Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Definition substratspecificiteter for lipase og phospholipase Kandidater

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Mikroorganismer producerer et bredt spektrum af (phospho) lipaser, der udskilles for at gøre eksterne substrater tilgængelige for organismen. Alternativt kan andre (phospho) lipaser være fysisk forbundet med den producerende organisme forårsager en omsætning på iboende lipider og ofte giver anledning til en ombygning af de cellulære membraner. Selvom potentielle (phospho) lipaser kan forudsiges med en række algoritmer når genet / proteinsekvens er til rådighed, har ofte ikke opnået eksperimentelt bevis for enzymaktiviteterne, substratspecificiteter og potentielle fysiologiske funktioner. Dette håndskrift beskriver optimeringen af ​​assay betingelser for potentielle (phospho) lipaser med ukendte substratspecificiteter og hvordan man kan ansætte disse optimerede betingelser i jagten på det naturlige substrat af en respektiv (phospho) lipase. Brug af kunstige chromogene substrater, såsom p-nitrophenyl-derivater, kan bidrage til at detektere en mindreenzymatisk aktivitet for en forudsagt (phospho) lipase under standardbetingelser. Efter at have fundet en mindre enzymatisk aktivitet, kan de forskellige parametre i en enzymassay varieres for at opnå en mere effektiv hydrolyse af det kunstige substrat. Efter at have konstateret, under hvilke betingelser et enzym fungerer godt, bør en række potentielle naturlige substrater analyseres for deres nedbrydning, en proces, der kan følges ansætte forskellige kromatografiske metoder. Definitionen af ​​substratspecificiteter for nye enzymer, ofte giver hypoteser for en potentiel fysiologiske rolle af disse enzymer, som derefter kan testes eksperimentelt. Efter disse retningslinjer, var vi i stand til at identificere en phospholipase C (SMc00171), der nedbryder phosphatidylcholin at phosphocholin og diacylglycerol, i et afgørende skridt for ombygningen af membraner i bakterien Sinorhizobium meliloti på fosfor-begrænsende betingelser for vækst. For to forudsagte patatin-ligesom phospholipaser (SMc00930 og SMc01003) af den samme organisme, kunne vi omdefinere deres substratspecificiteter og præcisere, at SMc01003 er en diacylglycerol lipase.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Glycerol-baserede lipider, såsom triacylglyceroler og (glycero) fosfolipider udgør vigtige og formentlig den mest kendte lipidklasser 1. Triacylglyceroler (tags) er fedtstoffer eller olier, der normalt fungerer som opbevaring lipider og dermed som potentielle energi- og kulstof kilder. TAG kan nedbrydes af lipaser, som ofte udskilles af det producerende organisme at fordøje eksterne TAG og gøre dem tilgængelige som kulstofkilder. Desuden har lipaser blevet bredt studeret i årenes løb på grund af deres vigtige bioteknologiske applikationer 2.

På grund af deres amfifile karakter og deres næsten cylindrisk form, (glycero) phospholipider udviser membrandannende egenskaber og sædvanligvis udgør de vigtigste lipid-bestanddele af en dobbeltlagede membran 3. I simple mikroorganismer, såsom bakterien Escherichia coli, kun tre store hoved gruppe varianter, phosphatidylglycerol (PG), cardiolipin (CL), og phosphatidylethanolamine (PE) er stødt på, selv om man skal være klar over, at hver af dem kan være substitueret med et betydeligt antal forskellige fede acylkæder i sn-1- eller sn-2-position giver anledning til et stort antal forskellige molekylspecies 4 . Andre bakterier kan have andre phospholipider foruden eller i stedet. For eksempel, Sinorhizobium meliloti, en jord bakterie, som er i stand til at danne en nitrogen-fikserende rodknold symbiose med bælgplanter lucerne (Medicago sativa), indeholder foruden PE et andet zwitterionisk phospholipid, phosphatidylcholin (PC) 5. Også, lipider, der ikke indeholder fosfor eller glycerol kan være amfifilt og indgår i cellemembranen. For eksempel efter fosfor-begrænsende vækstbetingelser, i S. meliloti, (glycero) phospholipider er i høj grad erstattet af membranlipider, der ikke indeholder phosphor, dvs. sulfolipider, ornithin lipider, og diacylglyceryl trimethylhomoserine (DGTS) 6. I bakterier er DGTS dannet af diacylglycerol (DAG) i en to-trins pathway 7, men kilden til DAG generation var ikke klart. Pulse-chase eksperimenter foreslog, at PC kan være en forløber for DGTS 8 og ved hjælp af den metode, der er beskrevet i dette manuskript, vi kunne identificere en phospholipase C (PLCP, SMc00171), der er dannet under fosfor-begrænsende betingelser, og som kan konvertere pc til DAG og phosphocholin- 8.

I en separat undersøgelse, opdagede vi, at en acyl-CoA syntetase (FADD) deficiente mutant af S. meliloti eller af Escherichia coli akkumulerede frie fedtsyrer ved indtastning stationær vækstfase 9. Selv om disse fedtsyrer syntes at være afledt af membranlipider, blev den præcise kilde til de frie fedtsyrer eller enzymet (er) befriende dem ikke kendt. Igen, beskæftiger den strategi, der er skitseret i dette manuskript, to patatin-lignende 10 (phospho) lipaser (SMc00930 og SMc01003), der bidrog til dannelsen af frie fedtsyrer i S. meliloti 11 blev forudsagt. Overraskende SMc01003 anvendes DAG som substrat konvertere den til monoacylglycerol og endelig glycerol og frie fedtsyrer 11. Derfor SMc01003 er en DAG-lipase (DGLA).

Selv om en række algoritmer findes for at forudsige potentiale (phospho) lipaser 12,13, deres præcise funktion og fysiologiske rolle er normalt ikke kendt. Her skitserer vi en protokol, til at klone og overudtrykker forudsagte eller potentielle (phospho) lipaser. Dette håndskrift forklarer, hvordan enzymassays kan udvikles og optimeres til den overudtrykt (phospho) lipase ved hjælp af kunstige kromogene substrater. Vi giver eksempler på, hvordan med en optimeret enzym assay den virkelige (phospho) lipase substrat kan opstå, og hvordan disse resultater kan berige vores forståelse af mikrobiel fysiologi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Klon og overudtrykker strukturgenet for Forudsagt Lipase

  1. Anvendelse af polymerasekædereaktion (PCR) 14 og specifikke oligonukleotider (tabel 1) 15, amplificere genet af interesse (smc01003, smc00930 eller smc00171), forudsiges at kode for et lipase eller phospholipase, fra det genomiske DNA af værtsorganismen (dvs. , S. meliloti).
    1. Indføre specifikke restriktionssteder (med designet sekvens af oligonukleotider). Fordøje amplificerede DNA-fragment med de tilsvarende restriktionsenzymer og klone det i en ekspressionsvektor, såsom plasmider af PET-serien 16.
    2. Efter kontrol af korrekte DNA sekvens for det klonede gen, transformere vektoren til et udtryk stamme såsom Escherichia coli BL21 (DE3) pLysS 16.
  2. Forbered en overnatning forkultur af udtrykket vært E. coli BL21 (DE3) pLYSS, der huser de respektive pET vektoren med det klonede gen eller tom vektor, i 100 ml dyrkningskolber indeholdende 20 ml Luria Bertani-bouillon (LB) 17 plus de krævede antibiotika. Dyrke cellerne ved 30 ° C (eller ved den sædvanlige væksttemperatur af bakterien fra hvilken lipasen hidrører).
    1. Brug af natten pre-kulturer, pode 500 ml forvarmet LB medium (plus de nødvendige antibiotika) i 2 L dyrkningskolber at opnå en indledende optisk densitet ved 620 nm (OD 620) = 0,05. Følg væksten af kulturerne og ved en OD620 = 0,3, tilføje isopropyl-β-D-thiogalactosid (IPTG) til en slutkoncentration på 100 uM, og inkuberes under omrøring ved 30 ° C i et tidsrum på 4 timer.
    2. Ved slutningen af inkubationsperioden, overføre hver kultur til en 500 ml centrifugerør og centrifugeres ved 5.000 xg ved 4 ° C i 30 minutter. Resuspender bakterielle cellepellets i 5 ml suspension puffer (f.eks SMc00930- og SMc01003-udtrykkende celler i 50 mM Tris-HCl pH 8,0, og SMc00171-udtrykkende celler i 50 mM diethanolamin-HCI pH 9,8). Opbevar cellesuspensionerne ved -80 ° C indtil anvendelse.

2. Forbered Cellefri proteinekstrakter og Bestem Protein Koncentration

  1. Afrimning bakterielle cellesuspensioner og gemme på is. Pass cellesuspensioner tre gange gennem en kold trykcelle ved 20.000 lb pr i 2. Fjern intakte celler og cellerester ved centrifugering ved 5000 x g i 30 minutter ved 4 ° C.
  2. Efter centrifugering forberedes delprøver på 100 og 500 pi fra supernatanten til efterfølgende analyse og opbevare dem ved -80 ° C indtil anvendelse.
  3. Brug en af de 100 pi alikvot til bestemmelse proteinkoncentration på distinkte cellefrie ekstrakter ved en fremgangsmåde til valg eller som beskrevet 18.

3. Brug Kunstige Substrater til Optimering EnzymeAktiviteter (Phospho) lipaser

  1. For en første dækning af distinkte enzymaktiviteter, bruge kunstige substrater, der giver et farvet produkt ved hydrolyse, såsom p-nitrophenol (s NP).
    1. For enzymassays allerede optimeret med kunstige p nitrophenylester substrater (skitseret for phospholipase C PLCP (SMc00171), såvel som for de forudsagte patatin-lignende phospholipaser SMc00930 og SMc01003), brug pipettering ordninger er beskrevet i tabel 2.
    2. Når udforske en ny potentiel (phospho) lipase fremstilles en første standard enzymassay indeholdende 50 mM Tris-HCI, pH 8,5, 100 mM NaCl, 0,05% Triton X-100, 0,5 mM p-nitrophenyl-indeholdende forbindelse (p-nitrophenylphosphat , bis- p-nitrophenylphosphat, p-nitrophenyl decanoat, eller p-nitrophenyl palmitat), og cellefri proteinekstrakt (check 1, 3, 10, 30, 100, 300, og 1000 ug) i et samlet volumen på 1 ml i 1 ml plast Cuvettes.
      BEMÆRK: Brug alkalisk pH (figur 1), når følgende p-nitrophenylester hydrolyse på en kontinuert assay. Alternativt bruge enkelte Tidsforløb assays til et område af pH-værdier, tilsætte NaOH i slutningen af inkubationsperioden for at afslutte enzymreaktionen og sikre, at alle p NP er til stede i phenolat formular.
    3. Følg tidsforløbet for en forøgelse af absorbansen ved 405 nm, på grund af dannelsen af p NP, i et spektrofotometer ved 30 ° C i løbet af 5 minutter. Kvantificer den oprindeligt lineære dannelse af p NP ved at bestemme den initiale hældning af stigningen i absorbans per tid.
    4. Beregn ændringen af koncentrationen (Δc) for p NP bruge loven om Lambert-Beer (Aa = ε Δc d) en.
      BEMÆRK: Aa er den lineære ændring af absorbans bestemmes, ε er den molære ekstinktionskoefficient ved den respektive bølgelængde (i enheder af M -1 cm-1), d er længden af lysvejen (1 cm), og Δc er ændringen af koncentrationen (i enheder af M), der skal bestemmes.
      1. I betragtning af at analysen volumen er 1 ml, beregne p NP dannet.
        BEMÆRK: Beløb = koncentration x volumen.
      2. Beregn enzymaktiviteten ved at dividere mængden af p NP dannet af den tid, i hvilken den er dannet. Bestemme den specifikke enzymaktivitet ved at dividere enzymaktiviteten af ​​mængden af ​​protein (i mg), som var ansvarlig for generering denne aktivitet.
    5. Undersøg absorbans ændringer provokeret af proteinekstrakter, hvor en kandidat gen (smc00171, smc00930 eller smc01003) var blevet udtrykt med ekstrakter, der huser kun en tom vektor.
      BEMÆRK: For at fortsætte med følgende trin, bør de specifikke aktiviteter, forårsaget af proteinekstrakter, hvor en kandidat gen var blevet udtrykt, være mindst to gange eller mmalm end værdierne for de specifikke aktiviteter forårsaget af protein ekstrakter, der huser kun en tom vektor.
    6. Til yderligere eksperimenter, vælge de tilstande, hvor hydrolyse af p-nitrophenyl-indeholdende forbindelse er minimal med cellefrie ekstrakter (dvs. tom vektor), og for hvilket mest udtalte dannelse af p NP og p -nitrophenolate anion (figur 1) kan observeres, når proteinekstrakter anvendes, hvori et kandidat-gen var blevet udtrykt.
  2. Efter bestemmelse af indledende enzymaktivitet i 3.1, optimere assaybetingelserne for det respektive enzym ved at variere pH, type buffer, buffer styrke, koncentrationer af NaCl, detergenter, såsom Triton X-100, og fravær eller nærvær af forskellige divalente kationer.
    1. For forskellige koncentrationer af hver variabel, bestemme den specifikke enzymaktivitet (se 3.1.4.2) (det højeste tal, der opnås definerer betingelsenaf maksimal enzymaktivitet). Bruge kombinationen af ​​de optimale betingelser, der forekommer for hver variabel for at definere en optimeret enzymassay, hvor hver variabel er til stede i sin optimale koncentration.

figur 1
Figur 1. p-nitrophenyl-estere som kunstige substrater for (phospho) lipaser i en spektrofotometrisk assay. Ved hydrolyse af p-nitrophenyl-estere, er en syre (R-OH) og p-nitrophenol (p NP) dannet. På grund af den pKa = 7,2 for dissociation af phenoliske H + fra p NP, ved en pH> 9,2 mere end 99% er på den lyse gule p -nitrophenolate formular og en molær ekstinktionskoefficient på 18.000 M-1 cm - 1 kan anvendes ved en bølgelængde på 405 nm til kvantificering af gratis p -nitrophenolate 22. Hvornår blev anvendt buffere med en pH-værdi på 8,5, blev absorbansen bestemt ved 400 nm og en molær ekstinktionskoefficient på 14.500 M -1 cm-1 blev ansat 23. Klik her for at se en større version af dette tal.

BEMÆRK: Efter at have defineret de optimale betingelser for aktiviteten af ​​enzymet af interesse, gå i gang med at finde den rigtige / fysiologiske substrat af denne lipase. I princippet tage to, ofte komplementære, tilgange til at nå dette mål, en in vivo metode eller en in vitro-metode.

4. In vivo Identifikation af den fysiologiske substrat af en lipase

ove_content "> NOTE:. I et in vivo metode, udtrykke lipase af interesse i en værtsorganisme 8,11 for at registrere tiden om ekspression af lipasen ændrer host's lipidprofil I en anden in vivo tilgang, generere en mutant deficient for genet af interesse 8,11 og undersøge, om dens lipidprofil adskiller sig fra vildtype-versionen 6,8,11. for at opnå en kvantitativ vurdering af en organisme lipidprofil, en simpel metode består i radiomærkning cellulære forbindelser , udtrække lipider, der adskiller dem ved kromatografi, og kvantificering af de radioaktivt mærkede adskilte lipider.

  1. Radiomærkning af lipider.
    1. Forbered en overnatning forkultur af en organisme af interesse (E. coli eller S. meliloti) i 5 ml af det ønskede dyrkningsmedium (komplekst medium eller defineret minimalt medium) og vokse ved 30 ° C.
    2. Fra præ-kultur, pode i 20 ml af samig frisk medium i en 100 ml dyrkningskolbe at opnå en indledende OD620 = 0,3 for kulturen.
    3. Udtag en aliquot (1 ml) af kulturen under sterile betingelser og overføres til en 14 ml steril polystyren rundbundet rør.
    4. Tilsæt 1 pCi af [1- 14C] acetat (60 mCi per mmol) til 1 ml kultur.
    5. Inkubér flydende kultur under omrøring ved 30 ° C i et tidsrum på 24 timer.
    6. Ved slutningen af ​​inkubationsperioden, overføre kulturen til et 1,5 ml mikrocentrifugerør og centrifugeres ved 12.000 xg ved stuetemperatur i 5 min.
    7. Pellet resuspenderes i 100 pi vand. På dette tidspunkt, opbevares cellesuspensionen ved -20 ° C eller umiddelbart fortsætte med udvinding af polære lipider (afsnit 4.2).
  2. Ekstraktion af polære lipider.
    BEMÆRK: Den her beskrevne væsentlige metode følger den procedure, rapporteret af Bligh og Dyer 19.
    1. Til 100 pi vandig celle suspension, tilsættes 375 pi methanol: chloroform-opløsning (2: 1; vol / vol).
    2. Vortex for 30 sec og inkuberes i 5 minutter ved stuetemperatur.
    3. Centrifuger i 5 minutter ved 12.000 xg ved stuetemperatur.
    4. Supernatanten overføres til et nyt 1,5 ml mikrocentrifugerør.
    5. Tilføj 125 pi chloroform og 125 pi vand, vortex 30 sek.
    6. Centrifuger 1 min ved 12.000 xg ved stuetemperatur.
    7. Overfør det nedre chloroformfase til et frisk rør og tør med en strøm af nitrogengas.
    8. Opløs tørrede lipider i 100 pi chloroform: methanol-opløsning (1: 1; vol / vol).
      BEMÆRK: På dette tidspunkt kan en portion af 5 pi af lipidopløsning kvantificeres ved væskescintillationstælling.
    9. For tyndtlagskromatografisk (TLC) -analyse, tørre ned de resterende 95 pi med en strøm af nitrogengas og genopløses tørrede lipider i 20 pi chloroform: methanol-opløsning (1: 1; vol / vol). Brug en 3 pi alikvotfor TLC-analyse.
  3. Adskillelse af polære lipider fra tyndtlagskromatografi (TLC).
    BEMÆRK: Afhængigt af lipidklasser, der skal analyseres, kan forskellige kombinationer af faste og mobile faser anvendes til separation. Her en typisk adskillelse til ladede polære lipider og en anden, som bedre opfylder neutrale polære lipider, under anvendelse af højtydende tyndtlagskromatografi (HPTLC) silicagel aluminiumsplader som den faste fase, er skitseret.
    1. Adskillelse af ladede polære lipider ved todimensional TLC (2D-TLC).
      1. Anvende en 3 pi alikvot af lipid prøve i et hjørne af en HPTLC silicagel aluminiumsplade (10 x 10 cm), 2 cm fra kanten af ​​pladen.
      2. Forberede og bland den mobile fase (140 ml chloroform, 60 ml methanol og 10 ml vand) til adskillelse i første dimension.
      3. Coat en TLC fremkaldekammeret internt med kromatografi papir.
        BEMÆRK: Dette er for at sikre, at gasfasen af ​​kammeretvil være mættet hurtigt (inden for 30 min), efter den mobile fase for den første dimension er tilføjet til kammeret, og kammeret er lukket med en glasplade.
      4. Forberede og bland den mobile fase (130 ml chloroform, 50 ml methanol og 20 ml iseddikesyre) til adskillelse i den anden dimension og overførsel til en anden TLC fremkaldekammeret indvendigt belagt med kromatografi papir og lad kammeret mætte.
      5. Overføre forsigtigt HPTLC silicagel aluminiumark med den tørrede lipid prøven til det første kammer og udvikle (dvs. udføre kromatografi) pladen i 60 minutter i det lukkede kammer i den første dimension 5.
      6. Fjern pladen fra kammeret og lad opløsningsmidler tørre ud i et flow hætte i 30 min.
      7. Efter at dreje pladen 90 grader med hensyn til den tidligere kromatografi, overføre HPTLC silicagel aluminiumplade, hvor lipiderne er blevet adskilt i en dimension, til second kar og udvikles pladen i 60 minutter i den anden dimension 5.
      8. Fjern pladen fra kammeret og lad opløsningsmidlerne tørre ud i en strøm hætte i mindst 2 timer.
    2. Adskillelse af neutrale polære lipider.
      1. Anvendelse 3 pi alikvoter af lipid prøver på en HPTLC silicagel aluminiumsplade startende 2 cm fra kanterne af pladen. Hvis flere prøver analyseres i en endimensional kromatografi, holde en afstand på mindst 1,5 cm mellem de forskellige test-applikationsområder pletter.
      2. Forbered og bland den mobile fase (140 ml hexan, 60 ml diethylether, og 8 ml eddikesyre) og overførsel til en TLC fremkaldekammeret internt belagt med kromatografi papir og dækket med en glasplade for at lade kammeret mætte (30 min).
      3. Overfør HPTLC silicagel aluminiumsplade med de tørrede lipid prøver til kammeret og udvikle pladen i 30 minutter i det lukkede kammer.
      4. Fjern pladen fra kammeretog lad opløsningsmidlerne tørre ud i en strøm hætte i 2 timer.
  4. Kvantificering og visualisering af separerede polære lipider.
    1. Når den udviklede TLC pladen er tør, inkuberes den med en fotostimulerbare luminescens (PSL) sigte i en lukket kassette i 3 dage.
    2. Udsætte inkuberet skærmen til en PSL scanner og erhverve et virtuelt billede af de separerede radiomærkede lipider.
    3. Udfør kvantificering hjælp PSL software 20.
  5. Visualisering og isolering af individuelle polære lipider klasser.
    1. Inkuber udviklede TLC plade i 10 minutter i en kromatografi kammer i nærværelse af 1 g iod krystaller.
      BEMÆRK: separat lipidiske forbindelser vil opløse iod og fremtræder som brunlige pletter.
    2. Circle pletterne med en blyant, sammenligne dem med den relative mobilitet (R f) af standard forbindelser (dvs. 1,2-dipalmitoyl sn-glycerol, dipalmitoyl-L-α-phosphatidylcholine, DL-α-monopalmitin eller palmitinsyre), og identificere hvilken lipid klasse, de måtte tilhøre.
    3. I et stinkskab, lad iod fordampe fra TLC plade.
    4. Ved hjælp af en spatel, skrabe silica gel indeholdende forbindelsen af ​​interesse fra pladen, og ekstrahere forbindelsen fra silicagelen med en blanding af 100 pi vand og 375 pi methanol: chloroform-opløsning (2: 1; vol / vol).
    5. Fortsæt med udsugning i henhold til Bligh og Dyer som skitseret (4.2.2 og fremefter).
    6. Store oprenset lipid klasse i 100 pi af chloroform: methanol (1: 1; vol / vol) ved -20 ° C indtil anvendelse.

5. In vitro Identifikation af den fysiologiske substrat af en lipase

BEMÆRK: I et in vitro fremgangsmåde, undersøge, om lipasen af interesse kan konvertere en blanding af isolerede lipider eller individuelle rene lipider til den tilsvarende Hydrolysis produkter under de betingelser, der er defineret som optimal i 3.2.

  1. Brug pipettering ordninger for enzymassays som pr tabel 3 til PC-specifik phospholipase C SMc00171 (se 5.2), phospholipase (se 5.3), og DAG lipase SMc01003 (se 5.4) aktivitet.
  2. Bestemmelse af PC-specifik phospholipase C-aktivitet (tabel 3).
    1. Til en 1,5 ml mikrocentrifugerør, tilsættes 5.000 tællinger per minut (cpm) af de samlede 14C-mærket PC og en opløsning af Triton X-100.
    2. Bland og tør under en strøm af nitrogen.
    3. Tilføj diethanolamin-HCl, pH 9,8 puffer, samt NaCI og MnCI2 løsninger og bidestilleret vand til opnåelse af et slutvolumen på 99,5 pl. Vortex i 5 sek.
    4. Tilsæt 0,5 pi enzym (5 ug protein) (dvs. en cellefri ekstrakt, hvori overudtrykt SMc00171 er til stede) at sætte reaktionen. Bland kortvarigt.
    5. Inkuber ved 30 ° C i 4 timer.
    6. Reaktionen standses ved dentilsætning af 250 pi methanol og 125 pi chloroform.
    7. Uddrag lipider som beskrevet tidligere (se 4.2).
    8. Separate lipider med endimensionale (1D) -TLC (se 4.3.2 og 4.4), og analysere dem ved PSL billeddannelse.
  3. Bestemmelse af phospholipase A-aktivitet (tabel 3).
    1. Til en 1,5 ml mikrocentrifugerør, tilsættes 5.000 cpm af de samlede 14C-mærket phospholipider og en opløsning af Triton X-100.
    2. Bland og tør under en strøm af nitrogen.
    3. For en endelig 100 pi assay tilføje Tris-HCl, pH 8,5 puffer, NaCl-opløsning og vand. Vortex i 5 sek.
    4. Tilsæt 5 pi enzym (50 ug protein) (dvs. en cellefri ekstrakt, hvori overudtrykt SMc00930 eller SMc01003 er til stede).
    5. Inkuber ved 30 ° C i 5 timer.
    6. Reaktionen standses ved tilsætning af 250 pi methanol og 125 pi chloroform.
    7. Uddrag lipider som beskrevet tidligere (se 4.2), separatedem ved 1D-TLC under anvendelse af 130 ml chloroform, 50 ml methanol og 20 ml iseddike som den mobile fase, og analysere dem ved PSL billeddannelse.
  4. Bestemmelse af diacylglycerol (DAG) lipaseaktivitet.
    1. Fremstilling af 14C-mærket DAG.
      1. Radioaktive mærkning S. meliloti kulturer (se 4.1) og udtrække polære lipider (se 4.2), som beskrevet. Separat S. meliloti total lipid ekstrakter ved 1D-TLC i chloroform: methanol: eddikesyre (130: 50: 20; vol / vol) under anvendelse af betingelser beskrevet for separation i anden dimension i 4.3.1.
      2. Visualiser PC ved jod farvning og bruge en blyant til at markere lokalisering af phosphatidylcholin (PC).
      3. Isoler radioaktivt mærket PC, som beskrevet i 4.5.
      4. Kvantificere ekstraheret PC ved scintillationstælling.
        BEMÆRK: Der forventes Omkring 320.000 CPM PC.
      5. Treat PC (250.000 cpm) med 0,1 U af phospholipase C fra Clostridium perfringens i 50 mM Tris-HCI, pH 7,2, 0,5% Triton X-100 og 10 mM CaCl2 i 2 timer i et totalvolumen på 100 pi og standser reaktionen ved tilsætning af 250 pi methanol og 125 pi chloroform.
      6. Uddrag lipider som tidligere og separat beskrevet af dem ved 1D-TLC (se 4.3.2).
      7. Isoler diacylglycerol fra silicaplade og kvantificere ved scintillationstælling (som beskrevet i 4.2)
    2. Diacylglycerol lipase assay (tabel 3).
      1. Til en 1,5 ml mikrocentrifugerør, tilsættes 5.000 cpm af 14C-mærket DAG og en opløsning af Triton X-100.
      2. Bland og tør under en strøm af nitrogen.
      3. For en endelig 100 pi assay tilføje Tris-HCI (pH 9,0) puffer, en NaCl-opløsning og dobbeltdestilleret vand. Vortex i 5 sek.
      4. Starte reaktionen ved tilsætning af 5 pi enzym (50 ug protein af cellefri ekstrakt).
      5. Inkuber ved 30 ° C i 4 timer.
      6. Reaktionen standses ved tilsætning af 250 pi methanol end 125 pi chloroform og ekstrakt lipider som beskrevet tidligere (se 4.2).
      7. Analyser neutrale polære lipider fra 1D-TLC (se 4.1.3.2) og efterfølgende PSL billeddannelse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aktivitet af PC-specifik phospholipase C SMc00171 med Bis- p-nitrophenylphosphat

Cellefrie ekstrakter opnået fra E. coli BL21 (DE3) x pLysS, som havde smc00171 udtrykt, blev undersøgt for deres evne til at hydrolysere bis- p-nitrophenyl phosphatestere, ved anvendelse af en spektrofotometrisk enzymatisk assay, måling af p NP dannet. Ingen hydrolytisk aktivitet var til stede i cellefrie ekstrakter opnået fra E. coli BL21 (DE3) x pLysS, der skjuler en tom pET9a vektor (data ikke vist), når bis-p-nitrophenylphosphat blev anvendt som substrat.

Tidsforløb for P NP dannet indikerer, at der er en stærk afhængighed af mængden af cellefrit ekstrakt (fra E. coli BL21 (DE3) x pLysS, som havde smc00171 udtrykt) tilsat til assayet (figur 2A). Hvis mængden af p NP dannet kun ville afhænge af enzymkoncentration, bør observeres en lineær korrelation mellem enzym (protein) anvendte koncentration og dannede produkt efter en vis tid. Dette er tydeligvis ikke tilfældet for cellefrie ekstrakter opnået fra E. coli BL21 (DE3) x pLysS, som smc00171 havde udtrykt (figur 2B). Selv om der kan være flere grunde til en eksponentiel afhængighed af enzymaktivitet på proteinkoncentration 21, en hyppig årsag er, at ved fortynding af et enzymholdigt proteinekstrakt, andre komponenter i ekstrakten, der kan være begrænsende for enzymaktivitet, dvs. potentielle cofaktorer , fortyndes så godt. I sådanne tilfælde er uventet lave enzymaktiviteter registreret med fortyndet cellefrie ekstrakter. Ved at inkludere en mættende koncentration på 3 mM MnCI2 i enzymassay, p NP dannet efter en vis tid kun afhænger af mængden af tilsat enzym (data ikke vist) indikerer, at MnCI2 var en begrænsende komponent til SMc00171 aktivitet i cellefrie ekstrakter af E. coli.

Figur 2
Figur 2. Bestemmelse af SMc00171 (phospholipase) aktivitet under anvendelse af kunstigt substrat bis-p-nitrophenylphosphat. Tidsforløbet for p NP dannelse er vist under anvendelse af cellefrie ekstrakter proteiner (● 10 ug / ml, ■ 15 ug / ml, ▲ 20 ug / ml), hvori SMc00171 var blevet udtrykt (A). p NP dannet efter 40 minutters inkubation med forskellige mængder af cellefrie proteiner ekstrakter hvori SMc00171 var blevet udtrykt (B). Fejlsøjler indikerer standardafvigelse..jove.com / filer / ftp_upload / 54.613 / 54613fig2large.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Aktiviteter af Predicted patatin-lignende Phospholipaser SMc00930 og SMc01003 med p-nitrophenyl Acyl Estere af forskellige kædelængder

Efter ekspression af smc00930 eller smc01003 i E. coli BL21 (DE3) x pLysS, cellefrie ekstrakter blev opnået og undersøgt for deres evne til at hydrolysere p-nitrophenyl fede acylestere. Under den enzymatiske assay blev p NP dannet bestemmes i et spektrofotometer. Mindre hydrolytiske aktiviteter var til stede i cellefrie ekstrakter opnået fra E. coli BL21 (DE3) x pLysS med en tom pET17b-vektor (tabel 4), når p-nitrophenyl acylestere af different kædelængder var ansat som substrater. Når smc01003 blev udtrykt, de opnåede ekstrakter viste en øget hydrolyse af p-nitrophenyl-estere af forskellige kædelængder. SMc01003 nedbrudt mediet kæde p-nitrophenyl decanoat samt langkædede p-nitrophenyl palmitat og p-nitrophenyl-stearat (tabel 4). Som SMc01003 er en stor bidragyder til dannelsen af langkædede frie fedtsyrer i S. meliloti under stationære fase 11, var det overraskende, at SMc01003 syntes at virke lige godt på medium-kæde end på langkædede p-nitrophenyl acylestere (tabel 4). Uventet SMc01003 handler også på kortkædede substrater såsom p-nitrophenyl-butyrat eller p-nitrophenyl octanoat (data ikke vist). Men disse sidstnævnte substrater også nedbrudt af aktiviteter til stede i cellefrie ekstrakter af E. coli (dvs. der huser den tomme vecteller pET17b) uden at udtrykke nogen ekstra gen og med kortkædede substrater (C4), halvdelen af substratet allerede nedbrydes af E. coli iboende enzymer (data ikke vist). Det er klart, behov SMc01003 skal renses for at afklare, om SMc01003 fungerer lige godt på korte, mellemlange og langkædede substrater. Generelt p-nitrophenyl acylestere synes ikke at være gode substrater for SMc01003 som kan være forståeligt at vide, at SMc01003 er i virkeligheden en DAG lipase 11. Cellefrie ekstrakter, hvor smc00930 havde givet udtryk for, viser meget højere enzymaktiviteter med p-nitrophenyl estere (tabel 4). Også SMc00930 er i stand til at hydrolysere p-nitrophenyl acylestere af forskellige kædelængder (C10, C12, C14, C16 og C18), selvom p-nitrophenyl palmitat (specifik aktivitet 5,5 mmol NP min - 1 mg protein - 1) er klart den bedste substrat for SMc00930. Til dato, physiologiske substrat for SMc00930 er ikke kendt.

Undersøge, om polære lipider kan fungere som Substrater til Predicted (phospho) lipaser

Når først en (phospho) lipase enzymatisk assay er blevet optimeret med kunstige substrater, radioaktivt mærkede lipidblandinger eller rene lipider kan undersøges som potentielle substrater.

Når analyse SMc00171-holdige cellefrie ekstrakter med 14 C-mærket pc under optimerede betingelser, kunne vi vise, at SMc00171 nedbryder PC til DAG, et resultat, der blev bekræftet af massespektrometriske undersøgelser 8. SMc00171 nedbryder også 32P-mærket pc til phosphocholin og virker derfor som en PC-specifik phospholipase C (PLCP) 8, som induceres under fosfor-begrænsende vækstbetingelser.

Hvornåranalyse SMc00930- eller SMc01003-holdige cellefrie ekstrakter med 14 C- eller 32P-mærkede totale polære lipider under optimerede betingelser, kunne vi vise, at ingen af phospholipider nedbrydes af SMc00930 eller SMc01003 under betingelser, hvor p-nitrophenyl acylestere fungerede som substrater 11. I modsætning hertil en kommerciel phospholipase A2 fra slangegift var stand til at nedbryde en sådan blanding af phospholipider 11. Disse resultater var overraskende og uventet, da begge, SMc00930 og SMc01003, blev forudsagt at være patatin-lignende phospholipaser.

Når analyse SMc00930- eller SMc01003-holdige cellefrie ekstrakter med 14 C- mærket diacylglycerol (DAG) under optimerede betingelser, kunne vi vise, at DAG ikke nedbrydes af SMc00930 eller cellefrie ekstrakter af E. coli, mens SMc01003 nedbryder DAG og danner forbindelser, der migrerer som frie fedtsyrer (figur 3). For nylig kunne vi vise, at SMc01003 fungerer som en DAG lipase, der kan nedbryde DAG eller monoacylglycerol til glycerol og frie fedtsyrer 11 (figur 4).

Figur 3
Figur 3. SMc01003 nedbryder diacylglycerol. Cellefrie ekstrakter af E. coli BL21 (DE3) pLysS × udtrykker SMc01003, SMc00930 eller indeholder den tomme pET17b vektoren, eller puffer blev inkuberet med 14C-DAG (opnået fra S. meliloti) i 24 timer. Ved udgangen af ​​de respektive inkubationsperioder blev radioaktivt mærkede lipider ekstraheret og separeret ved 1D-TLC under anvendelse af mobil fase til separering neutrale polære lipider (se 4.3.2). FA, fedtsyrer; DAG, diacylglycerol. Dette tal har været ændret siden [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Klik her for at se en større version af dette tal.

Figur 4
Figur 4. Enzymatisk funktion af diacylglycerol lipase DGLA (SMc01003). Diacylglycerol (DAG) lipase SMc01003 nedbryder DAG til monoacylglycerol og én fedtsyre, og derefter nedbrydes monoacylglycerol yderligere til glycerol og en anden fedtsyre. Klik her for at se en større version af denne figur.

Oligonucleotid
navn
sekvens
(5'-3 ')
Gene
af interesse
enzym restriktion
websted tilføjet
Vector
til ekspression
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 NdeI pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xhol pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 NdeI pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 BamHI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 NdeI pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 BamHI pET9a
Bogstaver med fed indikerer restriktionssteder.

Tabel 1. Oligonukleotider anvendt til at amplificere og klone forudsagte phospho (lipase) gener ind pET17b eller pET9a vektor. Primer oligonukleotider blev designet ved hjælp af beskrevne software 15.

Assay for SMc00171 Assay for SMc01003 Assay for SMc00930
lager Komponent
Tris-HCI, pH 8,5 25 pi
2 M Tris-HCI, pH 9,0 25 pi
1 M diethanolamin-HCI, pH 9,8 50 pi
1 M NaCl 40 pi 150 pi 150 pi
1% Triton X-100 200 pi 200 pi
50 mM p- nitrophenyl palmitat 12,5 pi 12,5 pi
200 mM bis- p- nitrophenylphosphat 2,5 pi
cellefri ekstrakt (1 mg Protein / ml) med kandidat-gen udtrykt 20 pi 100 pi 1 pi
dobbeltdestilleret vand 887.5 pi 512,5 pi 611.5 pi
slutvolumen 1 ml 1 ml 1 ml

Tabel 2. Afpipetteringsudstyr ordninger for optimerede enzymassays med kunstig p nitrophenylester substrater.

Assay for smc00171-kodet Phospholipase C Assay for smc01003 - kodet DAG-lipase Optimeret assay for Phospholipase A-aktivitet
lager Komponent
2 M Tris-HCI pH 8,5 2,5 pi
2 M Tris-HCl pH 9,0 2,5 pi
100 mM MnCI2 3 pi
1 M Diethanolamin-HCl pH 9,8 5 pi
1 M NaCl 4 pi 15 pi 15 pi
1% Triton X-100 2 pi 20 pi 20 pi 14 C-mærket lipid (phospholipider) 20 pi (5.000 cpm)
14 C-mærket lipid (PC) 20 pi (5.000 cpm)
14 C-mærket lipid (DAG) 20 pi (5.000 cpm)
10 mg / ml Protein ekstrakt med udtrykte kandidatgener 0,5 pi 5 pi 5 pi
dobbeltdestilleret vand 87,5 pi 77,5 pi 77,5 pi
slutvolumen 100 pi 100 pi 100 pi

Tabel3. Afpipetteringsudstyr ordninger for optimeret enzym assays for (phospho) lipaser med radioaktivt mærkede lipid substrater.

aktivitet angives i enheder (pmol nitrophenol / mg protein x min)
Fed skrift angiver acylkædelængde af p-nitrophenylester substrat 10 12 14 16 18
E. coli-ekstrakt (baggrund) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 udtrykt i E. coli ekstrakt 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 udtrykt i E. coli ekstrakt 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 minus baggrund 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 minus baggrund 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabel 4. p-nitrophenyl acylestere som substrater for patatin-lignende lipaser SMc00930 og SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I løbet af de sidste 20 år, har genomer af mange organismer blevet sekventeret, og selv om et væld af genom sekvens data er blevet genereret, er funktionel fortolkning halter bagefter og hæmmer derfor vores forståelse af genom-funktion. Genfunktioner i genomer ofte tildeles baseret på lighed med gener med kendt funktion eller forekomsten af ​​konserverede motiver. Den præcise funktion af et givet gen er ofte ikke kendt. Især forudsagte strukturelle gener for enzymer ikke let kan udforskes med OMIC teknikker på grund af det faktum, at de fleste enzymer katalyserer komplekse reaktioner, der involverer to substrater og to produkter. I øjeblikket virker det mere realistisk at udforske substratspecificiteter for grupper af enzymer, hvor mindst ét ​​substrat er fast, og hvor den anden kan varieres. For eksempel i eukaryoter fleste phosphoryleringsmotiver i proteiner er kendte og konsensus peptider til kinaser er blevet spottet på faste bærere for at generere peptid arstråler. Brug af disse arrays og radioaktivt mærket ATP, substratspecificiteter og aktivitetsniveauer af forskellige kinaser af en organisme kan bestemmes tillader etablering af en kinome profil og definere substratspecificiteter 24. Hydrolaser komponere en anden stor gruppe af enzymer, som en substrat, vand, er fast, men for hvilken den præcise art af den (anden) substrat, der skal hydrolyseret er ofte ikke kendt. Den omstændighed, at der for et nyt enzym de optimale assaybetingelser er heller ikke kendt, konverterer påvisning af et nyt enzym-aktivitet i en multi-variabel problem. Det kan derfor være med til at være i stand til at løse substrat, der skal hydrolyseres for at definere, hvilke betingelser enzymet fungerer bedst.

I nærværende manuskript, beskriver vi optimering af assay betingelser for potentielle (phospho) lipaser med ukendte substratspecificiteter og uddybe, hvordan at ansætte disse optimerede betingelser i jagten på det naturlige substrat af reperspektiv (phospho) lipase. Betydningen af den foreliggende teknik består i, at hydrolysen af fluorogene eller kromogene, kunstige substrater, der efterligner naturlige substrater i nogen grad, kan efterfølges af spektrofotometri 25, og at disse assays er let anvendelig til store undersøgelser 26. På grund af følsomheden af ​​sådanne assays og deres enkelhed at overvåge reaktionen, kan de let optimeres til en given enzym. Det er klart, for kunstige substrater man kunne forvente mindre gunstige kinetiske konstanter (dvs. høj K M, lav k kat) for et specifikt enzym end for naturlige substrater 1,21. Men i praksis, den lette tilgængelighed og sporbarhed af kunstige substrater fungerer som (dårlige) substrater for hele grupper af enzymer ofte mere end opveje ulemperne. Når have stødt betingelserne for et enzym til at arbejde (med kunstigt substrat), vil det gøre det med natural / fysiologisk substrat samt. Som fremstilling og isolering af potentielle lipidsubstrater kan være arbejdskrævende og tidskrævende, er det vigtigt at have sikkerhed for, at et enzym er klar til at arbejde, når man kombinerer og inkubere det med værdifulde substrater. Vigtigt er, at fremgangsmåden i første optimere betingelserne for et enzym til at arbejde, vil tillade en hurtigere identifikation af den fysiologiske substrat for en ny (phospho) lipase. Som en proof of concept, har vi med succes anvendt denne metode til karakterisering af substratspecificiteter af lipaser SMc00171, SMc00930, og SMc01003 8,11. I modsætning hertil mange traditionelle, alternative metoder oprettelse analyser til (phospho) lipase aktiviteter indebærer reaktioner, hvor substrat og produkt er tidligere kendte.

Det er klart, modifikationer af assays til påvisning optimal enzymaktivitet kan omfatte brugen af ​​andre fluorogene, kromogene eller på anden måde markerede kunstige substrater, variationenzym koncentration, type og koncentration af buffere eller andre tilsætningsstoffer (dvs. rengøringsmidler eller bivalente kationer). Hvis der ikke enzym aktivitet opdages med kunstige substrater, det respektive enzym simpelthen ikke kan arbejde med dette substrat, men fejlfinding i sådanne tilfælde helt sikkert bør omfatte at have sikkerhed for, at alle forholdsregler var taget, der kunne have været nødvendige for at opretholde enzymaktivitet intakt (dvs. lagring cellefrie ekstrakter ved 4 ° C eller lavere temperaturer indtil anvendelse og, hvis det er nødvendigt, tilføjer cocktails af proteaseinhibitorer til cellefrie ekstrakter for at undgå proteolytisk nedbrydning af enzymet af interesse) 27.

Begrænsninger af teknikken præsenteres i dette håndskrift skyldes det faktum, at det kunstige substrat og det naturlige substrat er forskellige fra hinanden og følgelig de bioenergetik for den katalyserede reaktion vil være så godt 1. De forskellige parDer bør etableres ameters for de optimale enzymaktivitet også for det naturlige substrat (ved at variere pH, type buffer, buffer styrke, koncentrationer af NaCl og detergenter, såsom Triton X-100, fravær eller nærvær af forskellige bivalente kationer), da de kan vise sig at være lidt anderledes end de optimale betingelser stødt til det kunstige underlag. En anden vigtig begrænsning er, at sandsynligvis ikke alle (phospho) lipaser kan påvises under anvendelse af kunstige chromogene substrater. For eksempel er den kunstige p-nitrophenyl rest af ester substrater simpelthen kan være for omfangsrigt, eller udvise andre kemiske egenskaber, der forhindrer, at en sådan substrat kan få adgang til det aktive sted på et enzym. Det blev bemærket, at DAG lipase SMc01003 viste lave aktiviteter med alle p-nitrophenylester substrater af forskellige kædelængder 11. Med den viden, at DAG er det naturlige substrat for SMc01003 og som har DAG reltivt lille polære hovedgruppe, bestående af glycerol kun 11, den er let forestille sig, at den voluminøse p-nitrophenyl-rest er simpelthen for stor for en let adgang til det aktive sted i SMc01003. Imidlertid er de molekylære detaljer hvorfor p-nitrophenyl-estere ikke er gode substrater for SMc01003 ikke kendt på nuværende tidspunkt.

Kritiske skridt i protokollen omfatter alle bestemmelser, der træffes for at sikre, at det undersøgte enzym har adgang til de respektive underlag. For eksempel i søgningen efter den fysiologiske sphingosin, er det afgørende, at sphingosin er tilvejebragt i en opløst form,. Derfor når man opretter sådanne enzymassays (beskrevet i fem af protokollen), lipid substrater, som regel opløst i blandinger af methanol: chloroform, bør blandes med en vandig opløsning af et rengøringsmiddel, dvs Triton X-100, inden tørring ned blandingen med nitrogengas. Denne procedure sikrer, at, efter at tilføje de resterende Ingredienser til assayet, er den potentielle sphingosin indlejret i detergent-miceller og som sådan tilgængelige for enzymet under assayet.

Principielt bør teknikken præsenteres her være bredt anvendelig i fremtiden for opdagelsen af ​​nye (phospho) lipaser og for definitionen af ​​deres naturlige substrater. Teknikken er let udvides til andre klasser af hydrolaser, men det kan være mere kompliceret at udvikle assays med kunstige substrater for nye enzymer, der kræver to, sædvanligvis ukendt, substrater til at fuldføre deres katalytiske cyklus.

For forudsagte (phospho) lipaser eller phosphataser hverken den korrekte substrat er kendt eller assay-betingelser, hvor enzymet fungerer godt. Derfor kan det være nyttigt at undersøge, om nogle forbindelse fra et batteri af kunstige forbindelser, såsom særskilte p-nitrophenyl-holdige forbindelser (p-nitrophenylphosphat, bis-p-nitrophenylphosphat, p-nitrophenyl palmitat), kan fungere som substrat. Opdagelsen af de første enzymaktiviteter med kunstige substrater har banet vejen til at løse, at SMc00171 er en PC-specifik phospholipase C 8, at SMc01003 er en DAG lipase 11, og været med til at definere de betingelser, hvorunder SMc00930 fungerer som en hydrolase 11. Det er klart, det naturlige substrat af SMc00930 er i øjeblikket stadig ukendt, og de fysiologiske sammenhænge SMc00930 og SMc01003 stadig at blive løst. Derfor er opgaven med at foreslå en fysiologisk funktion for en forudsagt lipase er udfordrende og ikke altid straks mødt med succes. Brug mutanter mangelfulde af den forudsagte lipase genet og sammenligne dem med de respektive vildtypestammen kan give eksperimentelle beviser, at lipase virker med specificiteten i sin oprindelige stamme baggrund, der er blevet postuleret i del 4) af protokollen. Det er klart, at kravet om en ny lipaseaktivitet shOuld understøttes af in vitro-beviser for, at en bestemt substrat omdannes ved hydrolyse til definerede produkter. Nogle gange den postulerede fysiologiske funktion kan udfylde huller i metaboliske veje eller forklare den fysiologiske adfærd producerende organisme, men i andre tilfælde er der simpelthen stadig ikke kan være nok biokemisk viden til at få mening ud af nogle aktiviteter. I løbet af vore undersøgelser identificerede vi adskillige enzymer, der virker på iboende polære membranlipider af bakterier nedbrydende dem og, i nogle tilfælde, konverterer dem til en spiller i mere komplekse lipid cyklusser. For eksempel, kombinerer den nye viden, som SMc00171 er en PC-specifik phospholipase C (PLCP) 8, der induceres under fosfor-begrænsende betingelser for vækst, med allerede eksisterende data, kan man postulere en roman DAG cyklus, der måtte eksistere i mange miljømæssige Proteobacteria og som giver anledning til dannelse af fosfor-fri membranlipider når fosfor er vækstbegrænsende. I contrast, når fosfor leverancer er rigelige, er DAG re-fosforyleres til phosphatidinsyre ind de novo phospholipid biosyntese, derved lukker denne lipid cyklus og sikre, at hovedsagelig (glycero) phospholipider er til stede i membranen 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Dette arbejde blev støttet af tilskud fra Consejo Nacional de Ciencias y Tecnología-México (CONACYT-Mexico) (82.614, 153.998, 253.549 og 178.359 i Investigación Científica basica samt 118 i Investigación en Fronteras de la Ciencia) og fra Dirección General de Asuntos de Personal Académico-Universidad Nacional Autónoma de México (DGAPA-UNAM, PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Definition substratspecificiteter for lipase og phospholipase Kandidater
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter