhamento é encontrada entre as duas aberturas internas (inserção canto inferior direito), onde o líquido de processamento é confinados (linhas de fluxo vermelho, margem interna superior esquerda). As dimensões da abertura utilizadas no modelo de elementos finitos são 200, 100, 100 e 200 um para I1, I2, a1e A2, respectivamente. Por favor clique aqui para ver uma versão maior desta figura.

Figura 6
Figura 6. Modos de operação do MFP plataforma para realizar a remoção de células e padronização. (A) Representação esquemática do trajecto de escoamento para padronização subtractiva por lise celular. Por simplicidade, apenas um de cada injecção e fluxo de aspiração caminhos são mostrados. As seringas são preenchidos usando a válvula de drenagem nas bombas. i1 e i2 são usados ​​para a injecção de tampão de extracção e de NaOH, respectivamente. (B) Esquema de caminho de fluxo para a recuperação de lisado. Este percurso de escoamento é activada após a recolha de lisado celular para a análise usando o caminho de fluxo em (A). Por favor click aqui para ver uma versão maior desta figura.

Figura 7
Figura 7. Análise de ADN a jusante a partir de lisados ​​de células utilizando qPCR. Lotes (A) a amplificação de ADN em lisado extraída a partir de 5 5 pegadas (FP) e um feixe (1 FP). Os controlos foram extraídos após a recolha lisado para ambos os casos. (B) Melt curvas de ADN amplificadas a partir do lisado que mostra a qualidade do DNA extraído. qPCR foi realizado (N = 2, n = 3) para amplificar o gene β-actina. Por favor clique aqui para ver uma versão maior desta figura.

Figura S
Figura S1. Uma imagem em escala de projeto do canal para a cabeça MFP 6 canaisutilizados para experiências de modelação. Canais realizando a hHFC são 200, 100, 100, 200 um de largura e 100 mm de profundidade. Os dois canais ultraperiféricas, que repor líquido de imersão são 500 mm de largura e 100 mm de profundidade. Um arquivo GDS para o mesmo projeto foi fornecido como um complementar a este artigo. Por favor clique aqui para ver uma versão maior desta figura.

Discussion

Apresenta-se um protocolo versátil para a modelação subtractiva de monocamadas de células que permite a geração rápida de padrões de células espacialmente definidos. lise selectiva de monocamadas de células é realizada utilizando NaOH como do líquido de processamento no hHFC. O NaOH instantaneamente desnatura as proteínas contidas na membrana da célula. Recomendamos o uso da concentração de 50 mM de NaOH para assegurar o processamento a jusante do lisado. Esta concentração pode ser aumentada para a remoção mais rápida de células, processamento a jusante desde lisado não é um objetivo. O hHFC assegura que as áreas circundantes não transformados da monocamada de células não são afectados e estão disponíveis para qualquer expansão do padrão ou de sondagem outras propriedades das células.

A taxa de remoção de células é uma função tanto da química e de corte apresentado pelo fluxo. Nós escolhemos um alcance de taxas de fluxo para ter a remoção de células dominante química. velocidades de digitalização de 10-20 & #181; m / seg utilizando uma taxa de fluxo de injecção de NaOH de 6-8 ul / min são usados ​​para facilitar a modelação subtractiva "rápida". A rápida taxa de remoção de células aborda alguns dos desafios enfrentados pela impressão de superfície padronização abordagens baseadas 20,21. Estes métodos requerem um mecanismo para limitar o crescimento de células em áreas espacialmente definidos, por exemplo, por deposição selectiva de proteínas de adesão celular, através da impressão de micro-contacto e subsequente sementeira de células para obter o padrão. Eles são limitados pela baixa taxa de transferência e requerem vários passos sequenciais para a geração de padrões, bem como um selo de estêncil / nova para cada padrão. O método descrito não requer o crescimento selectivo de células em áreas definidas, e supera as limitações através da realização de vários padrões subtractiva em contraste com a impressão, ao mesmo tempo não exigindo qualquer tratamento adicional do substrato de cultura de células.

Com o protocolo descrito no presente documento, a taxa de transferência de monocamadas de células padronizaçãoé aumentada, enquanto que a obtenção de um feedback visual imediata do padrão gerado. Isto facilita a modificação em tempo real dos padrões. Tal controle pode ser crucial em cenários em que a viabilidade celular em uma determinada superfície não é homogênea. Outra vantagem do método é que a mesma cabeça e da química podem ser usadas para gerar múltiplos padrões, reduzindo assim o número de passos envolvidos na geração de uma monocamada de células modelado.

As dimensões dos canais na cabeça e a geometria da cabeça pode ser dimensionada de acordo com os requisitos da aplicação, permitindo assim um controlo sobre a resolução da padronização. Todas as experiências no presente trabalho foram realizadas utilizando uma cabeça de MFP com dimensões abertura fixa, especificamente com aberturas internas a 100 × 100 mm e aberturas exteriores em 200 × 100 mm. Este design com aberturas exterior maior foi escolhido para garantir o funcionamento contínuo da hHFC sem entupimento das aberturas pelosdetritos celulares perdida. Nós testamos as cabeças com dimensões abertura interior 50 × 50 mm e 50 mm de espaçamento entre eles, com resultados bem sucedidos na remoção de células. A utilização de aberturas menores, abaixo de 10 x 10 um, com 10 um espaçamento, permitiria escala para um tamanho pegada menor (~ 30 × 30 mm), permitindo, assim, uma maior resolução em padronização. Observamos questões operacionais com abertura com dimensões inferiores a 10 mm, devido ao entupimento de partículas. Devido a estas dificuldades operacionais, 100 uM é o actual limite de resolução e, consequentemente, uma limitação da técnica descrito. No entanto, podemos resolver isso usando a habilidade formação líquida do hHFC. Nós demonstramos que a remoção de células de resolução pode ser sintonizado para um dado conjunto de dimensões de abertura, controlando Q I2 / I1 Q (Figura 4b) e a abertura do vértice para-substrato-10,14. As etapas utilizadas no trabalho atual tem um tamanho mínimo de passo de 100 nm.Uma combinação destes parâmetros controláveis ​​pode melhorar a resolução espacial da remoção de células em termos de tamanho reduzido e a distância de exploração.

Se modelado co-culturas são desejados para estudar as interacções célula-célula específicas entre diferentes tipos de células, a semeadura sequencial e uma modelação pode ser efectuada utilizando o protocolo descrito. Finalmente, o ADN amplificável de alta qualidade pode ser obtida a partir do lisado, como é evidente pelo pico singular no DNA derreter curva (ver Figura 7). Nós avaliamos a quantidade de ADN de cerca de 1,6 ng a partir de uma única área de cobertura (cerca de 300 células) utilizando qPCR, que está perto de expectativa teórica (6-8 pg / célula). Isto indica uma quantidade do DNA extraído apropriado para vários processos a jusante, enquanto eliminando o uso de quaisquer métodos de isolamento do ADN. Isso abre caminhos para a DNA-análise baseada em locais sondagem de células cultivadas. A capacidade de moldar hHFC para líquidos também pode ser utilizado para depositar as células vivas e as proteínas sobre ACvado superfícies que, em combinação com o padrão subtractivo e de co-cultura sequencial apresentado neste protocolo permite a criação de padrões de célula e célula-matriz complexa de substratos de cultura. A versatilidade eo controle fornecido pela padronização subtrativo baseado em hHFC de monocamadas de células e a possibilidade de realizar análise de DNA nas células extraídas, fornece um novo e poderoso conjunto de ferramentas para biólogos para realizar estudos espacialmente resolvidos envolvendo interações celulares.

Materials

Name Company Catalog Number Comments
Materials
Microfluidic Probe (MFP) Silicon/glass hybrid probe head with channels patterned in silicon. Fabrication done in-house at IBM Research - Zürich
Lab Tek II Chamber slides with 2 chambers ThermoFisher scientific, USA 154461 2 Chamber chamber slides for cell culture with each chamber providing an area of 4 cm2 and capable of holding up to 3 ml of media volume
Chemicals and cell lines
Sodium Hydroxide, Tris-Cl, Ethylenediaminetetraaceticacid, Rhodamine B SigmaAldrich chemicals, USA S5881, 252859,  E9884, R6626 Chemicals used for processing and shielding liquids
Proteinase K Qiagen, Germany 19131 protease to digest denatuired proteins
Deconex 16 Plus Bohrer Chemie, Switzerland Universal cleaning agent for labaratory consumables. Used for non stringent cleaning.
DNA away  ThermoFisher scientific, USA 7010 Surface decontaminant that denatures DNA and DNAases.
DMEM, high glucose, GLUTAMAX supplement ThermoFisher scientific, USA 10566-016 Culturing medium for epithelial cells.
CellTracker Green CMFDA dye ThermoFisher scientific, USA C7025 Membrane permeant live cell labeling dye. Dye active for 72 hours.
CellTracker Orange CMRA dye ThermoFisher scientific, USA C34551
β-actin genomic primers for qPCR Integrated DNA technologies, USA Custom oligos used for DNA quality validation and qPCR.
MCF7 breast carcinoma cells ATCC, USA ATCC HTB-22 Cell lines used to produce co-cultures.
MDA-MB-231 breast carcinoma cells ATCC, USA ATCC HTB-26
Equipment and fluidic connections
Motorized high precision stages Custom machined components.  Linear axis motors from LANG GmBH, Germany Customized linear axis stages from LT series 3 × LT for 3 axes. LSTEP controller used for interfacing stages and PC through RS 232 port.
Syringes Hamilton, Switzerland 1700 TLLX series Interchangeable with syringes provided by other manufacturers with a 250-500 µl range.
Nemesys low pressure syringe pumps cetoni GmbH, Germany Component of pumping station.
Circular M1-connector Dolomite microfluidics, United Kingdom  3000051 Interface between vias in MFP head and tubing
Tilt/rotation stage Goniometer OptoSigma, USA KKD-25C Goniometer to adjust coplanarity of MFP apex
DS Fi2 HD color camera (CCD)  Nikon, Switzerland Controlled using DS-U3 controller unit
Software
Win - Commander LANG GmBH, Germany Stage control software.
Qmix Elements cetoni GmbH, Germany Pump control software.
NIS Elements Nikon, Switzerland Basic research module for image acquisition and analysis.

DOWNLOAD MATERIALS LIST

References

  1. Théry, M. Micropatterning as a tool to decipher cell morphogenesis and functions. J. Cell Sci. 123, (Pt 24), 4201-4213 (2010).
  2. Goubko, C. A., Cao, X. Patterning multiple cell types in co-cultures: A review. Mater. Sci. Eng. C. 29, (6), 1855-1868 (2009).
  3. Kaji, H., Camci-Unal, G., Langer, R., Khademhosseini, A. Engineering systems for the generation of patterned co-cultures for controlling cell-cell interactions. Biochim. Biophys. Acta. 1810, (3), 239-250 (2011).
  4. Cho, C. H., Park, J., Tilles, A. W., Berthiaume, F., Toner, M., Yarmush, M. L. Layered patterning of hepatocytes in co-culture systems using microfabricated stencils. Biotechniques. 48, (1), 47-52 (2010).
  5. Schütze, K., Lahr, G. Identification of expressed genes by laser-mediated manipulation of single cells. Nat. Biotechnol. 16, (8), 737-742 (1998).
  6. Salazar, G. T. A., Wang, Y., et al. Micropallet arrays for the separation of single, adherent cells. Anal. Chem. 79, (2), 682-687 (2007).
  7. Guillaume-Gentil, O., Zambelli, T., Vorholt, J. A. Isolation of single mammalian cells from adherent cultures by fluidic force microscopy. Lab Chip. 14, (2), 402-414 (2014).
  8. Iwata, F., Adachi, M., Hashimoto, S. A single-cell scraper based on an atomic force microscope for detaching a living cell from a substrate. J. Appl. Phys. 118, (13), (2015).
  9. Riahi, R., Yang, Y., Zhang, D. D., Wong, P. K. Advances in wound-healing assays for probing collective cell migration. J. Lab. Autom. 17, (1), 59-65 (2012).
  10. Juncker, D., Schmid, H., Delamarche, E. Multipurpose microfluidic probe. Nat. Mater. 4, (8), 622-628 (2005).
  11. Kaigala, G. V., Lovchik, R. D., Delamarche, E. Microfluidics in the "open space" for performing localized chemistry on biological interfaces. Angew. Chem. Int. Ed. Engl. 51, (45), 11224-11240 (2012).
  12. Qasaimeh, M. A., Gervais, T., Juncker, D. Microfluidic quadrupole and floating concentration gradient. Nat. Commun. 2, (May), 464 (2011).
  13. Christ, K. V., Turner, K. T. Design of hydrodynamically confined microfluidics: controlling flow envelope and pressure. Lab Chip. 11, (8), 1491-1501 (2011).
  14. Autebert, J., Kashyap, A., Lovchik, R. D., Delamarche, E., Kaigala, G. V. Hierarchical hydrodynamic flow confinement: efficient use and retrieval of chemicals for microscale chemistry on surfaces. Langmuir. 30, (12), 3640-3645 (2014).
  15. Kaigala, G. V., Lovchik, R. D., Drechsler, U., Delamarche, E. A Vertical Microfluidic Probe. Langmuir. 27, (9), 5686-5693 (2011).
  16. Cors, J. F., Lovchik, R. D., Delamarche, E., Kaigala, G. V. A compact and versatile microfluidic probe for local processing of tissue sections and biological specimens. Rev. Sci. Instrum. 85, (3), 034301 (2014).
  17. Pollard, J. W., Walker, J. M. Basic Cell Culture Protocols. Humana Press. (1997).
  18. Mitry, R. R., Hughes, D. R. Human cell culture protocols. Methods Mol. Biol. Springer. 531, (1), (2012).
  19. Sakai, K., Ushida, T., Nagase, T., Nakamigawa, H. Quantitative analysis of cell detachment by shear stress. Mater. Sci. Eng. C. 17, (1-2), 55-58 (2001).
  20. Rodriguez, N. M., Desai, R. A., Trappmann, B., Baker, B. M., Chen, C. S. Micropatterned multicolor dynamically adhesive substrates to control cell adhesion and multicellular organization. Langmuir. 30, (5), 1327-1335 (2014).
  21. Tasoglu, S., Demirci, U. Bioprinting for stem cell research. Trends Biotechnol. 31, (1), 10-19 (2013).
Padronização Subtractive rápida de camadas de células vivas com uma Probe microfluídicos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kashyap, A., Cors, J. F., Lovchik, R. D., Kaigala, G. V. Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe. J. Vis. Exp. (115), e54447, doi:10.3791/54447 (2016).More

Kashyap, A., Cors, J. F., Lovchik, R. D., Kaigala, G. V. Rapid Subtractive Patterning of Live Cell Layers with a Microfluidic Probe. J. Vis. Exp. (115), e54447, doi:10.3791/54447 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter