Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Het definiëren van de ondergrond hebben voor lipase en fosfolipase Kandidaten

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Micro-organismen produceren een breed scala aan (fosfo) lipasen die worden afgescheiden teneinde externe beschikbare substraten voor het organisme maken. Ook kunnen andere (fosfo) lipasen fysiek gekoppeld aan het producerende organisme veroorzaakt een omzet van intrinsieke lipiden en vaak aanleiding geeft tot een hermodellering van de celmembranen. Hoewel potentiaal (fosfo) lipase kan worden voorspeld met een aantal algoritmen wanneer het gen / eiwitsequentie beschikbaar, experimenteel bewijs van de enzymactiviteiten, substraatspecificiteiten en mogelijke fysiologische functies is vaak niet verkregen. Dit manuscript beschrijft de optimalisatie van testcondities voor potentiële (fosfo) lipasen met onbekende substraatspecificiteiten en hoe deze geoptimaliseerde omstandigheden te gebruiken in de zoektocht naar het natuurlijke substraat van een respectievelijke (fosfo) lipase. Met behulp van kunstmatige chromogene substraten, zoals p-nitrofenyl derivaten kunnen helpen in geringe sporenenzymatische activiteit een voorspeld (fosfo) lipase onder standaardomstandigheden. Hebben ondervonden dergelijke kleine enzymatische activiteit kunnen de verschillende parameters van een enzym assay worden gevarieerd teneinde een efficiëntere hydrolyse van het kunstmatige substraat te verkrijgen. Na de voorwaarden waaronder een enzym werkt goed hebben vastgesteld, moet een groot aantal potentiële natuurlijke substraten worden getest op hun degradatie, een proces dat gevolgd kan worden in dienst verschillende chromatografische methoden. De definitie van substraatspecificiteiten voor nieuwe enzymen, vormt vaak hypothesen voor een mogelijke fysiologische rol van deze enzymen, die vervolgens experimenteel getest worden. Door deze richtlijnen, konden we een fosfolipase C (SMc00171) die fosfatidylcholine aan fosfocholine en diacylglycerol, een cruciale stap voor de verbouwing van membranen in de bacterie Sinorhizobium meliloti upon fosfor randvoorwaarden groei degradeert identificeren. Voor twee voorspelde patatin-zoals fosfolipasen (SMc00930 en SMc01003) van hetzelfde organisme, konden we hun substraat specificiteiten opnieuw te definiëren en te verduidelijken dat SMc01003 is een diacylglycerol lipase.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

-Glycerol gebaseerde lipiden zoals triacylglycerolen en (glycero) fosfolipiden zijn belangrijke en waarschijnlijk de meest bekende lipide-klassen 1. Triacylglycerolen (TAGs) zijn vetten en oliën, die gewoonlijk fungeren als opslag lipiden en derhalve potentiële energie en koolstofbronnen. TAGs kan worden afgebroken door lipasen die vaak worden uitgescheiden door het producerende organisme externe TAGs verteren en beschikbaar als koolstofbronnen. Ook lipasen zijn uitgebreid bestudeerd in de jaren vanwege hun belangrijke biotechnologische toepassingen 2.

Door hun amfifiele aard en hun bijna-cilindrische vorm, (glycero) fosfolipiden vertonen membraanvormende eigenschappen en meestal vormen de belangrijkste lipide componenten van een dubbellaag membraan 3. In eenvoudige organismen zoals de bacterie Escherichia coli, slechts drie grote kopgroep varianten, fosfatidylglycerol (PG), cardiolipine (CL) en phosphatidylethanolamine (PE) worden aangetroffen, hoewel men dient te beseffen dat elk daarvan kan worden gesubstitueerd met een groot aantal verschillende vetacylketens op de sn-1 of sn-2 positie waardoor een groot aantal verschillende moleculaire species 4 . Andere bacteriën kunnen andere fosfolipiden, naast of in plaats daarvan. Bijvoorbeeld, Sinorhizobium meliloti, een bodem bacterie, die in staat is een stikstoffixerende wortel knobbel symbiose met de peulvruchten alfalfa (Medicago sativa) vormen, bevat naast een tweede zwitterionisch fosfolipide, fosfatidylcholine (PC) PE 5. Ook lipiden zonder fosfor of glycerol kunnen amfifiele en deel uitmaken van de cellulaire membraan. Bijvoorbeeld upon fosfor beperkende groeiomstandigheden, S. meliloti, (glycero) fosfolipiden grotendeels vervangen door membraanlipiden die geen fosfor bevatten, dat wil zeggen, sulfolipiden, ornithine lipiden en diacylglyceryl trimethylhomoserine (DGTS) 6. In bacteriën wordt DGTS gevormd van diacylglycerol (DAG) in een tweestaps route 7 maar de bron voor DAG generatie was niet duidelijk. Pulse-chase experimenten gesuggereerd dat PC een voorloper voor DGTS 8 zou kunnen zijn en het gebruik van de in dit manuscript konden we een fosfolipase C (PLCP, SMc00171) identificeren beschreven methodologie die in het kader van fosfor randvoorwaarden wordt gevormd en welke pc kan omzetten in DAG en fosfocholine 8.

In een afzonderlijke studie, ontdekten we dat een acyl-CoA synthetase (FADD) deficiënte mutant van S. meliloti of Escherichia coli geaccumuleerde vrije vetzuren bij het invoeren van stationaire fase van 9 groei. Hoewel deze vetzuren leek te worden afgeleid van membraanlipiden, werden de precieze bron van de vrije vetzuren of de enzym (en) men ze niet bekend. Nogmaals, in dienst van de strategie die in dit manuscript, twee patatine-achtige 10 (fosfo) lipasen (SMc00930 en SMc01003) die hebben bijgedragen aan de vorming van vrije vetzuren in S. meliloti 11 voorspeld. Verrassenderwijs SMc01003 DAG gebruikt als substraat converteren naar monoacylglycerol en tenslotte glycerol en vrije vetzuren 11. Daarom SMc01003 een DAG lipase (DGLA).

Hoewel een aantal algoritmes aanwezig voor het voorspellen van mogelijke (fosfo) lipasen 12,13, de exacte functie en fysiologische rol meestal niet bekend. Hier schetsen we een protocol, te klonen en overexpressie voorspelde of potentiële (fosfo) lipasen. Dit manuscript uitgelegd hoe enzymbepalingen kunnen worden ontwikkeld en geoptimaliseerd voor de overexpressie (fosfo) lipase met kunstmatige chromogene substraten. We geven voorbeelden hoe met een geoptimaliseerde enzym assay de echte (fosfo) lipase substraat kan worden opgetreden en hoe deze bevindingen ons begrip van microbiële fysiologie zou kunnen verrijken.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Clone en overexpressie structureel gen voor Voorspelde lipase

  1. Middels polymerasekettingreactie (PCR) 14 en specifieke oligonucleotiden (Tabel 1) 15, vergroot het gen van belang (smc01003, smc00930 of smc00171), voorspelde te coderen voor een lipase of fosfolipase, uit het genomische DNA van het gastheerorganisme (dwz , S. meliloti).
    1. Voegen specifieke restrictieplaatsen (de ontworpen sequentie van de oligonucleotiden). Digest het geamplificeerde DNA-fragment met de overeenkomstige restrictie-enzymen en deze klonen in een expressievector zoals plasmiden van de pET series 16.
    2. Na verificatie van de juiste DNA-sequentie voor het gekloneerde gen, transformeren de vector een expressiestreng zoals Escherichia coli BL21 (DE3) pLysS 16.
  2. Bereid een overnachting pre-cultuur van de expressie gastheer E. coli BL21 (DE3) pLYSS, herbergt de respectieve pET vector met het gekloneerde gen of lege vector, in 100 ml kolven die 20 ml Luria Bertani bouillon (LB) 17 vermeerderd met de antibiotica. De cellen te kweken bij 30 ° C (of bij normale groeitemperatuur van de bacterie waaruit het lipase afkomstig).
    1. Uit de girale pre-culturen inoculeren 500 ml voorverwarmde LB medium (plus de benodigde antibiotica) in 2 L kweekkolven een eerste optische densiteit bij 620 nm (OD 620) = 0,05. Volg groei van kweken en bij een OD 620 = 0,3, voeg isopropyl-β-D-thiogalactoside (IPTG) tot een uiteindelijke concentratie van 100 pM en incubeer onder schudden bij 30 ° C gedurende 4 uur.
    2. Aan het einde van de incubatieperiode overbrengen elke cultuur een 500 ml centrifugebuis en centrifugeer bij 5000 xg bij 4 ° C gedurende 30 minuten. Resuspendeer bacteriële celpellets in 5 ml suspensie buffer (bijvoorbeeld, SMc00930- en SMc01003 tot expressie brengende cellen in 50 mM Tris-HCl pH 8,0 en SMc00171 tot expressie brengende cellen in 50 mM diethanolamine-HCl pH 9,8). Bewaar de celsuspensies bij -80 ° C tot gebruik.

2. Bereid Celvrije eiwitextracten en bepalen eiwitconcentratie

  1. Ontdooi bacteriële cel schorsingen en op te slaan op het ijs. Pass celsuspensies drie keer door een koude druk cel op 20.000 pond per in 2. Verwijderen intacte cellen en celafval door centrifugeren bij 5000 xg gedurende 30 min bij 4 ° C.
  2. Na centrifugeren aliquots van 100 en 500 pl van het supernatant voor verdere analyse en bewaar ze bij -80 ° C tot gebruik.
  3. Een van de 100 ui aliquot op eiwitconcentratie afzonderlijke celvrije extracten vast bij voorkeurswerkwijze of zoals beschreven 18.

3. Gebruik kunstmatig substraat voor het optimaliseren van EnzymeActiviteiten van (fosfo) lipase

  1. Voor een initiële dekking van de verschillende enzym activiteiten, gebruik van kunstmatige substraten die een gekleurd product opleveren bij hydrolyse, zoals p-nitrofenol (p -NP).
    1. Voor enzymassays al geoptimaliseerd kunstmatige p-nitrofenyl ester substraten (geschetste fosfolipase C PLCP (SMc00171), alsmede voor de voorspelde patatin-achtige fosfolipasen SMc00930 en SMc01003), gebruik pipetteren schema in Tabel 2.
    2. Bij het verkennen van een nieuw potentieel (fosfo) lipase, stelt een eerste standaard enzym assay bevattende 50 mM Tris-HCl, pH 8,5, 100 mM NaCl, 0,05% Triton X-100, 0,5 mM p-nitrofenyl-bevattende verbinding (p-nitrofenylfosfaat , bis-p-nitrofenylfosfaat, p-nitrofenyl decanoaat of p-nitrofenyl palmitaat) en celvrije eiwitextract (raadpleeg 1, 3, 10, 30, 100, 300 en 1000 ug) in een totaal volume van 1 ml in 1 ml plastic cuvettes.
      OPMERKING: Gebruik alkalische pH (figuur 1) bij het volgen van p-nitrofenyl ester hydrolyse in een continue assay. Alternatief Gebruik één tijdpunt assays voor een traject van pH-waarden, toevoeging NaOH aan het einde van de incubatieperiode om de enzymreactie te beëindigen en te waarborgen dat alle p -NP in de fenolaat vorm.
    3. Volg het tijdsverloop voor een verhoging van de absorptie bij 405 nm, door de vorming van p -NP in een spectrofotometer bij 30 ° C gedurende een 5 minuten periode. Kwantificeren van de aanvankelijk lineaire vorming van p -NP door het bepalen van de eerste helling van de toename van de absorptie per keer.
    4. Bereken de verandering van de concentratie (Δc) voor p -NP het gebruik van de wet van Lambert-Beer (AA = ε Δc d) 1.
      OPMERKING: AA is de lineaire verandering van de absorptie bepaald ε is de molaire extinctiecoëfficiënt bij de betreffende golflengte (in eenheden van M -1 -1), d de lengte van het lichtpad (1 cm) en Δc de verandering van de concentratie (in eenheden van M) worden gebruikt.
      1. Aangezien de test volume 1 ml, berekent de hoeveelheid p -NP gevormd.
        LET OP: Bedrag = concentratie x volume.
      2. Bereken de enzymactiviteit door het bedrag van p -NP gevormd door de tijd waarin het is gevormd. Bepaal de specifieke enzymactiviteit van enzymactiviteit delen door de hoeveelheid eiwit (in mg) die verantwoordelijk voor het genereren deze activiteit.
    5. Vergelijk absorptie veranderingen veroorzaakt door eiwitextracten waarin een kandidaat-gen (smc00171, smc00930 of smc01003) had geuit met extracten dat alleen een lege vector haven.
      Opmerking: Om verder met de volgende stappen, de specifieke activiteiten veroorzaakt door eiwitextracten waarin een kandidaatgen voor een uit, ten minste twee of m bedragenore dan de waarden verkregen voor de specifieke activiteiten veroorzaakt door proteïne-extracten dat alleen een lege vector haven.
    6. Voor verdere experimenten, selecteert aandoeningen waarbij hydrolyse van p-nitrofenyl-bevattende verbinding minimaal met celvrije extracten (dwz lege vector) en waarvoor de meest uitgesproken vorming van p -NP en p -nitrophenolate anion (fig 1) kan worden waargenomen wanneer eiwitextracten worden gebruikt, waarbij een kandidaatgen voor een uit.
  2. Na het bepalen van de initiële enzymactiviteit in 3,1, optimaliseren van de testomstandigheden voor de betreffende enzym variëren van pH, type buffer, buffersterkte concentraties van NaCl, detergentia zoals Triton X-100, en de afwezigheid of aanwezigheid van verschillende tweewaardige kationen.
    1. Voor verschillende concentraties van elk variabel Bepaal de specifieke enzymactiviteit (zie 3.1.4.2) (het hoogste aantal verkregen definieert de voorwaardevan de maximale enzymactiviteit). Met de combinatie van optimale omstandigheden die voor elke variabele om een ​​optimale enzym assay waarbij elke variabele in de optimale concentratie te bepalen.

Figuur 1
Figuur 1. p-nitrofenyl esters kunstmatig substraat voor (fosfo) lipase in een spectrofotometrische assay. Na hydrolyse van p-nitrofenyl esters, een zuur (R-OH) en p-nitrofenol (p -NP) gevormd. Door de pKa = 7,2 voor de dissociatie van de fenolische H + van p -NP, bij een pH> 9,2 meer dan 99% in de felgele p -nitrophenolate vorm en een molaire extinctiecoëfficiënt van 18.000 M-1 cm - 1 kan worden gebruikt bij een golflengte van 405 nm voor de kwantificering van vrije p -nitrophenolate 22. Wanneer buffers met een pH van 8,5 werden gebruikt, werd de absorptie bepaald bij 400 nm en een molaire extinctiecoëfficiënt van 14.500 M -1 cm -1 werd gebruikt 23. Klik hier om een grotere versie van deze figuur te bekijken.

LET OP: Na de optimale omstandigheden voor de activiteit van het enzym van belang, zoals omschreven, beginnen aan de zoektocht naar de echte / fysiologische substraat van deze lipase. In principe nemen twee, vaak complementair, zal dit doel, een in vivo aanpak of een in vitro aanpak te komen.

4. In vivo identificatie van de fysiologische substraat van lipase

ove_content ">. OPMERKING: In een in vivo benadering, drukken de lipase van belang in een gastheerorganisme 8,11 voor de registratie na verloop van tijd de vraag of de expressie van het lipase verandert de host's lipidenprofiel In een andere in vivo benadering, het genereren van een deficiënte mutant van het gen van interesse 8,11 en onderzoeken of het lipidenprofiel verschilt van de wildtype versie 6,8,11. om een kwantitatieve beoordeling van een organisme lipidenprofiel verkrijgen, een eenvoudige methode bestaat uit radioactief merken cellulaire verbindingen , het extraheren van de lipiden, gescheiden door chromatografie, en kwantificeren van de radioactief gelabelde gescheiden lipiden.

  1. Radiolabeling van lipiden.
    1. Bereid een nacht voorkweek van een organisme van belang (E. coli of S. meliloti) in 5 ml van het gewenste kweekmedium (complex medium of gedefinieerd minimaal medium) en groeit bij 30 ° C.
    2. Uit de pre-culture, te enten in 20 ml van de same vers medium in een 100 ml kolf met een initiële OD 620 = 0,3 voor de cultuur te verkrijgen.
    3. Neem een ​​monster (1 ml) van de cultuur onder steriele condities overgebracht in een 14 ml steriele polystyreen ronde bodem buis.
    4. Voeg 1 pCi [1- 14 C] acetaat (60 mCi per mmol) aan de 1 ml cultuur.
    5. Incubeer de vloeibare kweek onder roeren bij 30 ° C gedurende 24 uur.
    6. Aan het einde van de incubatieperiode, breng de cultuur een 1,5 ml microcentrifugebuis en centrifugeer bij 12.000 xg bij kamertemperatuur gedurende 5 min.
    7. Resuspendeer de pellet in 100 pl water. Op dit punt, bewaar de celsuspensie bij -20 ° C of onmiddellijk verder met de extractie van polaire lipiden (sectie 4.2).
  2. Extractie van polaire lipiden.
    LET OP: De methode die hier in essentie beschreven volgt de procedure van Bligh en Dyer 19 gerapporteerd.
    1. De 100 ul waterige cel suspension, voeg 375 pl methanol: chloroform oplossing (2: 1, vol / vol).
    2. Vortex gedurende 30 seconden en incubeer gedurende 5 minuten bij kamertemperatuur.
    3. Centrifugeer 5 minuten bij 12.000 xg bij kamertemperatuur.
    4. Breng de supernatant naar een nieuwe 1,5 ml microcentrifugebuis.
    5. Voeg 125 ul van chloroform en 125 ui water, vortex 30 sec.
    6. Centrifugeer 1 min bij 12.000 xg bij kamertemperatuur.
    7. Breng de onderste chloroformfase naar een nieuwe buis en droog met een stroom stikstofgas.
    8. Lossen gedroogde lipiden in 100 ui chloroform: methanol (1: 1, vol / vol).
      OPMERKING: Op dit punt, kan een monster van 5 gl van de lipideoplossing wordt gekwantificeerd door vloeistofscintillatietelling.
    9. Voor dunne-laag chromatografische analyse (TLC), droog de resterende 95 pl met een stroom stikstofgas gedroogd en los lipiden in 20 pl chloroform: methanol (1: 1, vol / vol). Gebruik een 3 gl aliquotvoor TLC-analyse.
  3. Scheiding van polaire lipiden door dunnelaagchromatografie (TLC).
    Opmerking: Afhankelijk van de lipideklassen te analyseren, kunnen verschillende combinaties van vaste en mobiele fasen gebruikt worden voor de scheiding. Hier een typische scheiding voor geladen polaire lipiden en andere, meer geschikt voor neutrale polaire lipiden, met behulp van hoge prestatie dunnelaagchromatografie (HPTLC) silicagel aluminiumplaten als de vaste fase worden uiteengezet.
    1. Scheiding van geladen polaire lipiden door tweedimensionale TLC (2D-TLC).
      1. Breng een hoeveelheid van 3 pl lipide monster in een hoek van een HPTLC silicagel aluminiumplaat (10 x 10 cm), 2 cm van de rand van de plaat.
      2. Bereiden en meng de mobiele fase (140 ml chloroform, 60 ml methanol en 10 ml water) voor scheiding in de eerste dimensie.
      3. Coat een TLC ontwikkelen kamer intern met chromatografie papier.
        Opmerking: Dit om te verzekeren dat de gasfase van de kamerwordt snel verzadigd (binnen 30 minuten) na de mobiele fase voor de eerste dimensie is toegevoegd aan de kamer en de kamer is afgesloten met een glazen plaat.
      4. Bereiden en meng de mobiele fase (130 ml chloroform, 50 ml methanol en 20 ml ijsazijn) voor scheiding in de tweede dimensie overgebracht in een tweede TLC ontwikkelkamer inwendig gecoat chromatografiepapier en laat de kamer verzadigen.
      5. Zorgvuldig overdracht van de HPTLC silicagel aluminium plaat met de gedroogde lipide monster naar de eerste kamer en de ontwikkeling van (dat wil zeggen, uit te voeren chromatografie) de plaat gedurende 60 minuten in de gesloten kamer in de eerste dimensie 5.
      6. Neem de plaat uit de kamer en laat oplosmiddelen drogen in een stroom kap voor 30 min.
      7. Nadat de plaat van 90 graden met betrekking tot de vorige chromatografie, breng de HPTLC silicagel aluminiumplaat waarop de lipiden in één dimensie gescheiden, de twd kamer en de ontwikkeling van de plaat gedurende 60 minuten in de tweede dimensie 5.
      8. Verwijder de plaat uit de kamer en laat de oplosmiddelen drogen in een stroom kap voor ten minste 2 uur.
    2. Scheiding van neutrale polaire lipiden.
      1. Toepassen 3 gl aliquots lipide monsters op een HPTLC silicagel aluminiumplaat vanaf 2 cm van de rand van de plaat. Indien meerdere monsters worden geanalyseerd in een eendimensionale chromatografie, op een afstand van ten minste 1,5 cm tussen de verschillende voorbeeldtoepassing spots.
      2. Voor te bereiden en meng de mobiele fase (140 ml hexaan, 60 ml diethylether en 8 ml azijnzuur) en overbrengen in een TLC ontwikkelen kamer inwendig bekleed met chromatografie papier en afgedekt met een glazen plaat naar de kamer verzadigde (30 min) te laten.
      3. Breng de HPTLC silicagel aluminium plaat met de gedroogde lipide monsters naar de kamer en de ontwikkeling van de plaat gedurende 30 minuten in de gesloten kamer.
      4. Neem de plaat uit de kameren laat de oplosmiddelen drogen in een stroom kap voor 2 uur.
  4. Kwantificering en visualisatie van gescheiden polaire lipiden.
    1. Zodra de ontwikkelde TLC plaat droog, incuberen met een fotostimuleerbare luminescentie (PSL) scherm in een gesloten cassette voor 3 dagen.
    2. Expose de geïncubeerde scherm om een ​​PSL scanner en het verwerven van een virtueel beeld van de afgescheiden radioactief gemerkte lipiden.
    3. Voer kwantificering met behulp van PSL software 20.
  5. Visualisatie en isolatie van afzonderlijke polaire lipiden klassen.
    1. Incubeer ontwikkelde TLC plaat gedurende 10 min in een kamer chromatografie bij aanwezigheid van 1 g jodium kristallen.
      LET OP: Gescheiden lipide verbindingen zullen de jodium te ontbinden en verschijnen als bruinachtige vlekken.
    2. Omcirkel de vlekken met een potlood, vergelijken met de relatieve mobiliteit (R f) van de standaard verbindingen (dat wil zeggen 1,2-dipalmitoyl sn-glycerol, dipalmitoyl-L-α-fosphatidylcholine, DL-α-monopalmitine of palmitinezuur) en identificeren welke lipide klasse zij zouden behoren.
    3. In een zuurkast, laat de jodium verdampen uit de TLC plaat.
    4. Met behulp van een spatel, schraap de silica gel die de verbinding van interesse van de plaat en extraheer de verbinding uit het silicagel met een mengsel van 100 pi water en 375 pi methanol: chloroform oplossing (2: 1; vol / vol).
    5. Ga verder met extractie volgens Bligh en Dyer zoals geschetst (4.2.2 en verder).
    6. WINKEL gezuiverd lipideklasse in 100 ui chloroform: methanol (1: 1, vol / vol) bij -20 ° C tot gebruik.

5. In vitro identificatie van de fysiologische substraat van lipase

Opmerking: In een in vitro benadering onderzoeken of de lipase plaats een mengsel van geïsoleerde lipiden of afzonderlijke zuivere lipiden kunnen omzetten in de overeenkomstige hydroltion producten onder de gedefinieerd als optimale in 3.2 omstandigheden.

  1. Gebruik pipetteren regelingen voor enzym assays als per tabel 3 voor PC-specifieke fosfolipase C SMc00171 (zie 5.2), fosfolipase A (zie 5.3), en DAG lipase SMc01003 (zie 5.4) activiteit.
  2. Bepaling van PC-specifieke fosfolipase C (tabel 3).
    1. Een 1,5 ml microcentrifugebuis, voeg 5000 tellingen per minuut (cpm) van de totale 14-gelabeld PC en een oplossing van Triton X-100.
    2. Mix en droog onder een stroom van stikstof.
    3. Diethanolamine add-HCl, pH 9,8 buffer, en NaCl en MnCl2 oplossingen en tweevoudig gedestilleerd water tot een eindvolume van 99,5 pl verkrijgen. Vortex gedurende 5 sec.
    4. Voeg 0,5 pl enzym (5 ug eiwit) (dwz een celvrij extract waarin overexpressie SMc00171 aanwezig is) om de reactie te starten. Meng kort.
    5. Incubeer bij 30 ° C gedurende 4 uur.
    6. Stop de reactie van detoevoeging van 250 ul methanol en 125 ui chloroform.
    7. Extract lipiden zoals eerder beschreven (zie 4.2).
    8. Aparte lipiden door één-dimensionale (1D) -TLC (zie 4.3.2 en 4.4), en analyseren door PSL beeldvorming.
  3. Bepaling van de fosfolipase A activiteit (Tabel 3).
    1. Een 1,5 ml microcentrifugebuis, voeg 5000 cpm totaal 14-C gemerkte fosfolipiden en een oplossing van Triton X-100.
    2. Mix en droog onder een stroom van stikstof.
    3. Voor een uiteindelijke 100 gl assay add Tris-HCl, pH 8,5 buffer NaCl-oplossing en water. Vortex gedurende 5 sec.
    4. Voeg 5 ul enzym (50 ug eiwit) (dwz een celvrij extract waarin overexpressie SMc00930 of SMc01003 aanwezig is).
    5. Incubeer bij 30 ° C gedurende 5 uur.
    6. Stop de reactie door toevoeging van 250 ul methanol en 125 ui chloroform.
    7. Extract lipiden zoals eerder beschreven (zie 4.2), apartnemen met 1D-TLC via 130 ml chloroform, 50 ml methanol en 20 ml ijsazijn als de mobiele fase, en analyseren van PSL beeldvorming.
  4. Bepaling van diacylglycerol (DAG) lipase-activiteit.
    1. Bereiding van 14 C-gelabeld DAG.
      1. Radioactief label S. meliloti culturen (zie 4.1) en pak polaire lipiden (zie 4.2) zoals beschreven. Aparte S. meliloti totale lipide extracten van 1D-TLC in chloroform: methanol: azijnzuur (130: 50: 20, vol / vol) via de tweede dimensie beschreven scheiding 4.3.1 omstandigheden.
      2. Visualiseer PC door jodium kleuring en gebruik maken van een potlood om de lokalisatie van fosfatidylcholine (PC) te markeren.
      3. Isoleer radiolabeled PC zoals beschreven in 4.5.
      4. Kwantificeren uitgepakte PC door scintillatietelling.
        LET OP: Ongeveer 320.000 cpm PC wordt verwacht.
      5. Behandel PC (250.000 cpm) met 0,1 U van fosfolipase C uit Clostridium perfringens in 50 mM Tris-HCl, pH 7,2, 0,5% Triton X-100 en 10 mM CaCl2 gedurende 2 uur in een totaal volume van 100 ul en stop de reactie door toevoeging van 250 ul methanol en 125 ui chloroform.
      6. Extract lipiden zoals eerder en apart beschreven door hen door 1D-TLC (zie 4.3.2).
      7. Isoleer diacylglycerol van siliciumoxideplaat en kwantificeren scintillatietelling (zoals beschreven in 4.2)
    2. Diacylglycerol lipase assay (Tabel 3).
      1. Een 1,5 ml microcentrifugebuis, voeg 5000 cpm van 14 C-gelabeld DAG en een oplossing van Triton X-100.
      2. Mix en droog onder een stroom van stikstof.
      3. Voor een uiteindelijke 100 gl assay add Tris-HCl (pH 9,0) -buffer, een NaCl-oplossing en gebidestilleerd water. Vortex gedurende 5 sec.
      4. Start de reactie door toevoeging van 5 pi enzym (50 ug eiwit celvrij extract).
      5. Incubeer bij 30 ° C gedurende 4 uur.
      6. Stop de reactie door toevoeging van 250 pl methanol eend 125 pl chloroform en extract lipiden zoals eerder beschreven (zie 4.2).
      7. Analyseer neutrale polaire lipiden door 1D-TLC (zie 4.1.3.2) en de daaropvolgende PSL beeldvorming.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Activiteit van PC-specifieke fosfolipase C SMc00171 met Bis- p nitrofenylfosfaat

Celvrije extracten verkregen van E. coli BL21 (DE3) pLysS x, die moest smc00171 expressie werden onderzocht op hun vermogen om bis-p-nitrofenylfosfaat esters hydrolyseren, onder toepassing van een spectrofotometrische enzymatische test, meten blz -NP gevormd. Geen hydrolytische activiteit was aanwezig in celvrije extracten verkregen van E. coli BL21 (DE3) pLysS x herbergt een lege pET9a vector (gegevens niet getoond) als bis-p-nitrofenylfosfaat werd toegepast als substraat.

Tijdsverloop voor de p -NP gevormde geven aan dat er een sterke afhankelijkheid van de hoeveelheid celvrije extract (van E. coli BL21 (DE3) pLysS x, die sm hadc00171 uitgedrukt) toegevoegd aan de assay (figuur 2A). Als de hoeveelheid p -NP gevormde alleen afhangt van enzymconcentratie dient een lineaire correlatie tussen enzym (eiwit) gebruikte concentratie en gevormde product na een bepaalde tijd worden waargenomen. Dit is duidelijk niet voor celvrije extracten verkregen van E. coli BL21 (DE3) pLysS x, die was smc00171 uitgedrukt (Figuur 2B). Hoewel er kunnen verschillende redenen zijn voor een exponentiële afhankelijkheid van enzymactiviteit op eiwitconcentratie 21, een frequente reden is dat bij verdunning van een enzym bevattend eiwitextract, andere componenten in het extract die kunnen beperkend voor enzymactiviteit, bijvoorbeeld, potentiële cofactoren , worden ook verdund. In dergelijke gevallen wordt onverwacht lage enzymactiviteiten geregistreerd verdunde celvrije extracten. Door een verzadigende concentratie van 3 mM MnCl2 in het enzym assay, de p -NP Gevormde product na enige tijd alleen afhankelijk van de hoeveelheid toegevoegd enzym (gegevens niet getoond) wat aangeeft dat MnCl2 was een beperkende component SMc00171 activiteit in celvrije extracten van E. coli.

Figuur 2
Figuur 2. Bepaling van SMc00171 (fosfolipase) activiteit met de kunstmatige substraat bis-p-nitrofenylfosfaat. Het tijdsverloop voor p -NP formatie shown gebruik celvrije extracten eiwitten (● 10 ug / ml ■ 15 ug / ml, ▲ 20 ug / ml) waarin SMc00171 werden uitgedrukt (A). p -NP gevormd na 40 min incubatie met verschillende hoeveelheden eiwitten celvrije extracten waarin SMc00171 werden uitgedrukt (B). Error bars geven de standaarddeviatie..jove.com / files / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> Klik hier om een grotere versie van deze figuur te bekijken.

Activiteiten van Voorspelde Patatin-achtige fosfolipasen SMc00930 en SMc01003 met p nitrofenyl acylesters van verschillende ketenlengten

Na expressie van smc00930 of smc01003 in E. coli BL21 (DE3) pLysS x celvrije extracten werden verkregen en onderzocht op hun vermogen om p-nitrofenyl vetzuur acyl esters hydrolyseren. Tijdens de enzymatische test, p -NP gevormd werd bepaald in een spectrofotometer. Minor hydrolytische activiteiten waren aanwezig in cel-vrij verkregen extracten van E. coli BL21 (DE3) pLysS x met een lege vector pET17b (Tabel 4) wanneer p nitrofenyl acyl esters van different ketenlengten werden gebruikt als substraten. Bij smc01003 expressie werd gebracht, de verkregen extracten toonde een toegenomen hydrolyse van p-nitrofenyl esters van verschillende ketenlengten. SMc01003 afgebroken middellange keten p nitrofenyl decanoaat en lange-keten p nitrofenyl palmitaat en stearaat p-nitrofenyl (Tabel 4). Als SMc01003 is een belangrijke bijdrage voor de vorming van lange-keten vrije vetzuren in S. meliloti tijdens stationaire fase 11 was het verrassend dat SMc01003 leek even goed werken op middellange-keten dan aan lange-keten acyl p-nitrofenyl esters (Tabel 4). Onverwacht SMc01003 werkt ook op korte keten substraten zoals p-nitrofenyl butyraat of p-nitrofenyl octanoaat (gegevens niet getoond). Echter, deze laatste substraten ook afgebroken door activiteiten die in celvrije extracten van E. coli (dat wil zeggen, het herbergen van de lege vectof pET17b) zonder expressie extra gen en kortketenige substraten (C4), de helft van het substraat reeds afgebroken door E. coli intrinsieke enzymen (gegevens niet getoond). Het is duidelijk dat SMc01003 moet worden gezuiverd om te verduidelijken of SMc01003 werkt net zo goed op de korte, middellange en lange-keten substraten. In het algemeen, p-nitrofenyl acylesters kennelijk geen goede substraten voor SMc01003 begrijpelijke kan zijn wetende dat SMc01003 is in werkelijkheid een DAG lipase 11 zijn. Celvrije extracten, waarin smc00930 werd uitgedrukt, vertonen veel hogere enzymactiviteiten met p-nitrofenyl esters (Tabel 4). Ook SMc00930 is in staat om p nitrofenyl acylesters van verschillende ketenlengten (C10, C12, C14, C16 en C18) hydrolyseren, hoewel p nitrofenyl palmitaat (specifieke activiteit 5,5 mmol NP min - 1 mg eiwit - 1) is duidelijk de beste substraat voor SMc00930. Tot op heden, de physiologische substraat voor SMc00930 is onbekend.

Of het verkennen van Polar Lipids kan functioneren als substraten voor Voorspelde (fosfo) lipasen

Eenmaal per (fosfo) lipase enzymatische test is geoptimaliseerd met kunstmatige substraten, radiogelabeld lipide mengsels en zuivere lipiden kunnen worden getest als mogelijke substraten.

Bij testen SMc00171 bevattende celvrije extracten met 14 C-gelabeld PC onder optimale omstandigheden konden wij aantonen dat SMc00171 degradeert PC DAG, een resultaat dat werd bevestigd door massaspectrometrische studies 8. SMc00171 degradeert ook 32-P gelabelde PC fosfocholine en dus werkt als een PC-specifiek fosfolipase C (PLCP) 8, dat wordt geïnduceerd onder fosfor beperkende vegetatieve omstandigheden.

Wanneertesten SMc00930- of SMc01003 bevattende celvrije extracten met 14 C- of 32-P gemerkt totale polaire lipiden onder optimale omstandigheden konden wij aantonen dat geen van de fosfolipiden wordt afgebroken door SMc00930 of SMc01003 onder omstandigheden waarbij p-nitrofenyl acylesters functioneerde als substraten 11. Daarentegen commerciële fosfolipase A2 uit slangengif kon dergelijk mengsel van fosfolipiden 11 degraderen. Deze resultaten waren verrassend en onverwacht aangezien zowel SMc00930 en SMc01003 werden voorspeld dat Patatin-achtige fosfolipasen.

Bij het testen van SMc00930- of SMc01003 bevattende celvrije extracten met 14 C- gelabeld diacylglycerol (DAG) onder optimale omstandigheden, konden we laten zien dat DAG niet wordt afgebroken door SMc00930 of celvrije extracten van E. coli, terwijl SMc01003 degradeert DAG en vormt verbindingen die migreren als vrije vetzuren (figuur 3). Recent konden we aantonen dat SMc01003 fungeert als DAG lipase dat DAG kunnen afbreken of monoacylglycerol glycerol en vrije vetzuren 11 (figuur 4).

figuur 3
Figuur 3. SMc01003 degradeert diacylglycerol. Celvrije extracten van E. coli BL21 (DE3) × pLysS uitdrukken SMc01003, SMc00930 of met de lege pET17b vector, of buffer werden met 14 C-DAG (verkregen van S. meliloti) gedurende 24 uur. Aan het einde van de respectieve incubatietijd werden radioactief gemerkte lipiden geëxtraheerd en gescheiden door TLC-1D met de mobiele fase voor het scheiden neutrale polaire lipiden (zie 4.3.2). FA, vetzuren; DAG, diacylglycerol. Dit cijfer is gewijzigd ten opzichte van [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4. Enzymatische functie van diacylglycerol lipase DGLA (SMc01003). Diacylglycerol (DAG) lipase SMc01003 degradeert DAG te monoacylglycerol en een vetzuur, en dan degradeert monoacylglycerol verder glycerol en een vetzuur. Klik hier om een grotere versie van deze foto figuur.

oligonucleotide
naam
Volgorde
(5'-3 ')
Gen
van belang
enzyme beperking
website toegevoegd
Vector
voor expressie
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 NdeI pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 XhoI pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 NdeI pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 BamHI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 NdeI pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 BamHI pET9a
Letters in vet geven restrictie sites.

Tabel 1. Oligonucleotiden gebruikt voor het amplificeren en kloon voorspelde fosfo (lipase) genen in pET17b of pET9a vector. Primer oligonucleotiden werden ontworpen met behulp van de beschreven software 15.

Assay voor SMc00171 Assay voor SMc01003 Assay voor SMc00930
Voorraad bestanddeel
Tris-HCl, pH 8,5 25 gl
2 M Tris-HCl, pH 9,0 25 gl
1 M diethanolamine-HCl, pH 9,8 50 gl
1 M NaCl 40 gl 150 gl 150 gl
1% Triton X-100 200 gl 200 gl
50 mM p- nitrofenyl palmitaat 12,5 pl 12,5 pl
200 mM bis- p- nitrofenylfosfaat 2,5 pl
celvrij extract (1 mg Protein / ml) met kandidaatgen uitgedrukt 20 gl 100 gl 1 pi
tweevoudig gedestilleerd water 887,5 pl 512,5 pl 611,5 pl
Final Volume 1 ml 1 ml 1 ml

Tabel 2. Pipetting regelingen voor optimale enzym assays met kunstmatige p nitrofenyl ester substraten.

Assay voor smc00171 gecodeerde fosfolipase C Assay voor smc01003 - gecodeerde DAG lipase Geoptimaliseerd test voor fosfolipase A activiteit
Voorraad bestanddeel
2 M Tris-HCl pH 8,5 2,5 pl
2 M Tris-HCl pH 9,0 2,5 pl
100 mM MnCl2 3 gl
1 M Diethanolamine-HCl pH 9,8 5 gl
1 M NaCl 4 gl 15 ul 15 ul
1% Triton X-100 2 gl 20 gl 20 gl 14 C-gelabeld lipide (fosfolipiden) 20 pl (5000 cpm)
14 C-gelabeld lipide (PC) 20 pl (5000 cpm)
14 C-gelabeld lipide (DAG) 20 pl (5000 cpm)
10 mg / ml Eiwitextract met expressie kandidaatgenen 0,5 pl 5 gl 5 gl
tweevoudig gedestilleerd water 87,5 pl 77,5 pl 77,5 pl
eindvolume 100 gl 100 gl 100 gl

Tafel3. Pipetting's voor optimale enzym assays voor (fosfo) lipide lipasen radioactief gemerkte substraten.

activiteit wordt gegeven in eenheden (umol nitrofenol / mg eiwit x min)
Vetgedrukte cijfers duiden acyl ketenlengte van p-nitrofenyl ester substraat 10 12 14 16 18
E. coli extract (achtergrond) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 expressie gebracht in E. coli extract 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 expressie gebracht in E. coli extract 43 ± 2.1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 minus achtergrond 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 minus achtergrond 27 ± 2.1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tabel 4. p nitrofenyl acylesters als substraten voor patatin-achtige lipasen SMc00930 en SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In de afgelopen 20 jaar hebben genomen van vele organismen gesequenced en hoewel een schat aan genoomsequentie gegevens zijn gegenereerd, wordt de functionele interpretatie achterstand en belemmert daardoor ons begrip van de werking van het genoom. Genfuncties in het genoom worden vaak toegewezen op basis van similariteit met genen van bekende functie of voorkomen van geconserveerde motieven. De precieze functie van een bepaald gen vaak niet bekend. Vooral voorspelde structurele genen voor enzymen kunnen gemakkelijk met een mische technieken vanwege het feit dat de meeste enzymen katalyseren reacties waarbij twee complexe substraten en twee producten. Momenteel lijkt het haalbaar om substraatspecificiteiten voor groepen van enzymen staand waarbij ten minste één drager is bevestigd en waarbij de andere worden gevarieerd. Bijvoorbeeld, in de meeste eukaryoten fosforylering motieven in eiwitten zijn bekend en consensus kinasen peptiden werden gespot op vaste dragers om peptide ar genererenstralen. Het gebruik van dergelijke arrays en radioactief gemerkt ATP, substraat specificiteit en activiteit van verschillende kinasen van een organisme kan bepaald worden geschapen voor een kinome profiel en definiëren substraatspecificiteit 24. Hydrolasen samen een grote groep van enzymen die een substraat water, wordt vastgesteld maar waarvoor de exacte aard van de (andere) substraat te hydrolyseren is vaak niet bekend. Het feit dat een nieuw enzym de optimale testomstandigheden worden ook niet bekend, zet de detectie van een nieuwe enzymactiviteit in een multivariabele probleem. Derhalve kan helpen kunnen het substraat vast te hydrolyseren om bepalen onder welke omstandigheden het enzym beste werkt.

In dit manuscript beschrijven we de optimalisering van testomstandigheden voor potentiële (fosfo) lipasen met onbekende substraatspecificiteiten en werken hoe deze geoptimaliseerde omstandigheden te gebruiken in de zoektocht naar het natuurlijke substraat van het rerespectieve (fosfo) lipase. Het belang van deze techniek bestaat erin dat de hydrolyse van het fluorogene of chromogene, kunstmatige substraten, die natuurlijke substraten enigszins nabootsen, kunnen worden gevolgd door spectrofotometrie 25 en dat deze assays makkelijk toepasbaar grootschalige studies 26. Vanwege de gevoeligheid van dergelijke bepalingen en de eenvoud om de reactie te controleren, kunnen ze gemakkelijk worden geoptimaliseerd voor een gegeven enzym. Uiteraard, voor kunstmatige substraten men zou verwachten minder gunstige kinetische constanten (dat wil zeggen, een hoge K M, lage k kat) voor een specifiek enzym dan voor natuurlijke substraten 1,21. In de praktijk echter, de gemakkelijke beschikbaarheid en detecteerbaarheid kunstmatige substraten functioneren als (slecht) substraten voor hele groepen enzymen vaak meer dan compenseren nadelen. Zodra de voorwaarden hebben ondervonden om een ​​enzym te werken (met kunstmatig substraat), zal dit met de Natural / fysiologische substraat ook. Als de bereiding en isolatie van lipide potentiële substraten omslachtig en tijdrovend kan zijn, is het belangrijk om de zekerheid dat een enzym is klaar voor gebruik bij het combineren en te incuberen waardevolle substraten. Belangrijk is dat de procedure van eerste optimale voorwaarden voor een enzym werkt, zal een snellere identificatie van de fysiologische substraat voor een nieuw (fosfo) lipase toe. Als een proof of concept, hebben we met succes gebruikt deze methode voor de karakterisatie van substraat specificiteiten van lipasen SMc00171, SMc00930 en SMc01003 8,11. Daarentegen veel traditionele alternatieve methoden voor vaststelling assays (fosfo) lipase activiteiten omvatten reacties waarbij substraat en product reeds bekend.

Uiteraard modificaties van assays voor het detecteren optimale enzymactiviteit kan omvatten het gebruik van andere fluorogene, chromogene of andere tekens kunstmatige substraten variatievan enzymconcentratie, aard en concentratie van buffers of andere additieven (bijvoorbeeld, detergentia of tweewaardige kationen). Indien geen enzymactiviteit wordt gedetecteerd met kunstmatig substraat, de respectievelijke enzym kan simpelweg niet met dit substraat, maar oplossen in dat geval zeker moeten worden opgenomen om de zekerheid dat alle voorzorgsmaatregelen zijn genomen die nodig zouden zijn te handhaven enzymactiviteit intact 27 (dat wil zeggen, opslaan celvrije extracten bij 4 ° C of lagere temperaturen tot gebruik en, indien nodig, het toevoegen van een cocktail van proteaseremmers celvrije extracten om proteolytische afbraak van het enzym van belang te voorkomen).

Beperkingen van de in dit manuscript techniek zijn te wijten aan het feit dat het kunstmatige substraat en het natuurlijke substraat zijn verschillend van elkaar en derhalve de bio-energetica van de gekatalyseerde reactie zal eveneens 1 zijn. De verschillende parameters de voor optimale enzymactiviteit Voorts dienen voor het natuurlijke substraat (door het variëren van pH, type buffer, buffersterkte concentraties NaCl en detergentia zoals Triton X-100, de afwezigheid of aanwezigheid van verschillende tweewaardige kationen), als ze zouden kunnen blijken te zijn enigszins afwijken van de optimale omstandigheden die voor het kunstmatig substraat. Een andere belangrijke beperking is dat waarschijnlijk niet alle (fosfo) lipasen worden gedetecteerd door het gebruik van kunstmatige chromogene substraten. Bijvoorbeeld, de kunstmatige p-nitrofenyl ester rest van de substraten kan simpelweg te groot zijn of andere chemische eigenschappen vertonen die verhinderen dat een dergelijk substraat toegang tot de actieve plaats van een enzym kan krijgen. Opgemerkt werd dat de DAG lipase SMc01003 weergegeven vanaf activiteiten met p-nitrofenyl ester substraten van verschillende ketenlengten 11. Met de wetenschap dat DAG is het natuurlijke substraat voor SMc01003 en DAG een reltief kleine polaire kopgroep, bestaande uit glycerol slechts 11, is gemakkelijk denkbaar dat de omvangrijke p-nitrofenyl residu is simpelweg te groot voor een gemakkelijke toegang tot de actieve plaats van SMc01003. Echter, de moleculaire details waarom p-nitrofenyl esters zijn geen goede substraten voor SMc01003 niet bekend punt.

Kritische stappen in het protocol omvatten alle bepalingen getroffen opdat het enzym onderzochte toegang tot de respectieve substraat. Bijvoorbeeld, bij het zoeken naar de fysiologische lipide substraat, is het essentieel dat het lipide substraat is aangebracht in een opgeloste vorm. Derhalve bij het opzetten van dergelijke enzym assays (beschreven in 5 van het protocol), lipide substraten, gewoonlijk opgelost in mengsels van methanol: chloroform, worden gemengd met een waterige oplossing van een detergens, dat wil zeggen, Triton X-100, voor het drogen omlaag het mengsel met stikstofgas. Deze procedure garandeert dat, na toevoeging van het resterende ingrediënten voor de test wordt de potentiële lipidesubstraat ingebed in detergens micellen en daarmee toegankelijk voor het enzym tijdens de test.

In principe moet de hier gepresenteerde techniek op grote schaal toegepast in de toekomst voor de ontdekking van nieuwe (fosfo) lipasen en de omschrijving van hun natuurlijke substraten. De techniek is eenvoudig uit te breiden voor andere klassen van hydrolasen, maar het kan ingewikkelder assays met kunstmatige substraten voor nieuwe enzymen die twee, meestal onbekend, substraten vereisen om hun katalytische cyclus te voltooien ontwikkelen.

Voor voorspeld (fosfo) lipase of fosfatasen noch de juiste substraat bekend noch de assay omstandigheden waarin het enzym werkt goed. Daarom zou het nuttig zijn te onderzoeken of bepaalde verbinding uit een batterij van kunstmatige verbindingen, zoals p-nitrofenyl afzonderlijke verbindingen (p-nitrofenyl fosfaat, bis-p-nitrofenylfosfaat, p-nitrofenyl palmitaat), kan fungeren als substraat. De ontdekking van de eerste enzym activiteiten met kunstmatige substraten heeft de weg op te lossen dat SMc00171 is een PC-specifieke fosfolipase C 8 verhard, dat SMc01003 is een DAG lipase 11, en heeft bijgedragen tot de voorwaarden waaronder SMc00930 fungeert als een hydrolase 11 definiëren. Het is duidelijk dat het natuurlijke substraat van SMc00930 is op dit moment nog niet bekend en de fysiologische context van SMc00930 en SMc01003 nog moeten worden opgelost. Daarom is de taak van de voorstellen van een fysiologische functie voor een voorspelde lipase is uitdagend en niet altijd meteen een ontmoeting met succes. Met behulp van mutanten deficiënt van de voorspelde lipase-gen en deze te vergelijken met de respectievelijke wild type stam zou experimenteel bewijs dat de lipase handelt met de specificiteit in zijn inheemse stam achtergrond, dat is gepostuleerd in deel 4) van het protocol geven. Het is duidelijk dat de vordering van een nieuwe lipase-activiteit should worden ondersteund door in vitro aantoont dat een substraat wordt omgezet door hydrolyse in bepaalde producten. Soms is de veronderstelde fysiologische functie vervullen zou hiaten in metabole routes of de fysiologische gedrag van het producerende organisme uit te leggen, maar in andere gevallen is er alleen maar zou nog steeds niet genoeg biochemische kennis te voelen van een aantal activiteiten te maken. Tijdens onze studies identificeerden we een aantal enzymen die inwerken op intrinsieke polaire membraanlipiden bacteriën te degraderen en, in sommige gevallen om te zetten in een speler in complexere lipide cycli. Zo combineert de nieuwe kennis dat SMc00171 een PC-specifiek fosfolipase C (PLCP) 8 die wordt geïnduceerd onder fosfor randvoorwaarden van groei met reeds bestaande data, kan men een nieuwe DAG cyclus kan staan veel milieu proteobacteria postuleren en die aanleiding geven tot de vorming van fosforvrije membraanlipiden als fosfor-groeibeperkende. in contrast, wanneer fosfor voorraden zijn er in overvloed, DAG is gerefosforyleerd aan fosfatidezuur het invoeren van de novo fosfolipide biosynthese, waardoor deze lipide cyclus te sluiten en ervoor te zorgen dat vooral (glycero) fosfolipiden die aanwezig zijn in het membraan 8,28 zijn.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd ondersteund door subsidies van Consejo Nacional de Ciencias y Tecnología-México (CONACyT-Mexico) (82.614, 153.998, 253.549 en 178.359 in Investigación Científica Básica evenals 118 in Investigación en Fronteras de la Ciencia) en vanaf Dirección General de Asuntos de Personal Académico-Universidad Nacional Autónoma de México (DGAPA-UNAM; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Het definiëren van de ondergrond hebben voor lipase en fosfolipase Kandidaten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter