Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Définition Substrat Spécificités pour lipase et phospholipase candidats

doi: 10.3791/54613 Published: November 23, 2016

Abstract

Microorganismes produisent un large spectre de (phospho) lipases qui sont sécrétées dans le but de faire des substrats extérieurs disponibles pour l'organisme. Alternativement, d'autres (phospho) lipases peuvent être associées physiquement l'organisme producteur provoquant un chiffre d'affaires de lipides intrinsèques et souvent donner lieu à un remodelage des membranes cellulaires. Bien que les potentiels (phospho) lipases peuvent être prédits avec un certain nombre d'algorithmes lorsque la séquence de gène / protéine est disponible, la preuve expérimentale de l'activité des enzymes, des spécificités de substrat et les fonctions physiologiques potentiels a souvent été obtenu. Ce manuscrit décrit l'optimisation des conditions d'essai pour les futurs (phospho) lipases avec des spécificités de substrat inconnus et comment employer ces conditions optimisées dans la recherche pour le substrat naturel d'un (phospho) lipase respective. En utilisant des substrats chromogènes artificiels, tels que les dérivés p - nitrophényle, peuvent aider à détecter un mineurl'activité enzymatique d'un (phospho) lipase prédite dans des conditions standard. Après avoir rencontré une telle activité enzymatique faible, les paramètres distincts d'un dosage enzymatique peut être modifiée afin d'obtenir une hydrolyse plus efficace du substrat artificiel. Après avoir déterminé les conditions dans lesquelles une enzyme fonctionne bien, une variété de substrats naturels potentiels doit être testé pour leur dégradation, un processus qui peut être suivie en utilisant des méthodes chromatographiques distinctes. La définition des spécificités de substrat pour de nouvelles enzymes, fournit souvent des hypothèses pour un rôle physiologique potentiel de ces enzymes, qui peuvent ensuite être testés expérimentalement. Suite à ces directives, nous avons été en mesure d'identifier une phospholipase C (SMc00171) qui dégrade la phosphatidylcholine à phosphocholine et diacylglycérol, dans une étape cruciale pour le remodelage des membranes dans la bactérie Sinorhizobium meliloti sur les conditions de phosphore limitation de la croissance. Pour deux prédit patatin-comme phospholipases (SMc00930 et SMc01003) du même organisme, nous pourrions redéfinir leurs spécificités de substrat et de préciser que SMc01003 est une lipase de diacylglycérol.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Lipides à base de glycérol tels que triacylglycérols et (glycéro) phospholipides constituent importante et probablement les classes de lipides les plus connus 1. Triacylglycérols (TAG) sont des graisses ou des huiles, qui fonctionnent habituellement comme les lipides de stockage, et donc en tant que sources d'énergie et de carbone potentiels. TAGs peuvent être dégradés par les lipases, qui sont souvent sécrétées par l'organisme producteur à digérer TAGs externes et les rendre disponibles en tant que sources de carbone. En outre, les lipases ont été largement étudiés au cours des années en raison de leurs applications biotechnologiques importantes 2.

En raison de leur nature amphiphile et leur forme quasi cylindrique, les propriétés des membranes formant (glycéro) phospholipides présentent et constituent généralement les principaux composants lipidiques d'une membrane bicouche 3. Dans les micro - organismes simples, tels que la bactérie Escherichia coli, seules les trois principales variantes de groupe de tête, le phosphatidylglycérol (PG), cardiolipine (CL), et phosphatidylethanolamine (PE) sont rencontrées, mais il faut savoir que chacun d'entre eux pouvant être substitué par un grand nombre de différentes chaînes d'acyle gras en position sn -1 et sn -2 positions donnant lieu à un grand nombre d'espèces moléculaires différentes 4 . D'autres bactéries pourraient avoir d'autres phospholipides, en plus ou au lieu. Par exemple, Sinorhizobium meliloti, une bactérie du sol, qui est capable de former une racine nodule symbiose fixatrice d'azote avec la luzerne , des légumineuses (Medicago sativa), contient en outre au PE d' un second phospholipide zwitterionique, la phosphatidylcholine (PC) 5. En outre, les lipides ne contenant pas de phosphore ou de glycérol peuvent faire partie amphiphile et la forme de la membrane cellulaire. Par exemple, des conditions de croissance du phosphore limitatif, en S. meliloti (glycéro- phospholipides) sont en grande partie remplacés par des lipides membranaires qui ne contiennent pas de phosphore, à savoir, les sulfolipides, les lipides ornithine et diacylglyceryl trimethylhomoserine (dgts) 6. Chez les bactéries, dgts est formé à partir de diacylglycérol (DAG) dans une voie à deux étapes 7 , mais la source pour la génération DAG était pas claire. Expériences pulse-chase ont suggéré que PC pourrait être un précurseur pour dgts 8 et en utilisant la méthodologie décrite dans ce manuscrit nous avons pu identifier une phospholipase C (PLCP, SMc00171) qui est formé dans des conditions de phosphore limitatif et qui peut convertir PC en DAG et phosphocholine 8.

Dans une étude séparée, nous avons découvert que l'acyl-CoA synthétase (FADD) mutant déficient de S. meliloti ou d'Escherichia coli accumulée des acides gras libres lors de l' entrée en phase stationnaire de croissance 9. Bien que ces acides gras semblent être dérivés à partir des lipides membranaires, l'origine précise pour les acides gras libres ou de l'enzyme (s) en les libérant sont pas connus. Encore une fois, en utilisant la stratégie décrite dans ce manuscrit, deux 10 (phospho) lipases patatine-like (SMc00930 et SMc01003) qui a contribué à la formation d'acides gras libres dans S. meliloti 11 ont été prédit. De manière surprenante, SMc01003 DAG utilisé comme substrat le convertissant en monoacylglycérol et , enfin , du glycérol et des acides gras libres 11. Par conséquent, SMc01003 est une lipase DAG (DGLA).

Bien qu'un certain nombre d'algorithmes existent pour prédire le potentiel (phospho) lipases 12,13, leur fonction précise et rôle physiologique est généralement pas connue. Nous présentons ici un protocole, pour cloner et surexpriment (phospho) lipases prédites ou potentiels. Ce manuscrit explique comment les dosages enzymatiques peuvent être développées et optimisées pour le (phospho) lipase surexprimé en utilisant des substrats chromogènes artificiels. Nous fournissons des exemples comment avec un test enzymatique optimisé réel (phospho) substrat de lipase peut être rencontré et comment ces résultats pourraient enrichir notre compréhension de la physiologie microbienne.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Clone et surexpriment gène de structure pour la lipase prédite

  1. En utilisant la réaction en chaîne par polymérase (PCR) 14 et des oligonucléotides spécifiques (Tableau 1) 15, amplifient le gène d'intérêt (smc01003, smc00930 ou smc00171), prévu pour coder pour une lipase ou phospholipase, de l'ADN génomique de l'organisme hôte (c. -à- S. meliloti).
    1. Introduire des sites de restriction spécifiques (avec la séquence des oligonucléotides conçus). Digérer le fragment d'ADN amplifié avec les enzymes de restriction correspondantes et le cloner dans un vecteur d'expression tel que des plasmides de la série pET 16.
    2. Après vérification de la séquence d'ADN pour le gène clone, de transformer le vecteur à une souche d'expression telle que Escherichia coli BL21 (DE3) pLysS 16.
  2. Préparer un pré-culture de nuit de l'hôte d'expression E. coli BL21 (DE3) pLETJ, hébergeant le vecteur pET respectif avec le gène clone ou le vecteur vide, dans 100 ml des flacons de culture contenant 20 ml de bouillon Luria Bertani (LB) 17 ainsi que les antibiotiques nécessaires. La culture des cellules à 30 ° C (ou à la température habituelle de croissance de la bactérie à partir de laquelle la lipase est originaire).
    1. En utilisant les pré-cultures de la nuit, inoculer 500 ml de milieu LB préchauffée (plus les antibiotiques nécessaires) dans 2 flacons L de culture pour obtenir une densité optique initiale à 620 nm (DO 620) = 0,05. Suivre la croissance des cultures et à une DO620 = 0,3, ajouter de l' isopropyl-β-D-thiogalactoside (IPTG) jusqu'à une concentration finale de 100 uM, et on incube sous agitation à 30 ° C pendant une période de 4 heures.
    2. A la fin de la période d'incubation, chaque culture transférer dans un tube à centrifuger de 500 ml et centrifuger à 5000 g à 4 ° C pendant 30 min. Remettre en suspension les culots de cellules bactériennes dans 5 ml de tampon de suspension (par exemple, SMc00930- et des cellules exprimant SMc01003 dans du Tris-HCl 50 mM pH 8,0 et les cellules exprimant SMc00171 dans 50 mM diéthanolamine-HCl, pH 9,8). Stocker les suspensions cellulaires à -80 ° C jusqu'à utilisation.

2. Préparer des extraits de protéines sans cellules et déterminer Protein Concentration

  1. Décongeler suspensions de cellules bactériennes et les stocker sur la glace. Passer des suspensions de cellules à trois reprises à travers une cellule sous pression à froid à 20.000 livres par pouce 2. Retirer les cellules intactes et les débris cellulaires par centrifugation à 5000 xg pendant 30 min à 4 ° C.
  2. Après centrifugation, on prépare des aliquotes de 100 et 500 ul du surnageant pour une analyse ultérieure et de les stocker à -80 ° C jusqu'à utilisation.
  3. Utiliser une fraction aliquote de 100 ul pour déterminer la concentration en protéines des extraits exempts de cellules distinctes par un procédé de choix , ou comme décrit 18.

3. Utiliser des substrats artificiels pour optimiser EnzymeActivités de (phospho) lipases

  1. Pour une couverture initiale des activités enzymatiques distinctes, en utilisant des substrats artificiels qui produisent un produit coloré lors de l' hydrolyse, tels que le p - nitrophénol (p -NP).
    1. Pour les dosages enzymatiques déjà optimisés avec des substrats d'ester p - nitrophényle artificiels (décrites pour la phospholipase C PLCP (SMc00171), ainsi que pour les phospholipases de patatine comme prédit SMc00930 et SMc01003), les systèmes de pipetage d'utilisation décrites dans le Tableau 2.
    2. Lors de l' exploration d' un nouveau potentiel (phospho) lipase, préparer un premier essai enzymatique standard contenant 50 mM de Tris-HCl, pH 8,5, NaCl 100 mM, 0,05% de Triton X-100, 0,5 mM de p composé contenant nitrophényle (p phosphate de nitrophényle , le phosphate de bis - p - nitrophényle, p - nitrophényle décanoate, ou p - nitrophényle palmitate), et l' extrait de protéine acellulaire (check 1, 3, 10, 30, 100, 300 et 1000 ug) dans un volume total de 1 ml dans 1 ml de Cuve en plastiquettes.
      REMARQUE: Utiliser un pH alcalin (Figure 1) lorsque l'on suit l' hydrolyse de l' ester p - nitrophényle dans un dosage en continu. Vous pouvez également utiliser un seul des tests de temps de point pour une gamme de valeurs de pH, en ajoutant NaOH à la fin de la période d'incubation de mettre fin à la réaction enzymatique et de veiller à ce que tous les p -NP est présent sous forme de phénolate.
    3. Suivre le cours du temps une augmentation de l' absorbance à 405 nm, due à la formation de p -NP, dans un spectrophotomètre à 30 ° C sur une période de 5 min. Quantifier la formation initialement linéaire de p -NP en déterminant la pente initiale de l' augmentation de l' absorbance par unité de temps.
    4. Calculer la variation de la concentration (Ac) pour p -NP utilisant la loi de Beer-Lambert (AA = ε Ac d) 1.
      NOTE: AA est le changement linéaire d'absorbance déterminée, ε est le coefficient d'extinction molaire à la longueur d'onde respective (en unités de M -1 -1 cm), d est la longueur du trajet de lumière (1 cm) et Ac est la variation de concentration (en unités de M) à déterminer.
      1. Considérant que le volume d'essai est de 1 ml, calculer la quantité de p -NP formé.
        NOTE: Montant = concentration x volume.
      2. Calculer l'activité enzymatique en divisant la quantité de p -NP formé par le temps dans lequel il est formé. Déterminer l'activité enzymatique spécifique en divisant l'activité enzymatique par la quantité de protéine (en mg) qui était responsable de la génération de cette activité.
    5. Comparer les changements d'absorbance provoquées par des extraits de protéines dans lesquelles un gène candidat (smc00171, smc00930 ou smc01003) avait été exprimées avec des extraits qui abritent seulement un vecteur vide.
      NOTE: Afin de poursuivre avec les étapes suivantes, les activités spécifiques, causées par des extraits de protéines dans lesquelles un gène candidat avait été exprimés, devraient être au moins deux fois ou mminerai que les valeurs obtenues pour les activités spécifiques causées par des extraits de protéines qui abritent seulement un vecteur vide.
    6. Pour d' autres expériences, sélectionner les conditions dans lesquelles l' hydrolyse du composé p - nitrophényle contenant est minime avec des extraits exempts de cellules ( par exemple, vecteur vide) et pour lesquels la formation la plus prononcée de p -NP et l'anion p -nitrophenolate (Figure 1) peut être observé lorsque des extraits protéiques sont utilisés, dans lesquels un gène candidat a été exprimé.
  2. Après avoir déterminé l'activité enzymatique initiale de 3,1, d'optimiser les conditions de dosage pour l'enzyme concernée par le pH, le type de tampon variable, un tampon de force, des concentrations de NaCl, des détergents tels que le Triton X-100 et de l'absence ou en présence de divers cations bivalents.
    1. Pour différentes concentrations de chaque variable, déterminer l'activité enzymatique spécifique (voir 3.1.4.2) (le plus grand nombre obtenu définit la conditionde l'activité enzymatique maximale). Utiliser la combinaison des conditions optimales pour chacune des variables rencontrées pour définir un dosage enzymatique optimisé, dans lequel chaque variable est présent dans la concentration optimale.

Figure 1
Figure 1. p esters de nitrophényle substrats artificiels pour (phospho) lipases dans un dosage spectrophotométrique. Lors de l' hydrolyse des esters p - nitrophényle, un acide (R-OH) et p - nitrophénol (p -NP) sont formés. En raison du pKa = 7,2 pour la dissociation du H + phénolique à partir de p -NP, à un pH> 9,2 , plus de 99% sont en forme jaune p -nitrophenolate lumineux et un coefficient d'extinction molaire de 18 000 M -1 cm - 1 peut être utilisé à une longueur d'onde de 405 nm pour la quantification de p libre 22 -nitrophenolate. Lorsque des tampons avec un pH de 8,5 ont été utilisés, l'absorbance a été déterminée à 400 nm et un coefficient d'extinction molaire de 14500 M -1 cm -1 a été utilisé 23. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

NOTE: Après avoir défini les conditions optimales pour l'activité de l'enzyme d'intérêt, se lancer dans la recherche pour le substrat réel / physiologique de cette lipase. En principe, prendre deux, souvent complémentaires, les approches pour atteindre cet objectif, une approche in vivo ou une approche in vitro.

4. In Vivo Identification de la Physiological Substrat d'une lipase

ove_content "> NOTE:. Dans une approche in vivo, exprimer la lipase d'intérêt dans un organisme hôte 8,11 afin de vous inscrire au fil du temps si l' expression de la lipase modifie le profil host's lipidique Dans une autre approche in vivo, générer un mutant déficient du gène d'intérêt 8,11 et étudier si son profil lipidique est distincte de la version de type sauvage 6,8,11. afin d'obtenir une évaluation quantitative du profil lipidique d'un organisme, une méthode simple consiste à radiomarquage composés cellulaires , l'extraction des lipides, en les séparant par chromatographie, et la quantification des lipides séparés marqués radioactivement.

  1. Le marquage radioactif des lipides.
    1. Préparer un pré-culture de la nuit d'un organisme d'intérêt (E. coli ou S. meliloti) dans 5 ml de milieu de culture souhaitée (milieu complexe ou un milieu minimal défini) et de croître à 30 ° C.
    2. De la pré-culture, ensemencer dans 20 ml de same milieu frais dans une culture de 100 ml flacon pour obtenir une première DO 620 = 0,3 pour la culture.
    3. Prélever une partie aliquote (1 ml) de la culture dans des conditions stériles et transférer dans un tube à fond rond en polystyrène de 14 ml stérile.
    4. Ajouter 1 uCi de [1- 14C] acétate de méthyle (60 mCi par mmole) à la culture de 1 ml.
    5. Incuber la culture liquide, sous agitation à 30 ° C pendant une période de 24 heures.
    6. À la fin de la période d'incubation, transférer la culture dans un tube de microcentrifugation de 1,5 ml et centrifuger à 12 000 x g à température ambiante pendant 5 min.
    7. Remettre en suspension le culot dans 100 pl d'eau. À ce stade, stocker la suspension de cellules à -20 ° C ou immédiatement poursuivre l'extraction des lipides polaires (section 4.2).
  2. Extraction des lipides polaires.
    NOTE: La méthode décrite ici essentiellement suit la procédure rapportée par Bligh et Dyer 19.
    1. Pour les 100 pi de susp aqueuse de cellulesension, ajouter 375 ul de methanol: solution de chloroforme (2: 1, vol / vol).
    2. Vortex pendant 30 secondes et incuber pendant 5 minutes à température ambiante.
    3. Centrifuger 5 minutes à 12 000 x g à température ambiante.
    4. Transférer le surnageant dans un nouveau tube de 1,5 ml microcentrifugeuse.
    5. Ajouter 125 ul de chloroforme et 125 pi d'eau, vortex 30 sec.
    6. Centrifuger 1 min à 12 000 x g à température ambiante.
    7. Transférer la phase de chloroforme inférieure à un tube frais et sec avec un courant d'azote gazeux.
    8. Dissoudre les lipides séchés dans 100 ul de chloroforme: une solution de methanol (1: 1, vol / vol).
      REMARQUE: À ce stade, une partie aliquote de 5 ul de la solution lipidique peut être quantifiée par comptage par scintillation liquide.
    9. Pour la Chromatographie sur couche mince (CCM), on sèche jusqu'à 95 pl restants avec un courant d'azote gazeux et redissoudre les lipides séchés dans 20 ul de chloroforme et une solution de methanol (1: 1, vol / vol). Utiliser une fraction aliquote de 3 ulpour l'analyse par CCM.
  3. La séparation des lipides polaires par chromatographie sur couche mince (CCM).
    NOTE: En fonction des classes de lipides à analyser, différentes combinaisons de phases solides et mobiles peuvent être utilisés pour la séparation. Voici une séparation typique des lipides chargés polaires et une autre, plus adaptés pour les lipides polaires neutres, en utilisant haute performance chromatographie sur couche mince (HPTLC) feuilles de gel de silice en aluminium comme phase solide, sont décrites.
    1. La séparation des lipides polaires chargés par CCM à deux dimensions (2D-CCM).
      1. Appliquer une aliquote de 3 ul d'échantillon de lipide dans un coin d'une feuille CCMHP de gel de silice et d'aluminium (10 x 10 cm), à 2 cm du bord de la plaque.
      2. Préparer et mélanger la phase mobile (140 ml de chloroforme, 60 ml de methanol et 10 ml d'eau) pour la séparation dans la première dimension.
      3. Manteau une chambre de développement CCM en interne avec du papier de chromatographie.
        Remarque: il est de faire en sorte que la phase gazeuse de la chambresera saturé rapidement (en 30 minutes) après la phase mobile pour la première dimension a été ajoutée à la chambre et la chambre a été fermée avec une plaque de verre.
      4. Préparer et mélanger la phase mobile (130 ml de chloroforme, 50 ml de méthanol et 20 ml d'acide acétique glacial) pour la séparation dans la deuxième dimension et le transfert à une deuxième chambre de développement CCM revêtues intérieurement avec du papier de chromatographie et de laisser le saturer de chambre.
      5. Transférer soigneusement la feuille d'aluminium du gel de silice HPTLC avec l'échantillon de lipide séché à la première chambre et le développement ( par exemple, effectuer la Chromatographie) , la plaque pendant 60 minutes dans la chambre fermée dans la première dimension 5.
      6. Retirer la plaque de la chambre et de laisser les solvants sèchent dans une hotte à flux pendant 30 min.
      7. Après avoir tourné la plaque de 90 degrés par rapport à la chromatographie précédente, transférer la feuille d'aluminium et de gel de silice HPTLC, sur laquelle les lipides ont été séparés dans une dimension, à la secondechambre de d , et développer la plaque pendant 60 minutes dans la deuxième dimension 5.
      8. Retirez la feuille de la chambre et laisser les solvants sèchent dans une hotte à flux pendant au moins 2 h.
    2. Séparation de lipides polaires neutres.
      1. Appliquer 3 aliquotes d'échantillons de lipides sur une feuille de gel d'aluminium CCMHP de silice à partir de 2 cm des bords de la plaque. Si plusieurs échantillons sont analysés en chromatographie unidimensionnel, à une distance d'au moins 1,5 cm entre les différents points d'application de l'échantillon.
      2. Préparer et mélanger la phase mobile (140 ml d'hexane, 60 ml diéthyléther, et 8 ml d'acide acétique) et le transfert à une chambre de développement CCM revêtues intérieurement avec du papier de chromatographie et recouverts d'une plaque de verre pour laisser le saturer de chambre (30 min).
      3. Transférer la feuille d'aluminium de gel de silice avec CCMHP des échantillons de lipide séché à la chambre et à développer la plaque pendant 30 minutes dans la chambre fermée.
      4. Retirer la plaque de la chambreet laisser les solvants sèchent dans une hotte à flux pendant 2 heures.
  4. Quantification et la visualisation des lipides polaires séparés.
    1. Une fois la feuille TLC développé est sec, incuber avec un écran luminescence photostimulable (PSL) dans une cassette fermée pendant 3 jours.
    2. Exposer l'écran incubé à un scanner de PSL et d'acquérir une image virtuelle des lipides radiomarqués séparés.
    3. Effectuer la quantification en utilisant un logiciel de PSL 20.
  5. Visualisation et l'isolement des différentes classes de lipides polaires.
    1. Incuber feuille CCM développée pendant 10 minutes dans une chambre de chromatographie en présence de 1 g de cristaux d'iode.
      NOTE: Séparé des composés lipidiques vont dissoudre l'iode et apparaissent comme des taches brunâtres.
    2. Encerclez les taches avec un crayon, les comparer à la mobilité relative (R f) de composés standards (ie, le 1,2-dipalmitoyl- sn - glycérol, dipalmitoyl-L-α-phosphatidylcholine, DL-α-monopalmitine, ou l'acide palmitique), et d'identifier à laquelle lipidique classe ils pourraient appartenir.
    3. Dans une hotte, laissez l'iode évaporer de la feuille TLC.
    4. Avec l'aide d'une spatule, gratter le gel de silice contenant le composé d'intérêt à partir de la feuille, et en extraire le composé à partir du gel de silice avec un mélange de 100 ul d'eau et 375 pi de methanol: solution de chloroforme (2: 1; en volume / vol).
    5. Continuer avec extraction selon Bligh et Dyer comme indiqué (4.2.2 et suivantes).
    6. Magasin purifié classe de lipides dans 100 ul de chloroforme et une solution de methanol (1: 1; volume / volume) à -20 ° C jusqu'à utilisation.

5. In Vitro Identification de la Physiological substrat d'une lipase

NOTE: Dans une approche in vitro, étudier si la lipase d'intérêt peut convertir un mélange de lipides isolés ou de lipides purs individuels à l'hydrol correspondantproduits YSE dans les conditions définies comme optimale en 3.2.

  1. Utilisez les systèmes de pipetage pour les dosages enzymatiques selon le tableau 3 pour phospholipase spécifiques PC C SMc00171 (voir 5.2), phospholipase A (voir 5.3), et DAG lipase SMc01003 (voir 5.4) activité.
  2. Détermination de l' activité phospholipase C spécifique au PC (tableau 3).
    1. Pour un tube de 1,5 ml, ajouter 5.000 coups par minute (cpm) du total 14 C marqué PC et une solution de Triton X-100.
    2. Mélanger et sécher sous un courant d'azote.
    3. Ajouter diéthanolamine-HCl, pH 9,8 tampon, ainsi que NaCl et MnCl2 solutions et de l' eau bidistillée pour obtenir un volume final de 99,5 pi. Vortex pendant 5 sec.
    4. Ajouter 0,5 ul d'enzyme (5 pg de protéine) (soit un extrait exempt de cellule dans laquelle surexprimé SMc00171 est présent) pour amorcer la réaction. Mélanger brièvement.
    5. Incuber à 30 ° C pendant 4 heures.
    6. Arrêter la réaction par l'addition de 250 ul de methanol et 125 ul de chloroforme.
    7. Extraire les lipides comme décrit précédemment (voir 4.2).
    8. lipides séparés par une dimension (1D) -TLC (voir 4.3.2 et 4.4), et les analyser par imagerie par PSL.
  3. Détermination de l' activité phospholipase (tableau 3).
    1. Un tube de 1,5 ml, ajouter 5 000 cpm d' un total de 14 phospholipides marqué au C et une solution de Triton X-100.
    2. Mélanger et sécher sous un courant d'azote.
    3. Pour un dosage final de 100 ul, ajouter du Tris-HCl, pH 8,5, un tampon, une solution de NaCl et de l'eau. Vortex pendant 5 sec.
    4. Ajouter 5 pi d'enzyme (50 pg de protéines) (soit un extrait exempt de cellule dans laquelle surexprimé SMc00930 ou SMc01003 est présent).
    5. Incuber à 30 ° C pendant 5 heures.
    6. Arrêter la réaction par addition de 250 ul de methanol et 125 ul de chloroforme.
    7. Extraire les lipides comme décrit précédemment (voir 4.2), séparéselles par 1D-CCM en utilisant 130 ml de chloroforme, 50 ml de methanol et d'acide acétique glacial 20 ml en tant que phase mobile, et de les analyser par imagerie PSL.
  4. Détermination de diacylglycérol (DAG) activité de la lipase.
    1. Préparation de 14 C marqué par DAG.
      1. Radiomarqueur S. cultures meliloti (voir 4.1) et extraire les lipides polaires (voir 4.2) comme décrit. Séparée S. meliloti totaux extraits lipidiques par 1D-CCM dans un mélange chloroforme: methanol: acide acétique (130: 50: 20, volume / volume) en utilisant les conditions décrites pour la séparation dans la deuxième dimension dans le 4.3.1.
      2. Visualisez PC par coloration d'iode et d'utiliser un crayon pour marquer la localisation de phosphatidylcholine (PC).
      3. Isoler PC radiomarqué comme décrit en 4.5.
      4. Quantifier PC extraite par comptage par scintillation.
        NOTE: A propos de 320.000 cpm PC est attendue.
      5. Traiter le PC (250 000 cpm) , avec 0,1 U de la phospholipase C de Clostridium perfringens dans 50 mM de Tris-HCl, pH 7,2, 0,5% De Triton X-100 et 10 mM de CaCl2 pendant 2 heures dans un volume total de 100 ul et d' arrêter la réaction en ajoutant 250 pi de methanol et 125 ul de chloroforme.
      6. Extraire les lipides comme décrit précédemment et séparés par eux par 1D-CCM (voir 4.3.2).
      7. Diacylglycérol isolât de la plaque de silice et la quantification par comptage par scintillation (comme décrit en 4.2)
    2. Dosage de la lipase diacylglycérol (tableau 3).
      1. Un tube de 1,5 ml, ajouter 5 000 cpm de 14C-DAG marqué et une solution de Triton X-100.
      2. Mélanger et sécher sous un courant d'azote.
      3. Pour un dosage final de 100 ul, ajouter du Tris-HCl (pH 9,0) tampon, une solution de NaCl et de l'eau bidistillée. Vortex pendant 5 sec.
      4. Initier la réaction en ajoutant 5 ul d'enzyme (50 ug de protéine d'extrait acellulaire).
      5. Incuber à 30 ° C pendant 4 heures.
      6. Arrêter la réaction par addition de 250 ul de methanol, und 125 ul de chloroforme et extrait les lipides comme décrit précédemment (voir 4.2).
      7. Analyser les lipides polaires neutres par 1D-CCM (voir 4.1.3.2) et l'imagerie PSL ultérieure.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L' activité de la phospholipase C spécifique au PC avec SMc00171 Bis- p - nitrophényle phosphate

Extraits exempts de cellules obtenues à partir de E. coli BL21 (DE3) pLysS x, qui ont exprimé smc00171, ont été étudiés pour leur capacité à hydrolyser p bis- esters de phosphate de nitrophényle, en utilisant un dosage enzymatique spectrophotométrique, la mesure du -NP p formée. Aucune activité hydrolytique était présent dans des extraits acellulaires obtenus à partir de E. coli BL21 (DE3) x pLysS hébergeant un pET9a vecteur vide (données non présentées) lorsque bis- phosphate p - nitrophényle a été utilisé comme substrat.

Cours de temps pour la -NP p formée indiquent qu'il existe une forte dépendance de la quantité d'extrait exempt de cellules (de E. coli BL21 (DE3) pLysS x, qui avait smc00171 exprimé) a été ajouté à l'essai (figure 2A). Si la quantité de produit formé -NP p dépendrait uniquement de la concentration enzymatique, une corrélation linéaire entre l' enzyme (protéine) de la concentration utilisée et le produit formé après un certain temps doit être observé. Il est clair que ceci est pas le cas pour des extraits acellulaires obtenus à partir de E. coli BL21 (DE3) pLysS x, qui a exprimé smc00171 (figure 2B). Bien qu'il pourrait y avoir plusieurs raisons pour une dépendance exponentielle de l' activité enzymatique de la concentration en protéine de 21, une raison fréquente est que lors de la dilution d'un extrait de protéine contenant une enzyme, d' autres composants dans l'extrait qui peuvent être limitatifs pour l' activité enzymatique, à savoir, des cofacteurs potentiels , sont dilués ainsi. Dans de tels cas, des activités enzymatiques étonnamment faibles sont enregistrés avec des extraits acellulaires après dilution. En incluant une concentration saturante de 3 mM de MnCl2 dans le dosage enzymatique, le p -NP Produit formé après un certain temps , ne dépend que de la quantité d'enzyme ajoutée (données non montrées) indiquant que MnCl 2 est un élément limitant l' activité SMc00171 dans des extraits exempts de cellules de E. coli.

Figure 2
Figure 2. Détermination de SMc00171 (phospholipase) l' activité en utilisant le substrat artificiel bis- phosphate p - nitrophényle. Le décours temporel de la formation p -NP est représenté employant des protéines des extraits acellulaires (● 10 pg / ml, ■ 15 pg / ml, ▲ 20 pg / ml) , dans laquelle a été exprimée SMc00171 (A). p -NP formé après 40 min d'incubation avec différentes quantités de protéines des extraits exempts de cellules dans lesquelles a été exprimée SMc00171 (B). Les barres d'erreur indiquent l'écart type..jove.com / fichiers / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Activités de Prédit patatine comme phospholipases SMc00930 et SMc01003 avec p - nitrophényle Acyl Esters de différentes longueurs de chaîne

Après l' expression de smc00930 ou smc01003 dans E. coli BL21 (DE3) pLysS x, les extraits acellulaires ont été obtenus et étudiés pour leur aptitude à hydrolyser les esters p - nitrophényle acyle gras. Au cours de l'essai enzymatique, la -NP p formée a été déterminée dans un spectrophotomètre. Activités hydrolytiques mineurs étaient présents dans des extraits exempts de cellules obtenues à partir de E. coli BL21 (DE3) pLysS x avec un pET17b vecteur vide (tableau 4) lorsque les esters p - nitrophényle acyles de différent longueurs de chaîne ont été utilisées comme substrats. Quand smc01003 a été exprimée, les extraits obtenus ont montré une augmentation de l' hydrolyse d'esters de p - nitrophényle de différentes longueurs de chaîne. SMc01003 dégradé nitrophényle le milieu décanoate chaîne p ainsi que la longue chaîne p - nitrophényle et p - nitrophényl palmitate stéarate (tableau 4). Comme SMc01003 est un contributeur majeur à la formation de longues chaînes d' acides gras libres dans S. meliloti pendant la phase stationnaire 11, il est surprenant que SMc01003 semblait agir aussi bien sur chaîne moyenne que sur longue chaîne esters p nitrophényle acyl (tableau 4). Contre toute attente, SMc01003 agit également sur des substrats à chaîne courte tels que le butyrate de p - nitrophényle ou p - nitrophényle octanoate (données non présentées). Cependant, ces derniers sont également des substrats dégradés par des activités présentes dans des extraits exempts de cellules de E. coli (ie, hébergeant le vect videou pET17b) sans exprimer aucun gène supplémentaire et avec des substrats à chaîne courte (C4), la moitié du substrat est déjà dégradé par E. enzymes propres coli (données non présentées). De toute évidence, SMc01003 doit être purifié afin de préciser si SMc01003 fonctionne aussi bien sur des substrats à court, moyen et à longue chaîne. En général, les esters de p - nitrophényle acyles semblent pas être de bons substrats pour SMc01003 qui pourrait être compréhensible sachant que SMc01003 est en réalité une lipase GAD 11. Extraits exempts de cellules, dans lequel smc00930 avait été exprimées, présentent des activités enzymatiques beaucoup plus élevées avec des esters p - nitrophényle (tableau 4). En outre, SMc00930 est capable d'hydrolyser les esters de p - nitrophényle acyle de longueurs de chaînes différentes (C10, C12, C14, C16 et C18), bien que la p - nitrophényle palmitate (activité spécifique 5,5 mmol NP min - 1 mg de protéine - 1) est clairement meilleur substrat pour SMc00930. À ce jour, le physiolosubstrat pour SMc00930 gique est inconnue.

Exploration Que ce soit Polar Lipids peut fonctionner comme substrats pour prédites (phospho) lipases

Une fois (phospho) lipase test enzymatique a été optimisé avec des substrats artificiels, des mélanges de lipides radiomarqués ou lipides purs peuvent être testés en tant que substrats potentiels.

Lors du dosage SMc00171 contenant des extraits exempts de cellules avec 14 C marqué par ordinateur dans des conditions optimisées, on peut montrer que SMc00171 dégrade PC DAG, un résultat qui a été confirmée par des études de spectrométrie de masse 8. SMc00171 dégrade également marqué au 32P PC phosphocholine et donc agit comme un PC spécifique de la phospholipase C (PLCP) 8, qui est induite dans des conditions de phosphore limitant la croissance.

Quanddosage SMc00930- ou SMc01003 contenant des extraits exempts de cellules avec un total de 14 C ou 32 lipides polaires P-marquée dans des conditions optimisées, nous avons pu montrer que aucun des phospholipides est dégradé par SMc00930 ou SMc01003 dans des conditions où les esters p - nitrophényle acyl fonctionnaient 11 en tant que substrats. En revanche, une phospholipase A2 commerciale de venin de serpent est capable de dégrader un tel mélange de 11 phospholipides. Ces résultats sont surprenants et inattendus à la fois, SMc00930 et SMc01003, ont été prévus pour être patatine comme phospholipases.

Lorsque le dosage SMc00930- ou SMc01003 contenant des extraits exempts de cellules avec 14 C- diacylglycérol marqué (DAG) dans des conditions optimisées, nous avons pu montrer que DAG est pas dégradé par SMc00930 ou par des extraits exempts de cellules de E. coli, alors que SMc01003 dégrade DAG et forme des composés qui migrent comme les acides gras libres (Figure 3). Récemment , nous avons pu montrer que SMc01003 agit comme une lipase DAG qui peuvent dégrader ou DAG monoacylglycérol en glycérol et en acides gras libres 11 (figure 4).

Figure 3
Figure 3 SMc01003 dégrade diacylglycérol. Extraits exempts de cellules de E. coli BL21 (DE3) pLysS × exprimant SMc01003, ou SMc00930 contenant le vecteur pET17b vide ou un tampon ont été incubées avec 14 C-DAG (obtenu à partir de S. meliloti) pendant 24 heures. A la fin des périodes d'incubation respectives, les lipides radiomarqués sont extraits et séparés par 1D-CCM en utilisant la phase mobile pour la séparation des lipides polaires neutres (voir 4.3.2). FA, les acides gras; DAG, diacylglycérol. Ce chiffre a été modifié depuis [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4. Enzymatic fonction de diacylglycérol lipase DGLA (SMc01003). Diacylglycerol (DAG) lipase SMc01003 dégrade DAG à monoacylglycérol et un acide gras, puis monoacylglycérol dégrade encore au glycérol et un autre acide gras. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Oligonucleotide
prénom
Séquence
(5'-3 ')
Gène
d'intérêt
l' enzyme de restriction
Site ajouté
Vecteur
pour
l' expression
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Ndel pET17b
oLOP150 CAGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho I pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Ndel pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam Hl pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Ndel pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam Hl pET9a
Les lettres en caractères gras indiquent les sites de restriction.

Tableau 1. Les oligonucleotides utilisés pour amplifier et clone prédit phospho (lipase) gènes dans pET17b ou pET9a vecteur. Oligonucléotides amorces ont été conçues en utilisant le logiciel décrit 15.

Dosage pour SMc00171 Dosage pour SMc01003 Dosage pour SMc00930
Stock Composant
Tris-HCl, pH 8,5 25 ul
2 M Tris-HCl, pH 9,0 25 ul
1 H diéthanolamine-HCl, pH 9,8 50 ul
1 H NaCl 40 ul 150 ul 150 ul
1% Triton X-100 200 ul 200 ul
50 mM , p- nitrophényl palmitate 12,5 pi 12,5 pi
200 mM bis- phosphate de p - nitrophényle 2,5 ul
extrait exempt de cellules (1 mg protein / ml) avec du gène candidat exprimé 20 ul 100 ul 1 ul
eau bidistillée 887,5 pi 512,5 pi 611,5 pi
Le volume final 1 ml 1 ml 1 ml

Tableau 2. Régimes de pipetage pour optimiser les dosages enzymatiques avec des substrats d'ester de nitrophényle p artificielle.

Dosage pour la phospholipase C smc00171 -encodés Dosage pour smc01003 - codé DAG lipase Dosage optimisé pour une activité phospholipase
Stock Composant
2 M Tris-HCl pH 8,5 2,5 ul
2 M Tris-HCl pH 9,0 2,5 ul
100 mM MnCl2 3 ul
1 H Diéthanolamine-HCl à pH 9,8 5 ul
1 H NaCl 4 ul 15 ul 15 ul
1% Triton X-100 2 ul 20 ul 20 ul 14 C marqué par des lipides (phospholipides) 20 ul (5000 cpm)
14 C marqué par des lipides (PC) 20 ul (5000 cpm)
14 C marqué lipidique (DAG) 20 ul (5000 cpm)
10 mg / ml extrait de protéine avec des gènes candidats exprimés 0,5 ul 5 ul 5 ul
eau bidistillée 87,5 pi 77,5 pi 77,5 pi
Le volume final 100 ul 100 ul 100 ul

Table3. systèmes de pipetage pour les dosages d'enzymes optimisées pour (phospho) lipases avec des substrats lipidiques radiomarqués.

l'activité est donnée en unités (pmol nitrophénol / mg de protéine x min)
Les chiffres en gras indiquent acyl longueur de chaîne de substrat d'ester p - nitrophényle de dix 12 14 16 18
Extrait de E. coli (fond) 16 ± 0,3 10 ± 1,1 13 ± 0,3 11 ± 0,8 10 ± 0,6
SMc00930 exprimé dans E. extrait coli 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003 exprimé dans E. extrait coli 43 ± 2,1 29 ± 2 20 ± 0,7 25 ± 1,5 22 ± 0,9
SMc00930 minus fond 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 minus fond 27 ± 2,1 18 ± 2 7 ± 0,7 14 ± 1,5 12 ± 0,9

Tableau 4. p esters nitrophényle acyles comme substrats pour les lipases de patatine comme SMc00930 et SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Au cours des 20 dernières années, les génomes de nombreux organismes ont été séquencés et même si un grand nombre de données de séquence du génome a été générée, l'interprétation fonctionnelle est à la traîne et entrave donc notre compréhension du fonctionnement du génome. fonctions de gènes dans les génomes sont souvent attribués en fonction de similarité avec des gènes de la fonction ou l'apparition de motifs conservés connu. Cependant, la fonction précise d'un gène donné est souvent inconnue. Surtout, prédit gènes de structure pour les enzymes ne peuvent pas être facilement explorés par des techniques omiques en raison du fait que la plupart des enzymes catalysent les réactions complexes impliquant deux substrats et deux produits. À l'heure actuelle, il semble plus possible d'explorer des spécificités de substrat pour des groupes d'enzymes où au moins un substrat est fixé et que l'autre peut être modifiée. Par exemple, dans la plupart des eucaryotes, des motifs de phosphorylation des protéines et des peptides sont connus consensus pour la kinase ont été repérés sur des supports solides pour générer des peptides ardes rayons. L' utilisation de ces réseaux et de l' ATP radiomarqué, des spécificités de substrat et les niveaux de kinases distinctes d'un organisme d'activité peut être déterminée permettant l'établissement d'un profil de kinome et définissant substrat spécificités 24. Hydrolases composent un autre grand groupe d'enzymes pour lesquelles un substrat, l'eau, est fixe, mais dont la nature précise de la (autre) substrat à hydrolyser est souvent inconnue. Le fait que, pour une nouvelle enzyme les conditions de dosage optimales ne sont pas connus, soit, convertit la détection d'une nouvelle activité enzymatique dans un problème à variables multiples. Il peut donc aider à être en mesure de fixer le substrat à hydrolyser afin de définir les conditions dans lesquelles l'enzyme fonctionne le mieux.

Dans le présent manuscrit, nous décrivons l'optimisation des conditions d'essai pour prospective (phospho) lipases avec des spécificités de substrat inconnus et élaborons comment employer ces conditions optimisées dans la recherche pour le substrat naturel de la reperspective (phospho) lipase. La signification de la présente technique réside dans le fait que l'hydrolyse des substrats artificiels chromogènes ou fluorogènes, qui imitent, des substrats naturels dans une certaine mesure, peut être suivie par spectrophotométrie 25 et que ces tests sont facilement applicables à grande échelle des études 26. En raison de la sensibilité de ces dosages et leur simplicité de suivre la réaction, ils peuvent être facilement optimisées pour une enzyme donnée. Il est évident que , pour les substrats artificiels on pourrait attendre des constantes cinétiques moins favorables (c. -à K élevé M, faible k cat) pour une enzyme spécifique que pour les substrats naturels 1,21. Dans la pratique, cependant, la disponibilité facile et détectabilité des substrats artificiels fonctionnant comme (mauvais) des substrats pour des groupes entiers d'enzymes souvent plus que compenser les inconvénients. Une fois avoir rencontré les conditions pour une enzyme à travailler (avec le substrat artificiel), il le fera avec la natural / substrat physiologique aussi bien. Comme la préparation et l'isolement des substrats lipidiques potentiels peuvent être laborieux et de longue haleine, il est important d'avoir l'assurance qu'une enzyme est prête à travailler lors de la combinaison et l'incubation avec des substrats précieux. Fait important, la procédure de la première optimisation des conditions pour une enzyme de travailler, permettra une identification plus rapide du substrat physiologique pour une nouvelle (phospho) lipase. Comme une preuve de concept, nous avons réussi à employé cette méthode pour la caractérisation des spécificités de substrat de lipases SMc00171, SMc00930 et SMc01003 8,11. En revanche, de nombreuses méthodes alternatives traditionnelles établissant des essais pour les activités (phospho) lipase impliquent des réactions où substrat et le produit sont déjà connus.

Il est évident que des modifications des analyses pour détecter une activité enzymatique optimale peut comprendre l'utilisation d'autres fluorogénique, chromogénique, ou autre substrats artificiels marqués, la variationd'enzyme concentration, le type et la concentration des tampons, ou d' autres additifs (c. -à- détergents ou des cations bivalents). Si aucune activité enzymatique est détectée avec des substrats artificiels, l'enzyme respective simplement pourrait ne pas fonctionner avec ce substrat, mais le dépannage dans de tels cas devrait certainement inclure d'avoir l'assurance que toutes les précautions avaient été prises qui auraient été nécessaires pour maintenir l'activité de l'enzyme intacte (c. -à stocker des extraits exempts de cellules à 4 ° C ou à des températures plus basses , jusqu'à l' utilisation et, si nécessaire, en ajoutant des cocktails d'inhibiteurs de la protéase à des extraits exempts de cellules, afin d'éviter la dégradation protéolytique de l'enzyme d'intérêt) 27.

Limites de la technique présentée dans ce manuscrit sont dues au fait que le substrat artificiel et le substrat naturel sont différentes les unes des autres et par conséquent , les bioénergétique pour la réaction catalysée sera ainsi 1. Les différentes paramètres des conditions optimales d'activité de l'enzyme doivent être établies également pour le substrat naturel (par variation du pH, du type de tampon, un tampon de force, des concentrations de NaCl et des détergents tels que le Triton X-100, l'absence ou en présence de différents cations bivalents), car ils pourraient se révéler légèrement différente des conditions optimales rencontrées pour le substrat artificiel. Une autre limitation importante est que probablement tous les (phospho) lipases ne sont pas détectables par l'utilisation de substrats chromogènes artificiels. Par exemple, le résidu p - nitrophényle artificiel des substrats de type ester peut être simplement trop volumineux, ou présenter d' autres propriétés chimiques qui empêchent qu'un tel substrat peut obtenir un accès au site actif d'une enzyme. Il a été noté que la lipase DAG SMc01003 affiche une faible activité avec tous les substrats de type ester p - nitrophényle de différentes longueurs de chaîne 11. Avec les connaissances que DAG est le substrat naturel pour SMc01003 et que DAG a un reltivement petit groupe de tête polaire, constitué par le glycérol seulement 11, il est facilement imaginable que le résidu p - nitrophényle volumineux est tout simplement trop grand pour un accès facile au site actif de SMc01003. Cependant, les détails moléculaires pourquoi les esters de nitrophényle p ne sont pas de bons substrats pour SMc01003 ne sont pas connus à ce stade.

Les étapes critiques au sein du protocole comprennent toutes les dispositions prises pour garantir que l'enzyme étudiée a accès au substrat respectif. Par exemple, dans la recherche du substrat lipidique physiologique, il est essentiel que le substrat lipidique est fourni sous une forme solubilisée. Par conséquent, lors de la mise en place de tels dosages enzymatiques (décrit dans 5 du protocole), des substrats lipidiques, généralement dissous dans des mélanges de methanol et de chloroforme, doit être mélangée avec une solution aqueuse d'un détergent, à savoir, le Triton X-100, avant le séchage vers le bas le mélange avec de l'azote gazeux. Cette procédure garantit que, après avoir ajouté les autres ingréingré- pour le dosage, le substrat lipidique potentiel est incorporé dans des micelles de détergent et comme tel accessible pour l'enzyme au cours de l'essai.

Principalement, la technique présentée ici devrait être largement applicable à l'avenir pour la découverte de nouveaux (phospho) lipases et pour la définition de leurs substrats naturels. La technique est facilement extensible pour les autres classes de hydrolases, mais il pourrait être plus compliqué à développer des essais avec des substrats artificiels pour de nouvelles enzymes qui nécessitent deux, généralement inconnus, des substrats pour compléter leur cycle catalytique.

Pour prédites (phospho), des lipases ou des phosphatases ni le substrat approprié est connu ni les conditions d'essai dans lequel l'enzyme fonctionne bien. Par conséquent, il pourrait être utile d'étudier si certains composés à partir d' une pile de composés artificiels, tels que des composés contenant des nitrophényl-p distincts (p -nitrophényle, le phosphate de bis - p - nitrophényl phosphate, p - nitrophényle palmitate), peut fonctionner en tant que substrat. La découverte des activités enzymatiques initiales avec des substrats artificiels a ouvert la voie pour résoudre ce SMc00171 est spécifique au PC phospholipase C 8, qui SMc01003 est une lipase de DAG 11, et a aidé à définir les conditions dans lesquelles SMc00930 agit comme une hydrolase 11. De toute évidence, le substrat naturel de SMc00930 est actuellement encore inconnu et les contextes physiologiques de SMc00930 et SMc01003 sont encore à résoudre. Par conséquent, la tâche de proposer une fonction physiologique pour une lipase prédite est difficile et pas toujours immédiatement rencontré le succès. Utilisation de mutants déficients du gène de la lipase prédite et en les comparant à la souche de type sauvage respective pourrait donner des preuves expérimentales que la lipase agit avec la spécificité dans sa souche native de fond qui a été postulé dans la partie 4) du protocole. De toute évidence, la demande d'une nouvelle activité de la lipase should être étayée par des preuves in vitro qu'un certain substrat est converti par hydrolyse en produits définis. Parfois, la fonction physiologique postulée pourrait combler les lacunes dans les voies métaboliques ou d'expliquer le comportement physiologique de l'organisme producteur, mais dans d'autres cas, il suffit encore peut-être pas suffisamment de connaissances biochimiques pour donner un sens de certaines activités. Au cours de nos études, nous avons identifié plusieurs enzymes qui agissent sur les lipides des membranes intrinsèques polaires des bactéries dégradant les et, dans certains cas, de les convertir en un joueur dans les cycles de lipides complexes. Par exemple, en combinant les nouvelles connaissances que SMc00171 est un spécifique au PC phospholipase C (PLCP) 8 qui est induite dans des conditions de phosphore limitant de la croissance, avec des données préexistantes, on peut postuler un nouveau cycle de DAG qui pourrait exister dans de nombreux proteobacteria environnement et ce qui donne lieu à la formation des lipides de la membrane sans phosphore lorsque le phosphore est limitant la croissance. Dans contrast, lorsque l' approvisionnement en phosphore sont abondantes, DAG est rephosphorylé à l' acide phosphatidique entrant dans la biosynthèse de novo phospholipide, fermant ainsi ce cycle de lipides et de faire en sorte que principalement (glycéro) phospholipides sont présents dans la membrane 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Ce travail a été soutenu par des subventions de Consejo Nacional de Ciencias y Tecnología-México (CONACyT-Mexique) (82614, 153998, 253549 et 178359 dans Investigación Científica Básica ainsi que 118 à Investigación en Fronteras de la Ciencia) et de Dirección General de Asuntos de Personal Académico-Universidad Nacional Autónoma de México (UNAM DGAPA-; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Définition Substrat Spécificités pour lipase et phospholipase candidats
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter